Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng

Plant Breeding and Biotechnology 2018;6(1):74-81.
Published online: March 1, 2018

1Chromosome Research Institute, Department of Life Science, Sahmyook University, Seoul 01795, KoreaJFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

2Department of Plant Science, Plant Genomics and Breeding Institute, and Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea

*Corresponding author Hyun Hee Kim, kimhh@syu.ac.kr, Tel: +82-2-3399-1715, Fax: +82-2-3399-1729
*Corresponding author Tae-Jin Yang, tjyang@snu.ac.kr, Tel: +82-2-880-4547, Fax: +82-2-8873-2056
• Received: February 14, 2018   • Revised: February 20, 2018   • Accepted: February 20, 2018

Copyright © 2018 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 12 Views
  • 0 Download
  • 11 Crossref
prev next
  • Repetitive DNA elements are ubiquitous in plant genomes. Although repeats provide relevant information for cytogenetic, evolutionary, and genomic studies, identifying and characterizing their sequence and chromosomal distribution are not always easily achieved through conventional methods. However, a high-throughput identification of genomic repeats can be obtained with short reads from next-generation sequencing data. Here, we identified the telomeric and two chromosome-specific repeats in Panax ginseng using low-coverage whole genome sequence data. The telomeric repeat sequence is same with the canonical angiosperm sequence, (TTTAGGG)n, and localized mostly in every chromosome termini, except for an additional interstitial location in chromosome 10. A dinucleotide (GA) microsatellite, PgGA15, with total genome representation (GR) of more than 33 kb localized in the long arm of chromosome 20. An 11-bp minisatellite, Pgms1, with more than 58 kb of GR localized in the long arm of chromosome 1. This study provides chromosome-specific markers for cytogenetic studies in P. ginseng.
Repetitive DNA elements are ubiquitous in plant genomes, and they are amplified or eliminated in a very rapid and dynamic fashion (Michael and Jackson 2013). They could be either dispersed or tandem repeats based on their physical organization in a genome (Kubis et al. 1998). Owing to these characteristics, they are responsible for significant genome size variations even between very closely related species (Tenaillon et al. 2010). Numerous studies have shown the indispensable roles of repeats in a genome which include genotypic and phenotypic variations, heterochromatin formation and environmental adaptation (Kalendar et al. 2000; Lippman et al. 2004; Wei et al. 2014). Because repeat amplification or elimination could happen before or after species divergence, repeats can be an excellent tool in studying evolution of genomes (Choi et al. 2014; Mehrotra and Goyal 2014; Wei et al. 2014). Although different repeats follow different evolutionary pathways, tandem repeats have been evolutionarily associated with other repetitive DNA like transposable elements and the intergenic spacers (IGSs) of the 45S rDNA genes in several plant species (Cheng and Murata 2003; Macas et al. 2003).
Tandem repeats can be classified as microsatellite, minisatellite or satellite according to their repeat unit and array size (2–5 bp in 10–100 units, 6–100 bp in 0.5–30 kb, and 150–400 bp in up to 100 Mb, respectively). Tandem repeats are also excellent cytogenetic markers because they are often distributed in unique chromosomal regions, allowing easy discrimination of chromosomes (Mendes et al. 2011; Choi et al. 2014).
Conventional methods in identifying and characterizing repeats may be costly and tedious, often involving extensive molecular procedures while producing low throughput repeat identification and characterization (Dong et al. 2000). With the advancement of next-generation sequencing (NGS) technologies and bioinformatics pipelines to handle NGS data such as TAREAN (Novák et al. 2017), high-throughput and more efficient genome-wide repeat identification can be obtained even with low-coverage sequencing. This approach has been successfully demonstrated in some species like pea, banana and cabbage (Macas et al. 2007; Hribova et al. 2010; Novák et al. 2013; Novák et al. 2017; Perumal et al. 2017; Waminal et al. 2017).
