Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers

Plant Breeding and Biotechnology 2016;4(1):71-78.
Published online: February 28, 2016

1Department of Herbal Crop Research, National Institute of Horticultural and Herbal Science, Rural Development Administration, Eumseong 27709, Korea

2Department of Biological Science, Kongju National University, Gongju 32588, Korea

3Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, KoreaJFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

*Corresponding author: Yi Lee, leeyi22@cbnu.ac.kr, Tel: +82-43-261-3373, Fax: +82-43-261-3373
• Received: January 26, 2016   • Revised: January 26, 2016   • Accepted: January 28, 2016

Copyright © 2016 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 245 Views
  • 0 Download
  • 10 Crossref
prev next
  • Panax ginseng has been one of the most important herbal medicines used in Eastern Asia. Recently, various molecular markers have been developed to authenticate Panax species, but these markers cannot differentiate the exact varieties or variants of Korean ginseng cultivars. In this study, six cultivars of Korean ginseng (Chunpoong, Yunpoong, Gopoong, Gumpoong, Jakyung, and Hwangsook), P. quinquefolius, and P. notoginseng were differentiated by simple sequence repeat (SSR) marker development. Specific primer sets were designed for the 54 candidate sequences containing SSRs that were predicted. Finally, eight polymorphic SSR loci were developed. DNA fragment analysis was performed using fluorescence-labelled primers for the amplicons. Reproducibility tests were carried out using multiple samples of Korean ginseng cultivars and Panax species. Eight primer sets (PgSSR07, PgSSR08, PgSSR09, PgSSR17, PgSSR37, PgSSR40, PgSSR51, and PgSSR53) showing polymorphism were used for phylogenetic relationship analysis. Consequently, six Korean ginseng cultivars (Chunpoong, Yunpoong, Gopoong, Gumpoong, Jakyung, and Hwangsook), P. quinquefolius, and P. notoginseng could be identified using the combination of SSR markers discovered.
Korean ginseng (Panax ginseng, C.A. Meyer) is an herbaceous perennial plant of the genus Panax (Araliaceae). Korean ginseng is a plant that grows only in the Far East areas, as in Asia, China, Manchuria, and Russia (Woo et al. 2004). The main physiologically active components of ginseng are saponins, phenols, polyacetylenes, alkaloids, and polysaccharides (Lee et al. 2008). These components act on the central nervous, cardiovascular, endocrine, and immune systems, and are recently reported to have antioxidant and anti-stress effects (Nam et al. 2005).
In general, the Panax genus is divided into nine species: P. ginseng, P. notoginseng, P. quinquefolius, P. japonicus, P. pseudoginseng, P. assamicus, P. sokpayensis, P. sikkimensis, and P. bipinnatifidus (Sharma and Pandit 2009). However, the number of Panax species is unclear because several scholars define the same species differently. Many studies identify plants species and varieties using morphological, cytological, anatomical, physiological, and ecological methods (Woo et al. 2004; Yu et al. 2009; Jee et al. 2014; Bai et al. 2015; Kim et al. 2015). Using such morphological characteristics to distinguish among varieties can lead to confusion because expression may be the result of a combination of genetics and environment (Jo et al. 2013). Furthermore, molecular techniques have added another level of classification through study of DNA (Lim and Choi 1990; Lim et al. 1993; Hon et al. 2003). In order to identify the plant species, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNAs (RAPD), amplified fragment length polymorphism (AFLP), and simple sequence repeat (SSR) were used (Powell et al. 1996). SSR markers, or microsatellites, are abundantly dispersed within the genome and have been widely used as genetic markers. SSR markers are very useful for a spectrum of genetic and breeding applications because of their reproducibility, co-dominant inheritance, multi-allelic nature, and genome coverage (Powell et al. 1996; Kim et al. 2007; Silva et al. 2013).
