Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae

Plant Breeding and Biotechnology 2013;1(4):354-365.
Published online: December 31, 2013

1Plant Systems Engineering Research Center, KRIBB, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806, Republic of Korea

2Crop Biotech Institute and Graduate School of Biotechnology, Kyung Hee University, Yongin 446-701, Korea

*Corresponding author: Suk-Yun Kwon, sykwon@kribb.re.kr, Tel: +82-42-860-4340, Fax: +82-42-860-4349

They are equally contributing authors.

• Received: November 7, 2013   • Revised: November 25, 2013   • Accepted: November 27, 2013

Copyright © 2013 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 214 Views
  • 0 Download
  • 10 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Structural and Functional Characterization of EXPO‐Derived Extracellular Vesicles in Plants
    Jiayang Gao, Yanbin Li, Shengqi Zhang, Yilin He, Zhiqi Liu, Juan Wang, Jingmin Hua, Jinyu Chen, Junru Zhong, Huan Zhong, Yiji Xia, Yong Cui, Liwen Jiang
    Advanced Science.2026;[Epub]     CrossRef
  • Regulation of stress-responsive transcription factors of rice by CPPU, a synthetic cytokinin, during water deficit stress at protein level
    Ranjit Singh Gujjar, Kanyaratt Supaibulwatana, Sangeeta Srivastava, Atul Kumar Upadhyay
    Cereal Research Communications.2025; 53(1): 291.     CrossRef
  • Diverse Roles of MAX1 Homologues in Rice
    Marek Marzec, Apriadi Situmorang, Philip B. Brewer, Agnieszka Brąszewska
    Genes.2020; 11(11): 1348.     CrossRef
  • In Silico Identification of QTL-Based Polymorphic Genes as Salt-Responsive Potential Candidates through Mapping with Two Reference Genomes in Rice
    Buddini Abhayawickrama, Dikkumburage Gimhani, Nisha Kottearachchi, Venura Herath, Dileepa Liyanage, Prasad Senadheera
    Plants.2020; 9(2): 233.     CrossRef
  • Unraveling the Genetic Elements Involved in Shoot and Root Growth Regulation by Jasmonate in Rice Using a Genome-Wide Association Study
    Huong Thi Mai To, Hieu Trang Nguyen, Nguyet Thi Minh Dang, Ngan Huyen Nguyen, Thai Xuan Bui, Jérémy Lavarenne, Nhung Thi Phuong Phung, Pascal Gantet, Michel Lebrun, Stephane Bellafiore, Antony Champion
    Rice.2019;[Epub]     CrossRef
  • Xylem cavitation susceptibility and refilling mechanisms in olive trees infected by Xylella fastidiosa
    Erika Sabella, Alessio Aprile, Alessandra Genga, Tiziana Siciliano, Eliana Nutricati, Francesca Nicolì, Marzia Vergine, Carmine Negro, Luigi De Bellis, Andrea Luvisi
    Scientific Reports.2019;[Epub]     CrossRef
  • Application of Statistical Tools for Data Analysis and Interpretation in Rice Plant Pathology
    Parsuram Nayak, Arup Kumar Mukherjee, Elssa Pandit, Sharat Kumar Pradhan
    Rice Science.2018; 25(1): 1.     CrossRef
  • Identification and characterization of responsive genes in rice during compatible interactions with pathogenic pathovars of Xanthomonas oryzae
    Moein Khojasteh, Bahman Khahani, Mohsen Taghavi, Elahe Tavakol
    European Journal of Plant Pathology.2017;[Epub]     CrossRef
  • Finding loci associated to partial resistance to white pine blister rust in sugar pine (Pinus lambertiana Dougl.).
    Alejandra Vázquez-Lobo, Amanda R. De La Torre, Pedro J. Martínez-García, Carl Vangestel, Jill L. Wegzryn, Irina Ćalić, Deems Burton, Dean Davis, Bohun Kinloch, Detlev Vogler, David B. Neale
    Tree Genetics & Genomes.2017;[Epub]     CrossRef
  • Histological and proteomics analysis of apple defense responses to the development of Colletotrichum gloeosporioides on leaves
    Mathias Ferrari Rockenbach, José Itamar Boneti, Gabriela Claudia Cangahuala-Inocente, Maria Carolina Andrade Gavioli-Nascimento, Miguel Pedro Guerra
    Physiological and Molecular Plant Pathology.2015; 89: 97.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae
Plant Breed. Biotech.. 2013;1(4):354-365.   Published online December 31, 2013
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae
Plant Breed. Biotech.. 2013;1(4):354-365.   Published online December 31, 2013
Close

