Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers

Plant Breeding and Biotechnology 2016;4(1):71-78.
Published online: February 28, 2016

1Department of Herbal Crop Research, National Institute of Horticultural and Herbal Science, Rural Development Administration, Eumseong 27709, Korea

2Department of Biological Science, Kongju National University, Gongju 32588, Korea

3Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea

*Corresponding author: Yi Lee, leeyi22@cbnu.ac.kr, Tel: +82-43-261-3373, Fax: +82-43-261-3373
• Received: January 26, 2016   • Revised: January 26, 2016   • Accepted: January 28, 2016

Copyright © 2016 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 24 Views
  • 0 Download
  • 10 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Development of Genomic SSR Markers to Reveal the Genetic Diversity in Trichosanthes kirilowii from Korea
    Jun-Su Kim, Raveendar Sebastin, Du-Hyun Baek, Yun-Sook Kim, Yong-Nam Cho, Doyun Kim, Tae-Young Heo, Jong-Wook Chung, Jae-Young Heo
    Molecular Biotechnology.2026; 68(6): 2927.     CrossRef
  • Genetic diversity of Panax ginseng cultivated in Japan and its relation with some plant characteristics
    Honoka Ito, Michiho Ito
    Journal of Natural Medicines.2024; 78(1): 91.     CrossRef
  • Development and authentication of Panax ginseng cv. Sunhong with high yield and multiple tolerance to heat damage, rusty roots and lodging
    Jiho Seo, Joon-Soo Lee, Sung-Lye Shim, Jun-Gyo In, Chol-Soo Park, Yong-Jae Lee, Hee-Jun Ahn
    Horticulture, Environment, and Biotechnology.2023; 64(5): 753.     CrossRef
  • Comparative metabolic profiling of root, leaf, fruit, and stem tissues of Panax notoginseng
    Rui Shi, Bingjie Xiong, Shu He, Can Liu, Jiftah Ben-Asher, Abraham Rami Horowitz, Shu Wang, Xiahong He
    International Journal of Food Properties.2022; 25(1): 1132.     CrossRef
  • Investigation of Morphological Characteristics and Genetic Diversity of Adenophora triphylla (Thunb.) A. DC. Using SSR Markers
    Dae Hui Jeong, Yurry Um, Yeong Bae Yun, Jeong Hoon Huh, Jiah Kim, Hong Woo Park
    Korean Journal of Medicinal Crop Science.2022; 30(6): 411.     CrossRef
  • Development of Whole Genome Sequence-based Novel SSR Markers in Astragalus membranaceus (Fisch.)
    Mok Hur, Yurry Um, Yi Lee, Yoon Jeong Lee, Sung Cheol Koo, Woo Tae Park, Jang Hoon Kim, Yun Chan Huh, Youn Ho Moon
    Korean Journal of Medicinal Crop Science.2021; 29(6): 418.     CrossRef
  • De novo assembly and Transcriptome characterization of an endemic species of Vietnam, Panax vietnamensis Ha et Grushv., including the development of EST-SSR markers for population genetics
    Dinh Duy Vu, Syed Noor Muhammad Shah, Mai Phuong Pham, Van Thang Bui, Minh Tam Nguyen, Thi Phuong Trang Nguyen
    BMC Plant Biology.2020;[Epub]     CrossRef
  • Silicon foliage spraying improves growth characteristics, morphological traits, and root quality of Panax ginseng C.A.Mey
    Soo-won Jang, Nooruddin Bin Sadiq, Muhammad Hamayun, Jehyeong Jung, Taeksung Lee, Jung-Seok Yang, Bokyung Lee, Ho-Youn Kim
    Industrial Crops and Products.2020; 156: 112848.     CrossRef
  • Genetic Diversity of Angelica gigas Nakai Collected in Korea using Genome-Wide SSR Markers
    Dae Hui Jeong, Yun Mi Park, Ki Yoon Kim, Hong Woo Park, Kwon Seok Jeon, Mahn Jo Kim, Jin Su Gil, Yi Lee, Yurry Um
    Korean Journal of Medicinal Crop Science.2019; 27(6): 376.     CrossRef
  • Whole genome re-sequencing and development of SSR markers in oriental melon
    Woon-Ho Song, Sang-Min Chung
    Journal of Plant Biotechnology.2019; 46(2): 71.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers
Plant Breed. Biotech.. 2016;4(1):71-78.   Published online February 28, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers
Plant Breed. Biotech.. 2016;4(1):71-78.   Published online February 28, 2016
Close

Figure

  • 0
Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers
Image
Fig. 1 Dendrograms showing genetic similarities among eight cultivars of ginseng, constructed using the Panax ginseng cultivars and Panax species similarity coefficient based on eight SSR markers (unweighted pair group method with arithmetic mean algorithm). Cultivars in Chunpoong (C), Yunpoong (Y), Gopoong (GO), Gumpoong (GU), Jakyung (J), Hwangsook (H), P. quinquefolius (PQ), P. notoginseng (PN). Group I contained C, Y, GO, and J. Group II contained GU and H. Group III contained P. quinquefolius and P. notoginseng.
Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers

Source of the Panax species and Panax ginseng cultivars used in this study.