Recently, researchers reported the development of ginseng SSR markers and genetic analysis among national collection species (Park et al. 2009), genetic diversity analysis between wood-cultivated ginseng and field-cultivated ginseng (Jo et al. 2009), as well as identification of P. ginseng and P. notoginseng (Ahn et al. 2009). Besides, many researchers have tried to identify ginseng species and varieties using SSR markers (Kim et al. 2007; Ma et al. 2007; Nguyen et al. 2010; Bang et al. 2011a, 2011b). SSR markers are important for several types of research, including the assessment of genetic diversity, development of genetic maps, comparative genomics, marker-assisted selection, and other plant breeding fields. However, there are few studies on genetic polymorphism analyses of domestic cultivars using SSR markers. These studies were inconclusive because the ginseng genome is very large (3.12 billion base pairs) and there are many recently developed varieties. Therefore, the development of more markers is necessary for molecular breeding and variety identification.
The aim of this research was to develop SSR markers from Korean ginseng cultivars and differentiate the P. ginseng cultivars and Panax species. The SSR markers were identified from the database which was constructed using an enriched SSR library and the polymorphism of the markers was investigated using DNA fragment analysis.
Plant materials and DNA extraction
This study was carried out with 115 Panax accessions grown in Korea. Panax samples used in this study were Korean ginseng cultivars (17 Chunpoong, 22 Yunpoong, 15 Gopoong, 10 Gumpoong, 23 Jakyung, and 20 Hwangsook) collected from various local fields in Goesan and Suwon, Korea. Moreover, 5 P. quinquefolius and 3 P. notoginseng were obtained from KT&G cooperation company (Daejeon, Korea) and National Institute of Horticultural and Herbal Science (Eumseong, Korea), respectively (Table 1). One hundred mg of fresh leaves were used for genomic DNA extraction using TissueLyser (Qiagen, Düsseldorf, Germany) and the DNeasy plant DNA isolation kit (Qiagen GmbH, Hilden, Germany).
SSR detection and specific primer design
A total of 3,773 DNA sequences of P. ginseng were collected through downloading of 2,549 genome survey sequences from the National Center for Biotechnology Information (NCBI) database and 1,224 microsatellite-enriched library (MEL) sequences from the data collected by Kim et al. (2007). Putative Panax MEL sequences were analyzed by the SSR identification tool (http://www.gramene.org/db/markers/ssrtool) program. Primer pairs flanking the SSRs were designed using the Primer3 program (Koressaar and Remm, 2007; Untergrasser et al. 2012) with a length of 18 to 25 bp, amplification product size of 100 to 500 bp, annealing temperature (Tm) ranging from 54°C to 60°C, and GC content between 40% and 60%.
Polymerase chain reaction (PCR) amplification and data analysis
Twenty μl of PCR mixture contained 10 pmole primers (fluorescence-labeled primer), 10 ng of genomic DNA, 0.1 mM dNTP, 0.2 units Taq DNA polymerase (RBC Bioscience, New Taipei City, Taiwan) and 10× Taq polymerase buffer using a T-gradient Thermoblock PCR system (Biometra, Göttingen, Germany) for 35 cycles. The initial cycle was pre-denaturation for 5 minutes at 94°C, denaturation for 30 seconds at 94°C, annealing for 1 minute at 59°C, and extension for 1 minute at 72°C (for the final cycle, 5 minutes added). Electrophoresis was performed using a 10% polyacrylamide gel. Polymorphic bands were visualized by gel staining using Gelstar (Lonza Inc., Rockland, ME, USA) and photographed under UV Transilluminator (CoreBio System Co., Seoul, Korea). Polymorphic amplicons visualized on polyacrylamide gels were separated in agarose gel electrophoresis. To verify the accuracy of ginseng SSR polymorphisms, the forward primer was labeled and tested on 6 Korean ginseng cultivars, P. quinquefolius and P. notoginseng. DNA fragment profile data were demonstrated by the SSR markers PgSSR08 and PgSSR51 using NED-labelled primers; PgSSR09 and PgSSR37 using FAM-labelled primers; PgSSR07 and PgSSR40 using VIC-labelled primers; and PgSSR17 and PgSSR53 using PET-labelled primers. Then, we preformed capillary electrophoresis using an