Figure

  • 0
  • 1
  • 2
  • 3
Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae
Image Image Image Image
Fig. 1 Phenotypic analysis of the rice bbr1 mutant. (a) Water-soaked disease lesions on three leaves from wild type ‘Dongan’ (WT) and bbr1 mutants (M6). 40-day-old plants were inoculated with Xoo. Image was taken two weeks after Xoo inoculation. (b) Leaf lesion lengths of eight bbr1 M6 progeny. Lesion lengths were measured at two weeks post Xoo inoculation. Experiments were repeated two times with similar results. Each data point represents the average and standard deviation of at least three leaves.
Fig. 2 Gene ontology classification of differentially expressed genes in rice leaves at 10 day post inoculation. Functional categories are derived from the primary annotation of biological process retrieved from the Kyoto Encyclopedia of Genes and Genomes (KEGG; www.genome.jp/kegg). Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses. White bars indicated the number of four-fold down regulated genes and black bars indicated the number of four-fold up-regulated genes compared to the WT.
Fig. 3 Altered expressions of genes related to Xoo inoculation in bbr1. The rice ACTIN gene was used as an internal positive control and transcript levels of the tested genes were normalized with that of ACTIN. Relative expressions of the tested genes were compared with that in WT plants. Bar represents standard deviation (three replicates) (a) qRT-PCR analysis was performed to study the transcript levels of peroxidase genes in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include POD-1, Os03g0235000; POD-2, Os07g0677100; POD-3, Os07g0677200; POD-4, Os08g0113000. (b) qRT-PCR analysis of the transcripts level of defense-related genes in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include R-1, Os01g0944900; R-2, Os02g0194700; R-3, Os03g0129100. (c) qRT-PCR analysis of the transcripts level of transcription factor genes in the in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include TF-1, Os02g0527300; TF-2, Os06g0127100; TF-3, Os08g0474000; TF-7, Os01g0975300; TF-8, Os01g0141000.
Fig. 4 Venn diagram of more than two folds up- and down-regulated genes with different AP2 domain binding motif in bbr1 mutant. A total 117 genes were differentially expressed before and after Xoo infection, among which 90 putative target genes contain DRE-related core motifs (80 genes), GCC-box (36 genes) and AP2+B3 binding motif (51 genes) in their putative promoter regions.
Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae

Thirty-six GCC-box containing differentially expressed genes in bbr1 mutant compared to wild type.

Gene Description Gene Title AGI Number Number of GCC-box in putative promoter regiona Average fold changeb