Panax ginseng (Korean ginseng or Asian ginseng) is an important allotetraploid (2n = 4x = 48) perennial crop (Choi et al. 2014; Jang et al. 2017), highly priced for its ginsenoside, which is known to have a wide range of therapeutic effects (Court 2000; Park et al. 2012). In addition, its sensitivity to light, slow growth (~four years/generation) and low seed yield (~40 seeds/plant) have contributed to its high price and a multi-billion USD market (Baeg and So 2013). Although there has been a relatively long history of pharmacological studies in P. ginseng (Leung and Wong 2010), genomics and molecular cytogenetics have just gained pace in recent years, and several questions still remain to be answered like the origin of the extant P. ginseng genome and the pathways of specific repeat evolution in light of the P. ginseng genome function. In a previous study (Waminal et al. 2017), we reported about Pg167TR, a 167-bp satellite DNA that localized in all P. ginseng chromosomes with a distinct pattern in each chromosome. However, we have not identified any chromosome-specific repeat so far. Here, using low-pass NGS data, we validated telomere repeats and its distribution and further identified novel chromosome-specific repeats that will be useful for P. ginseng cytogenetic and evolutionary studies.
Repeat identification and probe design
Approximately 0.03× of P. ginseng WGS reads were sampled from bulk NGS data deposited at the National Agricultural Biotechnology Information Center (NABIC, acc. code NN-0076-000001, https://nabic.rda.go.kr:2360/) was used to mine for microsatellite, minisatellite, and satellite repeats using the RepeatExplorer2 pipeline (Novák et al. 2013) after quality trimming as described in RepeatExplorer2 guidelines. Estimation of genome representation (GR) was carried out by multiplying the total number of repeats with the repeat period size followed by normalization of the size of raw reads used with the 3.6 Gbp genome size of P. ginseng (Waminal et al. 2016; Waminal et al. 2017). Read mapping and sequence characterization were carried out using CLC Assembly Cell ver. 4.21 and CLC Main Workbench ver. 7.9.1 using default parameters. A 30-bp oligoprobe each was designed each for PgGA15, Pgms1, and PgTel and synthesized by Bioneer Corp. (http://www.bioneer.com/, Korea).
FISH analysis
Chromosome spreads were prepared according to Waminal et al. (2017). Thirty-two microliters of FISH hybridization master mix (50% formamide, 10% dextran sulfate, and 2× SSC), 25 ng of each FAM- and Cy3-modified oligoprobes, and deionized water to a total volume of 40 μL were added to slides. Chromosomal DNA on a glass slide was denatured at 80°C for 5 minutes after the addition of hybridization mix. Hybridization was carried out for 30 minutes at room temperature. Stringency washes were performed using 2× SSC at room temperature for 5 minutes, 0.1× SSC at 42°C for 20 minutes, and 2× SSC for 5 minutes at room temperature. The slides were dehydrated in an ethanol series of 70%, 90%, and 100%, air-dried, and counterstained with premixed 4′,6-diamidino-2-phenylindole (DAPI) solution (1 μg/mL; DAPI in Vectashield, Vector Laboratories, Burlingame, CA, USA). Images were captured under a model BX53 fluorescence microscope (Olympus, Tokyo, Japan) equipped with a DFC365 FS CCD camera (Leica Microsystems, Wetzlar, Germany) and processed using Cytovision ver. 7.2 (Leica Microsystems). Further image enhancements and idiogram construction were performed with Adobe Photoshop CC (Adobe Systems, San Jose, CA, USA).
Identification of novel tandem repeats using Illumina NGS data
NGS reads have numerous uses depending on one’s research objectives (Fig. 1A). Our interest is in using NGS reads for repeatomics, characterizing the totality of repeats in a genome for structural characterization (Waminal et al. 2016). In this study, we focused on micro- and minisatellites that make a considerable physical array that can be observable using molecular cytogenetic techniques such as FISH. To do that, individual Illumina reads were concatenated into a single contig by adding 50-bp Ns in between reads using a Perl script from RepeatExplorer2 (Novák et al. 2013). The single contig was scanned for tandem repeats using Tandem Repeats Finder (Benson 1999) and sorted and quantified with TRAP (Sobreira et al. 2006) (Fig. 1B). Five microsatellites (2 or 3-bp) and two minisatellites (7 and 11-bp) with >25 kb total bases were identified (Table 1). Out of these seven tandem repeats, three showed reproducible distinct chromosome-specific signals. We identified one microsatellite (PgGA15), and two minisatellites including the telomeric repeat of P. ginseng (Pgms1 and PgTel) (Table 1). While all have potential of becoming cytogenetic markers, no discernable FISH signals were observed using oligonucleotide probes for other repeats.