ABI3730xl DNA analyzer with GeneScan-500LIZ size standard (Applied Biosystems, Foster City, CA, USA). Based on the resulting data, allele sizes were measured in terms of the numbers of alleles, gene diversity, and polymorphic information content (PIC), using PowerMarker software ver. 3.23 (Liu and Muse 2005). Coefficients of genetic similarity for the eight species used in this study were calculated using the SIMQUAL program (NTSYS-pc, ver. 2.10; Mogea 1999). A neighbor-joining dendrogram was constructed based on a genetic similarity matrix created in the SHAN clustering program from NTSYSpc using the unweighted pair group method with arithmetic mean algorithm.
Abundance and distribution of SSRs
A total of 3,773 sequences were collected and used for the finding of SSRs, defined as di-to octa-nucleotide motifs. Thus, 1,283 sequences (34% of the total sequences) contained SSRs and a total of 13,769 in silico SSR markers were identified. The observed frequencies of di-, tri-, tetra-, penta-, hexa-, hepta-, and octa-nucleotide repeats were 60.1% (n=8,279), 27.8% (n=3,832), 7.8% (n=1,070), 2.7% (n=371), 1.1% (n=153), 0.3% (n=48), and 0.1% (n=16), respectively (Table 2).
Among the dinucleotide repeats, (AT/AT)n and (TA/TA)n were the most abundant repeat motifs and represented 20.0% and 17.2% of dinucleotides, respectively. Among the trinucleotide repeats, (ATA/TAT)n and (TAA/TTA)n were most abundant, with each accounting for approximately 10% of the trinucleotides. Among the tetranucleotide repeats, (AAAT/ATTT)n and (TAAA/TTTA)n were most abundant, with each accounting for approximately 6% of the tetranucleotides (Table 3).
Gel electrophoresis of SSR motifs and DNA fragment analysis
Fifty-four putative SSR markers were validated for polymorphic markers. The allelic structures of the markers were determined from DNA band patterns from Gelstar stained 10% polyacrylamide gels (data not shown). Finally, eight markers—PgSSR07, PgSSR08, PgSSR09, PgSSR17, PgSSR37, PgSSR40, PgSSR51, and PgSSR53—amplified polymorphic PCR product bands among Korean ginseng cultivars. The products were analyzed using the DNA fragment analysis method.
A total of eight SSR loci showed polymorphism, producing a total of 33 alleles among the eight Panax species. The observed number of alleles ranged from three (PgSSR07, PgSSR09, PgSSR17, PgSSR40, and PgSSR53) to eight (PgSSR51), with an average of 4.13 alleles per locus. The genetic diversity of each locus ranged from 0.13 (PgSSR53) to 0.78 (PgSSR51), with an average of 0.45. In addition, the heterozygosity values ranged from 0.07 (PgSSR53) to 0.59 (PgSSR08 and PgSSR09), with an average of 0.32. PIC values were calculated for each polymorphic marker using the method of Roldán-Ruiz et al. (2000). For all accessions, PIC values ranged from 0.13 (PgSSR53) to 0.76 (PgSSR51), with an average of 0.42 (Table 4).
The NTSYSpc software calculated the genetic distances among ginseng cultivars. The eight cultivars were divided into three groups: I, II, and III (Fig. 1). The six Korean ginseng cultivars were divided into two groups. Group I contained Chunpoong, Yunpoong, Gopoong, and Jakyung. Group II contained two cultivars, Gumpoong and Hwangsook. Group III contained P. quinquefolius and P. notoginseng.
P. ginseng is one of the most important medicinal plants in Korea. Several cultivars that have different characteristics have been developed. For instance, Yunpoong is a cultivar that produces a higher yield than other cultivars and Chunpoong has good root shape and is suitable for red ginseng production (Lee 2002). Thus, molecular markers are needed to identify the cultivars for optimum utilization and further breeding. Previous researchers have developed various molecular markers—RAPD (Um et al. 2001; Cui et al. 2003; Shim et al. 2003; Lim et al. 2007), RFLP (Yang and Kim 2003), AFLP (Ha et al. 2002; Choi et al. 2008), STS (Bang et al. 2010), and SSR (Bang et al. 2011a, 2011b)—for identification of ginseng cultivars. But, it was not sufficient to identify all the Korean ginseng cultivars.