GCCGCC GGCGGC Total No NT Xoo
Transcription factor activity
 MYB family transcription factor Os01g0863300 AT2G38090 3 3 6 7.5 8.72
 MYB family transcription factor Os02g0104500 AT1G76890 5 10 15 −5.62 −2.1
Response to stress
 HSF-type DNA-binding domain containing protein Os06g0553100 AT3G24520 0 4 4 2.69 24.93
 VQ domain containing protein Os01g0278000 AT2G41010 1 1 2 4.84 7.29
 oxidoreductase/transition metal ion binding protein Os09g0445600 AT5G19875 1 5 6 3.57 6.87
 Similar to F-BOX STRESS INDUCED 2 Os07g0561300 AT4G21510 5 3 8 3.64 6.57
 Calmodulin-related calcium sensor protein Os01g0955100 AT1G76640 1 1 2 7.24 6.32
 phosphate carrier protein Os09g0454600 AT3G48850 4 2 6 3.86 6.19
 diacylglycerol kinase 1 Os12g0224000 AT5G63770 1 1 2 2.31 2.75
 PR (pathogenesis-related) peptide Os12g0437800 AT2G38870 12 5 17 −3.81 1.06
Protein modification process
 protein phosphatase 2C Os03g0268600 AT2G29380 1 2 3 7.29 9.99
 STE_MEKK_ste11_MAP3K.6 - STE kinases Os01g0699500 AT5G55090 2 0 2 9.48 9
 receptor protein kinase CRINKLY4 precursor Os08g0374600 AT3G55950 2 0 2 4.94 8.88
 protein kinase Os02g0165100 AT1G16670 2 0 2 6.63 8.63
 STE_MEKK_ste11_MAP3K.4 - STE kinases Os01g0699100 AT5G55090 2 2 4 3.1 7.44
 protein phosphatase 2C Os01g0583100 AT1G17550 1 1 2 2.93 3.77
Nucleotide binding
 WD domain containing protein Os01g0383700 AT4G03020 2 0 2 4.42 5.19
Development
 late embryogenesis abundant protein D-34 Os06g0341300 AT3G22490 4 3 7 5.39 15.56
 senescence-associated gene 29 Os02g0513100 AT3G48740 2 0 2 4.47 10.93
 Auxin regulated protein? Os01g0851100 AT2G37980 1 1 2 3.86 6.41
Metabolic procss
 fringe-related protein Os03g0269900 AT2G37730 3 2 5 3.86 6.94
 gibberellin receptor GID1L2 Os03g0790500 AT5G06570 1 1 2 4.76 6.82
 Anthranilate synthase alpha 2 subunit Os03g0264400 AT2G29690 2 0 2 3.4 3.23
 starch synthase Os06g0133000 AT1G32900 1 1 2 13.45 1.23
Unknown function
 transposon protein Os01g0186900 0 3 3 17.03 15.89
 expressed protein Os01g0305200 AT1G69510 1 9 10 4.3 9.88
 RPGR, putative Os03g0296200 1 1 2 6.77 8.97
 expressed protein Os02g0527200 AT2G27830 2 4 6 5.1 8.57
 expressed protein Os02g0601000 4 0 4 4.99 6.54
 expressed protein Os06g0133300 4 2 6 4.3 4.13
 expressed protein Os01g0138500 AT2G01260 0 1 1 2.88 4.13
 DUF966 domain containing protein Os01g0975000 AT5G59790 2 3 5 3.48 4.04
 cyclase/dehydrase family protein Os01g0772400 AT4G17650 1 3 4 3.36 3.38
 expressed protein Os12g0209700 AT4G10930 2 3 5 −2.31 −2.19
 expressed protein Os11g0307600 2 0 2 −7.41 −2.37
 Similar to pnn protein Os12g0516700 1 23 24 −3.88 −3.67

aOccurrence of GCC-box (GCCGCC or GGCGGC) in 2 kb upstream region of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Seventy-nine DRE binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Description Gene Title AGI Number Number of DRE-box in putative promoter regiona Average fold changeb