Identification of GA satellite blocks and chromosomal localization
PgGA15 is a GA dinucleotide microsatellite that is estimated to exist in more than 16,000 copies or about 33 kb in total base-pairs or 0.012× of the P. ginseng genome (Table 1). It has an average repeat number of 9.3 repeats (or 18.6 bp) per locus in more than 1,700 loci. The average repeat length per locus is less than 20% of the size of one read length, indicating shorter arrays of PgGA15 in the genome, characteristics of microsatellites. A 30-bp oligonucleotide probe, PgGA15_OP, was designed and modified at the 5′ with 6-carboxyfluorescein (FAM) fluorescent dye (Table 2). FISH analysis with PgGA15_OP revealed an intense signal on the DAPI band on one long chromosome. Based on distribution pattern of Pg167TR on each chromosome, we confirmed the chromosome number which show the PgGA15 signal. The PgGA15 hybridized on the long arm of chromosome 20, indicating a concentration of this microsatellite at this genomic region (Fig. 2).
Identification of telomere repeats and chromosomal localization
PgTel is a 7-bp minisatellite which corresponded with the canonical angiosperm telomere repeat TTTAGGG and was identified and estimated at more than 6,000 copies or about 46 kb or 0.016× of the genome (Table 1). It has an average repeat number of 11.9 repeats (or 83.3 bp) per locus in more than 550 loci. The average repeat length per locus is about 80% of the size of one read length, suggesting that PgTel is from much longer arrays in the actual genome. A 34-bp oligonucleotide probe, PgTel_OP, which is about 5 copies of the unit, was designed and modified at the 5′ with Cy3 fluorescent dye (Table 2). FISH analysis with PgTel_OP revealed a distribution at the chromosome termini of all P. ginseng chromosomes. However, an additional interstitial PgTel signal at the most intense DAPI band in the long arm of chromosome 10 was also observed (Fig. 3).
Identification of an 11-bp minisatellite and chromosomal localization
Pgms1is an 11-bp minisatellite that is estimated to about 5,000 copies or 58 kb, representing about 0.021× of the genome (Table 1). It has an average repeat number of 8.7 repeats (or 95.7 bp) per locus in more than 600 copies. The average repeat length per locus is almost as long as one read length, suggesting arrays of longer lengths for Pgms1. A 30-bp oligonucleotide probe, Pgms1_OP, which is about 2.5 copies of the repeat unit, was designed and modified at the 5′ end with Cy3 fluorescent dye (Table 2). FISH analysis with Pgms1_OP showed a distinct signal at the interstitial region of one long chromosome. Using Pg167TR as a reference marker of P. ginseng chromosomes, we confirmed that Pgms1 located at chromosome 1 (Fig. 4).
The novel micro- and minisatellites identified in this study were generated from concatenated 101-bp Illumina reads with 50-bp ‘N’ spacer, so array identification is limited to individual 101-bp reads. Although this limitation may not identify full-length repeat arrays, it is enough to identify short micro- and minisatellite repeat units. Consequently, the GR values may be an underestimate of the actual coverage in the genome. PgGA15 with short average repeat length per locus, compared with PgTel and Pgms1, may be physically organized as dense clusters in chromosome 20 with short arrays separated by non PgGA15 sequences. Whereas Pgms1 may be either of similar pattern with PgGA15 but of longer units or perhaps just a few long arrays but were separated by the short reads, as each read can be considered as a single locus after separation with the 50-bp N spacer between reads.
All identified repeats have more than 50% AT content and all hybridized to DAPI bands in their respective locus. The high AT content of these repeats may have contributed to the DAPI bands, as DAPI is known to preferentially intercalate at AT-rich DNA (Schweizer 1976). However, not all DAPI bands may be solely composed of one type of AT-rich repeats, but could be of several types, as in the case of the Pgms1 locus, which localized other minisatellites.