In this study, we collected 3,773 P. ginseng sequences from GSS and MEL databases. The selected primer sets were labeled with fluorescence at the 5′ end of the forward primer for DNA fragment analysis. The DNA fragment analysis method with different fluorescent colors made it easy to analyze the genetic diversity. Especially for the similar-sized PCR products, labeling using different colors made it possible to analyze several markers at the same time. This method is cost- and time-effective for large-sized samples. We used four colors of fluorescent dyes, FAM, NED, PET, and VIC. The product size of PgSSR09 and PgSSR17 was very similar, but it was possible to identify the markers because we used different colored dyes for each marker. Korean ginseng cultivars have very similar genotypes, therefore many markers are needed to differentiate the cultivars. Thus, we performed genotyping using eight SSR markers and DNA fragment analysis.
A dendrogram was constructed using the DNA fragment analysis data. The correlation coefficients between the cultivars were calculated from the genetic distance matrices based on PgSSR07, PgSSR08, PgSSR09, PgSSR17, PgSSR37, PgSSR40, PgSSR51, and PgSSR53 alleles. The correlation coefficients within the I, II, and III groups were 0.77, 0.87, and 0.70, respectively. The correlation coefficients between groups I+II and III was estimated as 0.56 and the coefficient between groups I and II was 0.67. The low correlation coefficiency of the third combination indicates that alleles could come from all of the three genomes instead of only one or two genomes, so that genetic relationships between varieties can be accurately evaluated (Zhang et al. 2002).
Korean ginseng cultivars grouped together. Jakyung and Hwangsook have been cultivated as domestic varieties in Korea for a long time. Chunpoong, Yunpoong, and Gopoong were developed from Jakyung by selective breeding and Gumpoong was developed from Hwangsook by selective breeding. From the results, Chunpoong, Yunpoong, and Gopoong were grouped with Jakyung; and Gumpoong was grouped with Hwangsook. Therefore, dendrogram results are consistent with the history of Korean ginseng cultivars and Panax species. The traditional ginseng classification was based on morphology, so we generated molecular data to establish the Panax species lineage. Some researchers have published molecular markers for the identification of Panax species (Choi et al. 2011; Bang et al. 2012). But there is no report on the DNA fragment analysis method. For this reason, this study provides a very efficient method for classification study and shows the results of marker application using molecular markers in Panax species.
Consequently, our result is a case study demonstrating that SSR markers developed from GSS and MEL sequences of P. ginseng could be used for genetic studies in Panax species and Korean ginseng cultivars. These markers could be used for further research on cultivar development with molecular breeding techniques and conservation of the genetic diversity of the species in the genus. Moreover, the markers could be useful for genetic mapping and eventual marker-assisted selection in the crop. The use of next-generation sequencing will enable more rapid and efficient development of SSR markers.
This work was carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ01102202)”, Rural Development Administration, Republic of Korea.
Fig. 1
Dendrograms showing genetic similarities among eight cultivars of ginseng, constructed using the Panax ginseng cultivars and Panax species similarity coefficient based on eight SSR markers (unweighted pair group method with arithmetic mean algorithm). Cultivars in Chunpoong (C), Yunpoong (Y), Gopoong (GO), Gumpoong (GU), Jakyung (J), Hwangsook (H), P. quinquefolius (PQ), P. notoginseng (PN). Group I contained C, Y, GO, and J. Group II contained GU and H. Group III contained P. quinquefolius and P. notoginseng.
pbb-4-071f1.jpg
Table 1
Source of the Panax species and Panax ginseng cultivars used in this study.
Table 1
Species Cultivar Accession No. of sample
P. ginseng Chunpoong KT&Gz) 17
Yunpoong KT&G 22
Gopoong Local 15
Gumpoong Local 10
Jakyungjong KT&G 23
Hwangsookjong Local 20
P. quinquefolius NIHHS 5
P. notoginseng NIHHS 3