CCGAC GTCGG Total No. NT Xoo
Transcription factor activity
 Tify domain containing protein Os10g0391400 No 5 3 8 2.98 85.24
 transcription factor bHLH92-like Os03g0741100 No 1 1 2 2.4 35.02
 Heat shock transcription factor 31 Os02g0527300 AT2G26150 0 1 1 3.05 26.01
 WRKY DNA -binding domain Os01g0821300 No 2 6 8 2.14 25.72
 Similar to MCB2 protein (Myb-type) Os01g0863300 AT5G04760 4 0 4 3.39 19.37
 Chitin-inducible gibberellin-responsive protein Os07g0545800 AT5G48150 1 3 4 2.08 12.32
 RING/FYVE/PHD-type domain containing protein Os02g0682300 No 1 0 1 2.65 8.86
 Tify domain containing protein Os09g0439200 No 2 1 3 3.07 8.84
 MYC/bHLH transcription factor-like Os06g0164400 AT5G67110 2 1 3 2.51 6.05
 NAM protein domain containing protein Os12g0123800 AT5G18270 0 1 1 2.85 4.36
Response to stress
 Avr9Cf-9 rapidly elicited protein 74 Os06g0248500 No 4 1 5 3.24 95.27
 hypothetical protein Os01g0186900 AT5G12010 1 1 2 2.97 92.16
 Avr9Cf-9 rapidly elicited protein 74 Os03g0240600 No 1 0 1 2.65 57.38
 EF-hand Ca2+-binding protein CCD1 Os06g0683400 AT4G27280 8 1 9 2.33 23.83
 GLYCINE-RICH PROTEIN 8 Os01g0278000 AT4G39260 2 0 2 2.56 13.9
 RPM1-INDUCED PROTEIN KINASE Os09g0442100 AT2G05940 2 0 2 2.58 13.33
 phosphate transport protein Os09g0454600 AT5G14040 1 2 3 2.46 9.71
 expressed protein Os01g0582600 AT5G12010 2 1 3 2.18 9.36
 putative beta-1,3 glucanase Os09g0542900 AT1G76070 1 1 2 2.23 9.32
 Similar to Protein phosphatase 2C Os01g0583100 AT5G57050 1 1 2 2.93 5.22
 heat shock protein Oshsp18.0 Os03g0267000 AT3G46230 0 5 5 2.54 4.68
 Dehydrin Rab25 Os01g0702500 No 2 1 3 4.59 3.68
 subtilisin-chymotrypsin inhibitor-2A-like Os12g0437800 No 3 6 9 −3.81 1.06
Protein modification precess
 protein kinase domain containing protein Os01g0699600 No 0 1 1 3.65 70.53
 protein kinase domain containing protein. Os01g0699500 No 2 0 2 3.25 26.42
 HIGHLY ABA-INDUCED PP2C GENE 3 Os03g0268600 AT2G29380 3 1 4 3.24 22.68
 Protein kinase Os02g0165100 No 2 1 3 2.76 20.92
 Similar to Receptor kinase-like Os08g0374600 No 1 1 2 3.02 14.39
 MAPKKK18 Os01g0699400 AT1G05100 2 0 2 2.93 11.11
 Oryza sativa MAP kinase BIMK1 Os03g0285800 No 3 2 5 2.61 10.7
 protein kinase domain containing protein Os01g0699100 No 4 3 7 3.61 6.43
 diacylglycerol kinase Os12g0224000 No 2 1 3 2.04 3.19
 Similar to Chaperone protein dnaJ 1 Os03g0822800 AT5G59610 1 1 2 2.6 −1.12
Biosynthetic process
 Similar to Viviparous-14 Os07g0154100 No 0 1 1 2.48 16.14
 Mog1/PsbP Os01g0934400 AT3G05410 1 2 3 4.89 8.9
 GRANULE BOUND STARCH SYNTHASE 1 Os06g0133000 AT1G32900 2 2 4 13.45 1.23
 Similar to Cytochrome P450 Os07g0635500 AT2G46960 6 1 7 2.82 6.25
Development
 zinc finger protein ZFP15 mRNA Os03g0820400 No 4 2 6 3.91 34.75