In addition, telomeric repeats are usually found at most of chromosome termini. However, several studies have reported interstitial localization of telomeric repeats, like that observed in the interstitial region of chromosome 10. Interstitial telomeric sites have been demonstrated to be recombination hot-spots, genome rearrangement break-points, and even shown to be functional in several species (Day et al. 1998; Hastie and Allshire 1989; Park et al. 1992; Tremousaygue et al. 1999; Uchida et al. 2002). P. ginseng have undergone two major rounds of genome duplications (Choi et al. 2013). This interstitial telomeric site on P. ginseng chromosome 10 may be just a relic of genomic rearrangements that occurred in P. ginseng, perhaps prior to the divergence between P. ginseng and P. quinquefolius, as both species share a similar chromosome bearing interstitial telomeric sequence (Fig. 3) or may still serve some unknown functions.
Recently, our studies revealed the evolution of major repeats in Panax genus (Jang et al. 2017; Lee et al. 2017). We also provided distribution pattern of these major repeats and established chromosome identification system using these repeats (Waminal et al. 2017). However, ginseng has 24 chromosome pairs (48 chromosomes) with similar size and shape that ask easy and reliable chromosome discrimination method. Here, we have provided chromosome-specific cytogenetic markers (Fig. 5 and Table 1) that will be useful tools for cytogenetic studies in P. ginseng and related species. It has improved the karyotype of P. ginseng. Future investigation on other chromosome-specific repeats and their impact on the evolution and function of the P. ginseng genome will be necessary for the molecular cytogenetic and genomics in ginseng.
This work was carried out with the support of the Cooperative Research Program for Agriculture Science & Technology Development (PJ013119), Rural Development Administration, Korea.
Fig. 1
Diagram in identifying repeats in P. ginseng. (A) A general non-comprehensive scheme of different applications for NGS data. Following this scheme, we used 0.3× of P. ginseng Illumina reads for tandem repeat analysis in this study. (B) A simple workflow for quantifying micro- and minisatellites.
pbb-06-074f1.jpg
Fig. 2
FISH analysis of PgGA15 on P. ginseng chromosomes. (A–C) Raw images of DAPI stained chromosomes, PgGA15, and Pg167TR signals, respectively. (D and E) Pseudo-colored images of PgGA15 signal and Pg167TR. The PgGA15 signal was localized on the long arm of chromosome 20. (F) Merged images of PgGA15 (arrowheads) and Pg167TR signals. Bar = 10 μm.
pbb-06-074f2.jpg
Fig. 3
FISH analysis of PgTel on P. ginseng (A–C) and P. quinquefolius (D–F) chromosomes. (A, B and D, E) Raw images of DAPI stained chromosomes and PgTel signals, respectively. (C and F) Merged images from A, B and D, E. PgTel localized in every chromosome termini with an additional location in one chromosome in both P. ginseng and P. quinquefolius (arrowheads). Based on previous karyotype of P. ginseng, the interstitial PgTel localized in the long arm of chromosome 10, but in P. quinquefolius, no established karyotype has been reported yet. Bars = 10 μm.
pbb-06-074f3.jpg
Fig. 4
FISH analysis of Pgms1 and Pg167TR on P. ginseng chromosomes. (A–C) Raw images of Pgms1, Pg167TR, and DAPI stained chromosomes, respectively. (D–F) Pseudo-colored signals from A–C, respectively, indicating the localization of Pgms1 on the long arm of chromosome 1. (F) Merged images of Pgms1 (arrowheads) and Pg167TR. Bar = 10 μm.
pbb-06-074f4.jpg
Fig. 5
Karyotype idiogram of P. ginseng showing different cytogenetic markers. Navy blue, orange, red, and green bands represent DAPI, Pg167TR, 45S rDNA, and 5S rDNA as described in Waminal et al. (2017). The DAPI bands in the long arm of chromosomes 1 and 20 are the sites for Pgms1 (patterned arrowhead) and PgGA15 (grey arrowhead) tandem repeats, respectively. PgTel repeats are depicted by magenta circles. An interstitial PgTel locus localized in the intense DAPI band in the long arm of chromosome 10 (green arrowhead).
pbb-06-074f5.jpg
Table 1
List of tandem repeats >25 kb identified in P. ginseng concatenated Illumina reads.
Table 1
No. Sequence Period size (base) %AT Total repeat units GRz) Ave. repeat/ locus Total repeat loci Total bases Given name in this study Chromosomal distribution
1 (TA)n 2 100 44,836 0.032 11.8 3,790 89,187 -- None detected
2 (TAT)n 3 100 28,869 0.031 9.3 3,091 86,167 -- None detected
3 (GA)n 2 50 16,347 0.012 9.3 1,762 32,591 PgGA15 DAPI band on long arm of Chr. 20
4 (TG)n 2 50 13,464 0.010 9.3 1,446 26,890 -- None detected
5 (TCT)n 3 67 8,370 0.009 6.7 1,252 25,204 -- None detected
6 (TTTAGGG)n 7 57 6,527 0.016 11.9 550 45,675 PgTel Chromosome termini and DAPI band on long arm of Chr. 10
7 (ACATTCTTGAT)n 11 73 5,427 0.021 8.7 627 58,266 Pgms1 DAPI band on long arm or Chr. 1