z)KT&G: name of a Korean ginseng corporation, NIHHS: National Institute of Horticultural and Herbal Science.

Table 2
Frequencies of microsatellite repeat types in the Panax ginseng sequence collections.
Table 2
Repeat type Simple sequence repeat
Di-nucleotide 8,279 (60.1)
Tri-nucleotide 3,832 (27.8)
Tetra-nucleotide 1,070 (7.8)
Penta-nucleotide 371 (2.7)
Hexa-nucleotide 153 (1.1)
Hepta-nucleotide 48 (0.3)
Octa-nucleotide 16 (0.1)
Total 13,769 (100.0)

Values are presented as number (%).

Table 3
Abundant SSR motives in the Panax ginseng database. Motifs accounting for 4.9% or more of each repeat type are included*.
Table 3
Variable SSR motif
AC/GT 990 (12.0)
AG/CT 1,240 (15.0)
AT/AT 1,655 (20.0)
CA/TG 1,403 (16.9)
GA/TC 1,340 (16.2)
TA/TA 1,428 (17.2)
AGA/TCT 192 (5.0)
ATA/TAT 419 (10.9)
TTG/CAA 215 (5.6)
GAA/TTC 220 (5.7)
TAA/TTA 377 (9.8)
TCA/TGA 189 (4.9)
AAAT/ATTT 65 (6.0)
TAAA/TTTA 62 (5.7)

Values are presented as number (%).

*SSR: simple sequence repeat.

Table 4
Characteristics of 8 SSR markers including GenBank accession, repeat motif, primer sequence, allele size range, number of alleles, genetic diversity, heterozygosity, and PIC among 8 cultivars of Panax species*.
Table 4
Marker ID GenBank accession Repeat motif Forward primer (5′→3′) Allele size range (bp) No. of allele Genetic diversity (h) Heterozygosity PIC
PgSSR07 GU565701 (GAA)18 VIC-ATGGAAGTGGTTTGTGTTGG
AGGAGACCATGAAGGATTCG
204–276 3 0.34 0.26 0.32
PgSSR08 EF531909 (GAAA)6 NED-CCTGCTGGAGATTGAAGTCAT
GTTGGAATGCTTCAGCAGAT
180–207 5 0.61 0.59 0.55
PgSSR09 GU565702 (AG)13 FAM-TGGATGATTTCGACATTTCTG
CCGTTCAACTAACCCCAAAC
164–204 3 0.51 0.59 0.42
PgSSR17 BZ957342 (GGAACC)3 PET-ATCAGAACCGGAACTGGAAC
CTGAATTACCGAACCGAACC
103–118 3 0.21 0.08 0.20
PgSSR37 EF140892 (ATG)7(CTGATG)2 FAM-AATCAGAAACAAAGAAAGCTAAAAC
CTCTCTCATCTCTCTCTCTTCC
100–122 5 0.73 0.36 0.69
PgSSR40 EF140893 (ATAG)2 VIC-GTAGTAGTAGTAAAACTTTGCTAACG
ATTTACAACTCTCTTCTTCCTCTAC
125–162 3 0.32 0.28 0.28
PgSSR51 EF140899 (AAG)9 NED-GGAGGTGATTGATGTAGTGGAATCC
GGCTCTCCTATACTCACTATTTCCC
299–330 8 0.78 0.34 0.76
PgSSR53 EF140900 (CTCCTTT)4 PET-CTACACGCTTTTTCATAGCTTACA
TGTCTGCATAAAAGAGTTCGAGGC
185–194 3 0.13 0.07 0.13
Average 4.13 0.45 0.32 0.42

*SSR: simple sequence repeat, PIC: polymorphic information content.