 Seed maturation protein domain containing protein Os06g0341300 AT3G22490 1 2 3 4.37 19.29
 CALMODULIN LIKE 39 Os01g0955100 AT1G76640 1 1 2.53 18.25
 Late embryogenesis abundant protein Os01g0705200 No 1 0 1 3.21 6.62
Gene regulation
 arginine/serine-rich 12 Os12g0516700 1 17 18 −3.84 −3.63
Metabolic process
 hypothetical protein Os01g0952900 No 1 3 4 3.73 248.65
 Nuclease, Phoaphatase Os01g0716800 AT1G71710 1 2 3 2.87 15.91
 α/β hydrolase fold-3 domain containing protein Os03g0790500 AT5G06570 2 0 2 2.83 11.52
 putative beta-1,3 glucanase Os03g0792800 AT1G64760 1 2 3 2.91 6.35
 putative 4-coumarate-CoA ligase Os01g0901600 AT5G63380 1 1 2 2.25 5.04
 Similar to H-ATPase Os03g0689300 AT5G62670 0 1 1 3.53 4.88
Transport
 peptidylprolyl isomerase ROC7 Os06g0708300 AT4G39220 1 1 2 2.65 10.09
 Similar to MtN3 protein precursor Os02g0513100 AT5G50800 1 1 2 5.73 8.59
 putative axi 1 protein Os01g0851100 AT2G37980 2 0 2 3.62 6.9
 Anthranilate synthase component I family protein Os03g0264400 AT5G05730 2 2 4 2.24 4.94
 dehydrase family protein Os01g0772400 AT4G17650 2 1 3 4.09 2.8
 Similar to GTP-binding nuclear protein Ran1B Os06g0600301 AT5G55190 1 0 1 2.15 2.12
Nucleotide binding
 WD-40 repeat family protein Os01g0383700 AT4G03020 4 2 6 3.56 6.49
Unknown function
 ZIM domain containing protein Os03g0181100 No 3 5 8 2.73 56.55
 hypothetical protein Os06g0133500 No 1 0 1 3.01 45.58
 hypothetical protein Os02g0733900 No 1 1 2 3.47 44.9
 DWNN domain domain containing protein Os03g0659400 No 1 2 3 2.91 19.86
 hypothetical protein Os02g0527200 No 4 4 8 2.55 17.3
 hypothetical protein Os02g0601000 No 3 5 8 2.47 13.29
 hypothetical protein Os01g0305200 No 4 5 9 3.23 13.21
 hypothetical protein Os01g0121600 No 0 2 2 2.51 10.85
 hypothetical protein Os03g0296200 No 4 0 4 6.64 9.28
 hypothetical protein Os07g0115500 No 1 1 2 2.58 9.08
 hypothetical protein Os06g0133300 No 0 1 1 2.34 7.59
 DUF604 family protein Os03g0269900 AT2G37730 1 0 1 3.6 7.49
 DUF966 family protein Os01g0975000 No 2 2 4 2.24 6.31
 Cyclin-like F-box domain containing protein Os07g0561300 No 5 2 7 3.9 6.17
 hypothetical protein Os09g0445600 AT2G31940 0 2 2 4.22 5.75
 DUF789 family protein Os01g0138500 AT2G01260 4 4 8 2.28 5.22
 TonB box domain containing protein Os09g0532000 No 1 0 1 2.35 4.15
 Conserved hypothetical protein Os01g0121500 No 1 0 1 2.88 3.07
 hypothetical protein Os07g0516400 No 1 2 3 4.83 3
 metallothionein-like type 2 (OsMT-2) mRNA Os01g0149200 No 1 3 4 2.77 2.78
 hypothetical protein Os12g0209700 No 4 2 6 −2.36 −2.14
 Hydroxyproline-rich glycoprotein DZ-HRGP Os11g0307600 No 3 0 3 −4.59 −2.89
 similar to GT-2 factor Os02g0104500 No 2 0 2 −5.62 −2.1
 hypothetical protein Os01g0303800 No 3 3 6 −2.08 −14.42