z)Genome representation.

Table 2
List of oligonucleotide probes used for FISH.
Table 2
 No.  Name Sequence Length Used label
1 PgGA15_OP  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 30 bases 5′-FAM
3 PgTel_OP TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGG  34 bases 5′-Cy3
2 Pgms1_OP ACATTCTTGATACATTCTTGATACATTCTT 30 bases 5′-Cy3
  • Baeg I-H, So SH. 2013. The world ginseng market and the ginseng (Korea). J Ginseng Res. 37: 1-7.
  • Benson G. 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27: 573-580.
  • Cheng Z-J, Murata M. 2003. A centromeric tandem repeat family originating from a part of Ty3/gypsy-retroelement in wheat and its relatives. Genetics. 164: 665-672.
  • Choi HI, Kim NH, Lee J, Choi BS, Do Kim K, Park JY, et al. 2013. Evolutionary relationship of Panax ginseng and P. quinquefolius inferred from sequencing and comparative analysis of expressed sequence tags. Genet Resour Crop Evol. 60: 1377-1387.
  • Choi HI, Waminal NE, Park HM, Kim NH, Choi BS, Park M, et al. 2014. Major repeat components covering one-third of the ginseng (Panax ginseng C.A. Meyer) genome and evidence for allotetraploidy. Plant J. 77: 906-916.
  • Court WE. 2000. Ginseng: The genus Panax Hardwood. Academic Publishers. Amsterdam, Netherlands.
  • Day JP, Limoli CL, Morgan WF. 1998. Recombination involving interstitial telomere repeat-like sequences promotes chromosomal instability in Chinese hamster cells. Carcinogenesis. 19: 259-265.
  • Dong F, Song J, Naess SK, Helgeson JP, Gebhardt C, Jiang J. 2000. Development and applications of a set of chromosome-specific cytogenetic DNA markers in potato. Theor Appl Genet. 101: 1001-1007.
  • Hastie ND, Allshire RC. 1989. Human telomeres: fusion and interstitial sites. Trends Genet. 5: 326-331.
  • Hribova E, Neumann P, Matsumoto T, Roux N, Macas J, Dolezel J. 2010. Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing. BMC Plant Biol. 10: 204
  • Jang W, Kim N-H, Lee J, Waminal NE, Lee S-C, Jayakodi M, et al. 2017. A glimpse of Panax ginseng genome structure revealed from ten BAC clone sequences obtained by SMRT sequencing platform. Plant Breed Biotech. 5: 25-35.
  • Kalendar R, Tanskanen J, Immonen S, Nevo E, Schulman AH. 2000. Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence. Proc Natl Acad Sci USA. 97: 6603-6607.
  • Kubis SE, Heslop-Harrison JS, Desel C, Schmidt T. 1998. The genomic organization of non-LTR retrotransposons (LINEs) from three Beta species and five other angiosperms. Plant Mol Biol. 36: 821-831.
  • Lee J, Waminal NE, Choi HI, Perumal S, Lee SC, Nguyen VB, et al. 2017. Rapid amplification of four retrotransposon families promoted speciation and genome size expansion in the genus Panax. Sci Rep. 7: 9045
  • Leung KW, Wong AS-T. 2010. Pharmacology of ginsenosides: a literature review. Chin Med. 5: 20
  • Lippman Z, Gendrel AV, Black M, Vaughn MW, Dedhia N, Mccombie WR, et al. 2004. Role of transposable elements in heterochromatin and epigenetic control. Nature. 430: 471-476.
  • Macas J, Navrátilová A, Mészáros T. 2003. Sequence subfamilies of satellite repeats related to rDNA intergenic spacer are differentially amplified on Vicia sativa chromosomes. Chromosoma. 112: 152-158.
  • Macas J, Neumann P, Navratilova A. 2007. Repetitive DNA in the pea (Pisum sativum L.) genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula. BMC genomics. 8: 427
  • Mehrotra S, Goyal V. 2014. Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function. Genomics Proteomics Bioinformatics. 12: 164-171.
  • Mendes MM, Da Rosa R, Giuliano-Caetano L, Dias AL. 2011. Karyotype diversity of four species of the incertae sedis group (Characidae) from different hydrographic basins: analysis of AgNORs, CMA3 and 18S rDNA. Genet Mol Res. 10: 3596-3608.
  • Michael TP, Jackson S. 2013. The first 50 plant genomes. Plant Genome. 6: 1-7.
  • Novák P, Ávila Robledillo L, Koblížková A, Vrbová I, Neumann P, Macas J. 2017. TAREAN: a computational tool for identification and characterization of satellite DNA from unassembled short reads. Nucleic Acids Res. 45: e111
  • Novák P, Neumann P, Pech J, Steinhaisl J, Macas J. 2013. RepeatExplorer: a Galaxy-based web server for genome-wide characterization of eukaryotic repetitive elements from next-generation sequence reads. Bioinformatics. 29: 792-793.