  • Ahn CH, Kim BB, Yoon ES, Choi YE. 2009. Development of microsatellite markers to distinguish south Korean and Chinese ginseng. J Korean Forest Sci. 98: 568-575.
  • Bai H, Wang S, Liu J, Gao D, Jiang Y, Liu H, et al. 2015. Localization of ginsenosides in Panax ginseng with different age by matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry imaging. J Chromatogr B Analyt Technol Biomed Life Sci. [Epub ahead of print].
  • Bang KH, Lee JW, Kim YC, Kim DH, Lee EH, Jeung JU. 2010. Construction of genomic DNA library of Korean ginseng (Panax ginseng C. A. MEYER) and development of sequence-tagged sites. Biol Pharm Bull. 33: 1579-1588.
  • Bang KH, Chung JW, Kim YC, Lee JW, Jo IH, Seo AY, et al. 2011a. Development of SSR markers for identification of Korean ginseng (Panax ginseng C. A. Meyer.) cultivars. Korean J Med Crop Sci. 19: 185-190.
  • Bang KH, Jo IH, Chung JW, Kim YC, Lee JW, Seo AY, et al. 2011b. Analysis of genetic polymorphism of Korean ginseng cultivars and foreign accessions using SSR markers. Korean J Med Crop Sci. 19: 347-353.
  • Bang KH, Seo AY, Chung JW, Kim YC, Jo IH, Kim JU, et al. 2012. Analysis of genetic polymorphism and relationship of Korean ginseng cultivars and breeding lines using EST-SSR marker. Korean J Med Crop Sci. 20: 277-285.
  • Choi HI, Kim NH, Kim JH, Choi BS, Ahn IO, Lee JS, et al. 2011. Development of reproducible EST-derived SSR markers and assessment of genetic diversity in Panax ginseng cultivars and related species. J Ginseng Res. 35: 399-412.
  • Choi YE, Ahn CH, Kim BB, Yoon ES. 2008. Development of species specific AFLP-derived SCAR marker for authentication of Panax japonicus C.A. MEYER. Biol Pharm Bull. 31: 135-138.
  • Cui XM, Lo CK, Yip KL, Dong TT, Tsim KW. 2003. Authentication of Panax notoginseng by 5S-rRNA spacer domain and random amplified polymorphic DNA (RAPD) analysis. Planta Med. 69: 584-586.
  • Ha WY, Shaw PC, Liu J, Yau FC, Wang J. 2002. Authentication of Panax ginseng and Panax quinquefolius using amplified fragment length polymorphism (AFLP) and directed amplification of minisatellite region DNA (DAMD). J Agric Food Chem. 50: 1871-1875.
  • Hon CC, Chow YC, Zeng FY, Leung FC. 2003. Genetic authentication of ginseng and other traditional Chinese medicine. Acta Pharmacol Sin. 24: 841-846.
  • Jee HS, Chang KH, Park SH, Kim KT, Paik HD. 2014. Morphological characterization, chemical components, and biofunctional activities of Panax ginseng, Panax quinquefolium, and Panax notoginseng roots: A comparative study. Food Rev Int. 30: 91-111.
  • Jo BH, Suh DS, Cho EM, Kim JK, Ryu GH, Chung KW. 2009. Characterization of polymorphic microsatellite loci in cultivated and wild Panax ginseng. Genes Genom. 31: 119-127.
  • Jo IH, Bang KH, Kim YC, Kim JU, Shin MR, Moon JY, et al. 2013. Analysis of mitochondrial DNA sequence and molecular marker development for identification of Panax species. Korean J Med Crop Sci. 21: 91-96.
  • Kim J, Jo BH, Lee KL, Yoon ES, Ryu GH, Chung KW. 2007. Identification of new microsatellite markers in Panax ginseng. Mol Cells. 24: 60-68.
  • Kim YJ, Jang MG, Zhu L, Silva J, Zhu X, Sukweenadhi J, et al. 2015. Cytological characterization of anther development in Panax ginseng Meyer. Protoplasma. [Epub ahead of print].
  • Koressaar T, Remm M. 2007. Enhancements and modifications of primer design program Primer3. Bioinformatics. 23: 1289-1291.
  • Lee MJ, Kim EH, Rhee DK. 2008. Effect of Panax ginseng on stress. J Ginseng Res. 32: 8-14.
  • Lee SS. 2002. Characteristics of photosynthesis among new cultivars of ginseng (Panax ginseng C.A. Meyer). J Ginseng Res. 26: 85-88.