aOccurrence of DRE binding domain (CCGAC or GTCGG ) in 2 kb region up stream of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. -3 = 3-fold decrease)

Fifty-one RAV1 binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Gene Description Gene Title AGI Number Number of RAV-binding site in putative promoter regiona Average fold changeb

CAACA+ CACCTG TGTTG+ CAGGTG Total NO NT Xoo
Transcription factor activity
 WRKY108, expressed Os01g0821300 AT4G11070 1 1 2 5.86 9.35
 HSF-type DNA-binding domain containing protein Os06g0553100 AT3G24520 1 0 1 2.69 4.03
Response to stress
 U-box protein CMPG1 Os06g0248500 AT5G37490 0 1 1 14.72 20.82
 cytochrome P450 Os12g0150200 AT2G27690 1 1 2 14.57 18.57
 Similar to ATL31 and ATL6 Os02g0759400 AT5G27420 3 0 3 9.25 12.55
 HSF-type DNA-binding domain containing protein Os02g0527300 AT5G03720 1 1 2 6.84 11.51
 Similar to RAP 2.4 Os03g0191900 AT1G78080 1 2 3 6.15 9.38
 late embryogenesis abundant protein, group 3 Os01g0705200 AT3G15670 1 0 1 2.87 7.34
 oxidoreductase/transition metal ion binding protein Os09g0445600 AT5G19875 1 0 1 3.57 6.87
 phosphate carrier protein Os09g0454600 AT3G48850 1 0 1 3.86 6.19
 Similar to RPM1-induced kinase Os09g0442100 AT2G05940 1 0 1 5.76 5.96
 Similar to PEN3 Os01g0609300 AT1G59870 1 0 1 5.68 5.62
 expressed protein Os01g0582600 AT5G12010 1 0 1 4.24 4.81
 Similar to 4CL Os08g0448000 AT3G21240 0 1 1 4.55 4
 glutamate decarboxylase Os03g0236200 AT5G17330 2 1 3 4.27 3.46
 Similar to PR-6 proteinase inhibitor family Os12g0437800 AT2G38870 1 0 1 −3.81 1.06
 heat shock protein DnaJ Os03g0822800 AT5G59610 1 0 1 2.6 −1.12
Protein modification process
 STE_MEKK_ste11_MAP3K.7 - STE kinases Os01g0699600 AT2G32510 1 2 3 18.13 14.07
 STE_MEKK_ste11_MAP3K.6 - STE kinases Os01g0699500 AT5G55090 0 3 3 9.48 9
 receptor protein kinase CRINKLY4 precursor Os08g0374600 AT3G55950 0 1 1 4.94 8.75
 protein kinase Os02g0165100 AT1G16670 1 0 1 6.66 8.63
 protein phosphatase 2C Os09g0325700 AT2G29380 1 0 1 4.76 7.59
 STE_MEKK_ste11_MAP3K.4 - STE kinases Os01g0699100 AT5G55090 1 0 1 3.1 7.44
 STE_MEKK_ste11_MAP3K.5 - STE kinases Os01g0699400 AT5G55090 1 0 1 4.63 6.99
 protein phosphatase 2C Os01g0583100 AT1G17550 2 1 3 4.03 3.77
Nucleotide binding
 CCHC-type zinc finger Os03g0659400 AT5G47430 0 1 1 6.23 9.25
 WD domain Os01g0383700 AT4G03020 1 0 1 4.42 5.19
Development
 EF hand family protein Os06g0683400 AT2G46600 1 0 1 7.94 6.94
 growth regulator related protein Os01g0851100 AT2G37980 1 0 1 3.86 6.41
 glucan endo-1,3-beta-glucosidase precursor Os03g0792800 AT2G19440 1 0 1 3.13 5.9
 senescence-inducible chloroplast stay-green protein 1 Os09g0532000 AT4G11910 0 1 1 2.72 3.57
Metabolic procss
 lumenal PsbP Os01g0934400 AT3G05410 0 2 2 5.08 12.04
 expressed protein Os06g0203600 AT2G26310 1 0 1 9.19 11.35
 AMP-binding domain containing protein Os01g0901600 AT5G63380 1 0 1 2.69 4.2
Transport
 white-brown complex homolog protein 7 Os01g0121600 AT2G01320 1 2 3 4.87 5.54
 Rer1 protein Os06g0708300 AT4G39220 1 0 1 4.58 5.8
 ras-related protein Os06g0600301 AT5G55190 0 1 1 2.17 2.06
Unknown function
 expressed protein Os01g0952900 AT5G12340 1 0 1 27.86 33.01
 transposon protein Os01g0186900 2 0 2 17.09 15.89
 expressed protein Os06g0133500 1 0 1 10.78 12.64
 expressed protein Os01g0305200 AT1G69510 1 0 1 4.3 9.88
 RPGR, putative, Os03g0296200 1 0 1 6.82 9
 expressed protein Os02g0527200 AT2G27830 1 0 1 5.1 8.57
 expressed protein Os02g0601000 1 1 2 4.99 6.5
 expressed protein Os07g0516400 1 0 1 2.27 6.34
 expressed protein Os01g0138500 AT2G01260 1 0 1 2.88 4.07
 expressed protein Os09g0542900 AT1G76070 1 0 1 5.26 3.93
 transposon protein Os01g0872900 1 0 1 5.68 3.64
 cyclase/dehydrase family protein Os01g0772400 AT4G17650 0 1 1 3.36 3.38
 expressed protein Os12g0209700 AT4G10930 0 1 1 −2.31 −2.13

aOccurrence of RAV1 binding domain (CAACA--CACCTG or TGTTG--CAGGTG) in 2 kb region upstream of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Summary table displaying Arabidopsis orthologous of differentially expressed genes with known roles in disease resistance (R- ), transcript regulation (TF- ) and oxidative stress (POD- ) and sequences of forward and reverse primers used in quantitative RT-PCR to validate the 17 selected gene expression changes determined by microarray analysis. TF, Transcription factor; R, Resistance; POD, Peroxidase.