  • Park HJ, Kim DH, Park SJ, Kim JM, Ryu JH. 2012. Ginseng in traditional herbal prescriptions. J Ginseng Res. 36: 225-241.
  • Park VM, Gustashaw KM, Wathen TM. 1992. The presence of interstitial telomeric sequences in constitutional chromosome abnormalities. Am J Hum Genet. 50: 914-923.
  • Perumal S, Waminal NE, Lee J, Lee J, Choi BS, Kim HH, et al. 2017. Elucidating the major hidden genomic components of the A, C, and AC genomes and their influence on Brassica evolution. Sci Rep. 7: 17986
  • Schweizer D. 1976. Reverse fluorescent chromosome banding with chromomycin and DAPI. Chromosoma. 58: 307-324.
  • Sobreira TJ, Durham AM, Gruber A. 2006. TRAP: automated classification, quantification and annotation of tandemly repeated sequences. Bioinformatics. 22: 361-362.
  • Tenaillon MI, Hollister JD, Gaut BS. 2010. A triptych of the evolution of plant transposable elements. Trends Plant Sci. 15: 471-478.
  • Tremousaygue D, Manevski A, Bardet C, Lescure N, Lescure B. 1999. Plant interstitial telomere motifs participate in the control of gene expression in root meristems. Plant J. 20: 553-561.
  • Uchida W, Matsunaga S, Sugiyama R, Kawano S. 2002. Interstitial telomere-like repeats in the Arabidopsis thaliana genome. Genes Genet Syst. 77: 63-67.
  • Waminal NE, Choi HI, Kim NH, Jang W, Lee J, Park JY, et al. 2017. A refined Panax ginseng karyotype based on an ultra-high copy 167-bp tandem repeat and ribosomal DNAs. J Ginseng Res. 41: 469-476.
  • Waminal NE, Perumal S, Lee J, Kim HH, Yang TJ. 2016. Repeat evolution in Brassica rapa (AA), B oleracea (CC), and B napus (AACC) genomes. Plant Breed Biotech. 4: 107-122.
  • Wei KH-C, Grenier JK, Barbash DA, Clark AG. 2014. Correlated variation and population differentiation in satellite DNA abundance among lines of Drosophila melanogaster. Proc Natl Acad Sci USA. 111: 18793-18798.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng
Plant Breed. Biotech.. 2018;6(1):74-81.   Published online March 1, 2018
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng
Plant Breed. Biotech.. 2018;6(1):74-81.   Published online March 1, 2018
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng
Image Image Image Image Image
Fig. 1 Diagram in identifying repeats in P. ginseng. (A) A general non-comprehensive scheme of different applications for NGS data. Following this scheme, we used 0.3× of P. ginseng Illumina reads for tandem repeat analysis in this study. (B) A simple workflow for quantifying micro- and minisatellites.
Fig. 2 FISH analysis of PgGA15 on P. ginseng chromosomes. (A–C) Raw images of DAPI stained chromosomes, PgGA15, and Pg167TR signals, respectively. (D and E) Pseudo-colored images of PgGA15 signal and Pg167TR. The PgGA15 signal was localized on the long arm of chromosome 20. (F) Merged images of PgGA15 (arrowheads) and Pg167TR signals. Bar = 10 μm.
Fig. 3 FISH analysis of PgTel on P. ginseng (A–C) and P. quinquefolius (D–F) chromosomes. (A, B and D, E) Raw images of DAPI stained chromosomes and PgTel signals, respectively. (C and F) Merged images from A, B and D, E. PgTel localized in every chromosome termini with an additional location in one chromosome in both P. ginseng and P. quinquefolius (arrowheads). Based on previous karyotype of P. ginseng, the interstitial PgTel localized in the long arm of chromosome 10, but in P. quinquefolius, no established karyotype has been reported yet. Bars = 10 μm.
Fig. 4 FISH analysis of Pgms1 and Pg167TR on P. ginseng chromosomes. (A–C) Raw images of Pgms1, Pg167TR, and DAPI stained chromosomes, respectively. (D–F) Pseudo-colored signals from A–C, respectively, indicating the localization of Pgms1 on the long arm of chromosome 1. (F) Merged images of Pgms1 (arrowheads) and Pg167TR. Bar = 10 μm.
Fig. 5 Karyotype idiogram of P. ginseng showing different cytogenetic markers. Navy blue, orange, red, and green bands represent DAPI, Pg167TR, 45S rDNA, and 5S rDNA as described in Waminal et al. (2017). The DAPI bands in the long arm of chromosomes 1 and 20 are the sites for Pgms1 (patterned arrowhead) and PgGA15 (grey arrowhead) tandem repeats, respectively. PgTel repeats are depicted by magenta circles. An interstitial PgTel locus localized in the intense DAPI band in the long arm of chromosome 10 (green arrowhead).
Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng

List of tandem repeats >25 kb identified in P. ginseng concatenated Illumina reads.

No. Sequence Period size (base) %AT Total repeat units GRz) Ave. repeat/ locus Total repeat loci Total bases Given name in this study Chromosomal distribution
1 (TA)n 2 100 44,836 0.032 11.8 3,790 89,187 -- None detected
2 (TAT)n 3 100 28,869 0.031 9.3 3,091 86,167 -- None detected
3 (GA)n 2 50 16,347 0.012 9.3 1,762 32,591 PgGA15 DAPI band on long arm of Chr. 20
4 (TG)n 2 50 13,464 0.010 9.3 1,446 26,890 -- None detected
5 (TCT)n 3 67 8,370 0.009 6.7 1,252 25,204 -- None detected
6 (TTTAGGG)n 7 57 6,527 0.016 11.9 550 45,675 PgTel Chromosome termini and DAPI band on long arm of Chr. 10
7 (ACATTCTTGAT)n 11 73 5,427 0.021 8.7 627 58,266 Pgms1 DAPI band on long arm or Chr. 1

z)Genome representation.

List of oligonucleotide probes used for FISH.

 No.  Name Sequence Length Used label
1 PgGA15_OP  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 30 bases 5′-FAM
3 PgTel_OP TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGG  34 bases 5′-Cy3
2 Pgms1_OP ACATTCTTGATACATTCTTGATACATTCTT 30 bases 5′-Cy3
Table 1 List of tandem repeats >25 kb identified in P. ginseng concatenated Illumina reads.

Genome representation.

Table 2 List of oligonucleotide probes used for FISH.