  • Lim W, Mudge KW, Weston LA. 2007. Utilization of RAPD markers to assess genetic diversity of wild populations of North American ginseng (Panax quinquefolium). Planta Med. 73: 71-76.
  • Lim YP, Choi KT. 1990. The characterization of mitochondrial DNA of Korean ginseng (Panax ginseng C.A. Meyer). Korean J Ginseng Sci. 14: 310-316.
  • Lim YP, Shin CS, Lee SJ, Youn YN, Jo JS. 1993. Survey of proper primer and genetic analysis of Korean ginseng (Panax ginseng C.A. Meyer) variants using the RAPD technique. Korean J Ginseng Sci. 17: 153-158.
  • Liu K, Muse SV. 2005. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics. 21: 2128-2129.
  • Ma KH, Dixit A, Kim YC, Lee DY, Kim TS, Cho EG, et al. 2007. Development and characterization of new microsatellite markers for ginseng (Panax ginseng C. A. Meyer). Conserv Genet. 8: 1507-1509.
  • Mogea JP. 1999. Relationships and phylogeny of the species of the genus Arenga (Palmae) based on morphology using the polarity method and the NTSYS program. Mem New York Bot Gard. 83: 169-177.
  • Nam MH, Kim SI, Liu JR, Yang DC, Lim YP, Kwon KH, et al. 2005. Proteomic analysis of Korean ginseng (Panax ginseng C.A. Meyer). J Chromatogr B Analyt Technol Biomed Life Sci. 815: 147-155.
  • Nguyen VD, Nirala R, Choi SR, Uhm TS, Yang TJ, Ahn IO, et al. 2010. Development and characterization of new microsatellite markers in Panax ginseng C. A. Meyer from BAC end sequences. Conserv Genet. 11: 1223-1225.
  • Park SW, Hyun YS, Chung KW. 2009. Genetic polymorphism of microsatellite in Panax ginseng C.A. Meyer. J Ginseng Res. 33: 199-205.
  • Powell W, Machray GC, Provan J. 1996. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1: 215-222.
  • Roldán-Ruiz I, Dendauw J, Van Bockstaele E, Depicker A, De Loose M. 2000. AFLP markers reveal high polymorphic rates in ryegrasses (Lolium spp.). Mol Breed. 6: 125-134.
  • Sharma SK, Pandit MK. 2009. A new species of Panax L. (Araliaceae) from Sikkim Himalaya, India. Syst Bot. 34: 434-438.
  • Shim YH, Choi JH, Park CD, Lim CJ, Cho JH, Kim HJ. 2003. Molecular differentiation of Panax species by RAPD analysis. Arch Pharm Res. 26: 601-605.
  • Silva PI, Martins AM, Gouvea EG, Pessoa-Filho M, Ferreira ME. 2013. Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads. BMC Genomics. 14: 17
  • Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. 2012. Primer3: new capabilities and interfaces. Nucleic Acids Res. 40: e115
  • Um JY, Chung HS, Kim MS, Na HJ, Kwon HJ, Kim JJ, et al. 2001. Molecular authentication of Panax ginseng species by RAPD analysis and PCR-RFLP. Biol Pharm Bull. 24: 872-875.
  • Woo SY, Lee DS, Kim PG. 2004. Growth and eco-physiological characteristics of Panax ginseng grown under three different forest type. J Plant Biol. 47: 230-235.
  • Yang DC, Kim MS. 2003. DNA analysis of ginseng using PCR-aided RFLP technology. J Ginseng Res. 27: 146-150.
  • Yu RH, Zhao YJ, Xu KZ, Zhang MS, Zhang ZA, Chen ZY. 2009. Diurnal changes of photosynthesis in Panax ginseng and Panax quinquefolium under different environmental conditions. J South China Agr Univ. 30: 7-11.
  • Zhang XY, Li CW, Wang LF, Wang HM, You GX, Dong YS. 2002. An estimation of the minimum number of SSR alleles needed to reveal genetic relationships in wheat varieties. I. Information from large-scale planted varieties and cornerstone breeding parents in Chinese wheat improvement and production. Theor Appl Genet. 106: 112-117.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers
Plant Breed. Biotech.. 2016;4(1):71-78.   Published online February 28, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers
Plant Breed. Biotech.. 2016;4(1):71-78.   Published online February 28, 2016
Close