Species Cultivar Accession No. of sample
P. ginseng Chunpoong KT&Gz) 17
Yunpoong KT&G 22
Gopoong Local 15
Gumpoong Local 10
Jakyungjong KT&G 23
Hwangsookjong Local 20
P. quinquefolius NIHHS 5
P. notoginseng NIHHS 3

z)KT&G: name of a Korean ginseng corporation, NIHHS: National Institute of Horticultural and Herbal Science.

Frequencies of microsatellite repeat types in the Panax ginseng sequence collections.

Repeat type Simple sequence repeat
Di-nucleotide 8,279 (60.1)
Tri-nucleotide 3,832 (27.8)
Tetra-nucleotide 1,070 (7.8)
Penta-nucleotide 371 (2.7)
Hexa-nucleotide 153 (1.1)
Hepta-nucleotide 48 (0.3)
Octa-nucleotide 16 (0.1)
Total 13,769 (100.0)

Values are presented as number (%).

Abundant SSR motives in the Panax ginseng database. Motifs accounting for 4.9% or more of each repeat type are included*.

Variable SSR motif
AC/GT 990 (12.0)
AG/CT 1,240 (15.0)
AT/AT 1,655 (20.0)
CA/TG 1,403 (16.9)
GA/TC 1,340 (16.2)
TA/TA 1,428 (17.2)
AGA/TCT 192 (5.0)
ATA/TAT 419 (10.9)
TTG/CAA 215 (5.6)
GAA/TTC 220 (5.7)
TAA/TTA 377 (9.8)
TCA/TGA 189 (4.9)
AAAT/ATTT 65 (6.0)
TAAA/TTTA 62 (5.7)

Values are presented as number (%).

*SSR: simple sequence repeat.

Characteristics of 8 SSR markers including GenBank accession, repeat motif, primer sequence, allele size range, number of alleles, genetic diversity, heterozygosity, and PIC among 8 cultivars of Panax species*.

Marker ID GenBank accession Repeat motif Forward primer (5′→3′) Allele size range (bp) No. of allele Genetic diversity (h) Heterozygosity PIC
PgSSR07 GU565701 (GAA)18 VIC-ATGGAAGTGGTTTGTGTTGG
AGGAGACCATGAAGGATTCG
204–276 3 0.34 0.26 0.32
PgSSR08 EF531909 (GAAA)6 NED-CCTGCTGGAGATTGAAGTCAT
GTTGGAATGCTTCAGCAGAT
180–207 5 0.61 0.59 0.55
PgSSR09 GU565702 (AG)13 FAM-TGGATGATTTCGACATTTCTG
CCGTTCAACTAACCCCAAAC
164–204 3 0.51 0.59 0.42
PgSSR17 BZ957342 (GGAACC)3 PET-ATCAGAACCGGAACTGGAAC
CTGAATTACCGAACCGAACC
103–118 3 0.21 0.08 0.20
PgSSR37 EF140892 (ATG)7(CTGATG)2 FAM-AATCAGAAACAAAGAAAGCTAAAAC
CTCTCTCATCTCTCTCTCTTCC
100–122 5 0.73 0.36 0.69
PgSSR40 EF140893 (ATAG)2 VIC-GTAGTAGTAGTAAAACTTTGCTAACG
ATTTACAACTCTCTTCTTCCTCTAC
125–162 3 0.32 0.28 0.28
PgSSR51 EF140899 (AAG)9 NED-GGAGGTGATTGATGTAGTGGAATCC
GGCTCTCCTATACTCACTATTTCCC
299–330 8 0.78 0.34 0.76
PgSSR53 EF140900 (CTCCTTT)4 PET-CTACACGCTTTTTCATAGCTTACA
TGTCTGCATAAAAGAGTTCGAGGC
185–194 3 0.13 0.07 0.13
Average 4.13 0.45 0.32 0.42

*SSR: simple sequence repeat, PIC: polymorphic information content.

Table 1 Source of the Panax species and Panax ginseng cultivars used in this study.

KT&G: name of a Korean ginseng corporation, NIHHS: National Institute of Horticultural and Herbal Science.

Table 2 Frequencies of microsatellite repeat types in the Panax ginseng sequence collections.

Values are presented as number (%).

Table 3 Abundant SSR motives in the Panax ginseng database. Motifs accounting for 4.9% or more of each repeat type are included*.

Values are presented as number (%).

SSR: simple sequence repeat.

Table 4 Characteristics of 8 SSR markers including GenBank accession, repeat motif, primer sequence, allele size range, number of alleles, genetic diversity, heterozygosity, and PIC among 8 cultivars of Panax species*.

SSR: simple sequence repeat, PIC: polymorphic information content.