Figure

  • 0
Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers
Image
Fig. 1 Dendrograms showing genetic similarities among eight cultivars of ginseng, constructed using the Panax ginseng cultivars and Panax species similarity coefficient based on eight SSR markers (unweighted pair group method with arithmetic mean algorithm). Cultivars in Chunpoong (C), Yunpoong (Y), Gopoong (GO), Gumpoong (GU), Jakyung (J), Hwangsook (H), P. quinquefolius (PQ), P. notoginseng (PN). Group I contained C, Y, GO, and J. Group II contained GU and H. Group III contained P. quinquefolius and P. notoginseng.
Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers

Source of the Panax species and Panax ginseng cultivars used in this study.

Species Cultivar Accession No. of sample
P. ginseng Chunpoong KT&Gz) 17
Yunpoong KT&G 22
Gopoong Local 15
Gumpoong Local 10
Jakyungjong KT&G 23
Hwangsookjong Local 20
P. quinquefolius NIHHS 5
P. notoginseng NIHHS 3

z)KT&G: name of a Korean ginseng corporation, NIHHS: National Institute of Horticultural and Herbal Science.

Frequencies of microsatellite repeat types in the Panax ginseng sequence collections.

Repeat type Simple sequence repeat
Di-nucleotide 8,279 (60.1)
Tri-nucleotide 3,832 (27.8)
Tetra-nucleotide 1,070 (7.8)
Penta-nucleotide 371 (2.7)
Hexa-nucleotide 153 (1.1)
Hepta-nucleotide 48 (0.3)
Octa-nucleotide 16 (0.1)
Total 13,769 (100.0)

Values are presented as number (%).

Abundant SSR motives in the Panax ginseng database. Motifs accounting for 4.9% or more of each repeat type are included*.

Variable SSR motif
AC/GT 990 (12.0)
AG/CT 1,240 (15.0)
AT/AT 1,655 (20.0)
CA/TG 1,403 (16.9)
GA/TC 1,340 (16.2)
TA/TA 1,428 (17.2)
AGA/TCT 192 (5.0)
ATA/TAT 419 (10.9)
TTG/CAA 215 (5.6)
GAA/TTC 220 (5.7)
TAA/TTA 377 (9.8)
TCA/TGA 189 (4.9)
AAAT/ATTT 65 (6.0)
TAAA/TTTA 62 (5.7)

Values are presented as number (%).

*SSR: simple sequence repeat.

Characteristics of 8 SSR markers including GenBank accession, repeat motif, primer sequence, allele size range, number of alleles, genetic diversity, heterozygosity, and PIC among 8 cultivars of Panax species*.

Marker ID GenBank accession Repeat motif Forward primer (5′→3′) Allele size range (bp) No. of allele Genetic diversity (h) Heterozygosity PIC
PgSSR07 GU565701 (GAA)18 VIC-ATGGAAGTGGTTTGTGTTGG
AGGAGACCATGAAGGATTCG
204–276 3 0.34 0.26 0.32
PgSSR08 EF531909 (GAAA)6 NED-CCTGCTGGAGATTGAAGTCAT
GTTGGAATGCTTCAGCAGAT
180–207 5 0.61 0.59 0.55
PgSSR09 GU565702 (AG)13 FAM-TGGATGATTTCGACATTTCTG
CCGTTCAACTAACCCCAAAC
164–204 3 0.51 0.59 0.42
PgSSR17 BZ957342 (GGAACC)3 PET-ATCAGAACCGGAACTGGAAC
CTGAATTACCGAACCGAACC
103–118 3 0.21 0.08 0.20
PgSSR37 EF140892 (ATG)7(CTGATG)2 FAM-AATCAGAAACAAAGAAAGCTAAAAC
CTCTCTCATCTCTCTCTCTTCC
100–122 5 0.73 0.36 0.69
PgSSR40 EF140893 (ATAG)2 VIC-GTAGTAGTAGTAAAACTTTGCTAACG
ATTTACAACTCTCTTCTTCCTCTAC
125–162 3 0.32 0.28 0.28
PgSSR51 EF140899 (AAG)9 NED-GGAGGTGATTGATGTAGTGGAATCC
GGCTCTCCTATACTCACTATTTCCC
299–330 8 0.78 0.34 0.76
PgSSR53 EF140900 (CTCCTTT)4 PET-CTACACGCTTTTTCATAGCTTACA
TGTCTGCATAAAAGAGTTCGAGGC
185–194 3 0.13 0.07 0.13
Average 4.13 0.45 0.32 0.42

*SSR: simple sequence repeat, PIC: polymorphic information content.

Table 1 Source of the Panax species and Panax ginseng cultivars used in this study.

KT&G: name of a Korean ginseng corporation, NIHHS: National Institute of Horticultural and Herbal Science.

Table 2 Frequencies of microsatellite repeat types in the Panax ginseng sequence collections.

Values are presented as number (%).

Table 3 Abundant SSR motives in the Panax ginseng database. Motifs accounting for 4.9% or more of each repeat type are included*.

Values are presented as number (%).

SSR: simple sequence repeat.

Table 4 Characteristics of 8 SSR markers including GenBank accession, repeat motif, primer sequence, allele size range, number of alleles, genetic diversity, heterozygosity, and PIC among 8 cultivars of Panax species*.

SSR: simple sequence repeat, PIC: polymorphic information content.