Primer name Gene title Arabidopsis orthologous Forward-primer Reverset-primer
TF-1 Os02g0527300 AT2G26150 gtggcactagtcagcaagca tactctcccaagctgcgttt
TF-2 Os06g0127100 AT4G25480 ctacgcgtactacggcaaca gaggagcaaagctggttgag
TF-3 Os08g0474000 AT4G34410 gagacaggggaccagctct ttcaattagtacaccagagccaat
TF-4 Os04g0583900 AT5G37260 ctccacaaaacagggagtgg tgttttctttagctcgcctgt
TF-5 Os03g0327800 AT3G04070 ctaggtcgtccgatcatgc ccggctttatgatcttgaca
TF-6 Os07g0558100 AT4G21440 gcaacaaccacaacgtcaac agtgttcgattcggctctgt
TF-7 Os01g0975300 AT5G59780 cagccagaggatgagtcgt gcgaataatccgagcagaag
TF-8 Os01g0141000 AT1G13260 atcagcgtactcctgcccta tgcaatctctgacctgacaaa
R-1 Os01g0944900 AT4G16260 gcttactacccggacgtcaa atgacggatgggttggtg
R-2 Os02g0194700 AT3G45140 gctgcatttgggacaagatt atccgtccgcatgacatact
R-3 Os03g0129100 AT2G39200 aaagggtgaggtcggaagat ggccatcaccgttgtacact
R-4 Os06g0698300 AT4G31750 ctgcaaagaagctcctccag tctgcttggcacaagacaac
R-5 Os10g0490800 AT2G15130 gtggactacgcgaagcaggt gtcacctccgtcctcacg
POD-1 Os03g0235000 AT5G06720 ggcaactccatggtcaagat gcgctccacaacacattaaa
POD-2 Os07g0677100 AT5G05340 atcaggcttagctgctccaa tcggtacataacatgggcttc
POD-3 Os07g0677200 AT5G05340 agctgctccaaggtgaactc atggctgctctgctccatac
POD-4 Os08g0113000 AT4G33420 ctgaattgcccgccttag cctccatgccacaatacaaa
ACTIN Os03g50890 AT3G18780 ggaactggataggtcaaggc agtctcatggatacccgcag

Highlight of differentially expressed genes with known or putative roles in stress response and transcript regulation. Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses.

Description Gene Title Average fold changea
Transcription factor activity
 TF-1; Similar to Heat shock transcription factor 31 Os02g0527300 11.52
 TF-2; AP2, Similar to CBF-like protein Os06g0127100 43.92
 TF-3; AP2, Similar to AP2 domain containing protein RAP2.6 Os08g0474000 51.32
 TF-4; MYB, Similar to LHY protein Os04g0583900 6.12
 TF-5; NAM, No apical meristem (NAM) domain containing protein Os03g0327800 5.37
 TF-6; MYB, Similar to Myb-related transcription factor LBM1 Os07g0558100 6.04
 TF-7; MYB, Similar to Typical P-type R2R3 Myb protein Os01g0975300 −7.52
 TF-8; AP2, RAV-like protein Os01g0141000 −4.17
Response to biotic stress
 R-1; Similar to Beta-1,3-glucanase-like protein Os01g0944900 19.29
 R-2; Similar to Lipoxygenase 2.3, chloroplast precursor Os02g0194700 10.9
 R-3; Seven transmembrane protein MLO2 Os03g0129100 8.27
 R-4; Protein phosphatase 2C family protein Os06g0698300 7
 R-5; Similar to NtPRp27 Os10g0490800 14.22
 Similar to Iron-phytosiderophore transporter protein yellow stripe 1 Os02g0649900 −6.28
 Similar to Pathogen-related protein Os01g0731100 −8.17
Response to oxidative stress
 POD-1; Peroxidase Os03g0235000 −42.2
 POD-2; Peroxidase Os07g0677100 −7.73
 POD-3; Peroxidase Os07g0677200 −4.79
 POD-4; Similar to Peroxidase 47 precursor Os08g0113000 −14.6
Response to abiotic stress
 Late embryogenesis abundant (LEA) group 1 family Os04g0589800 25.25
 Similar to Low-temperature induced protein lt101.2 Os05g0122700 16.92
 Similar to Allyl alcohol dehydrogenase Os04g0497000 11.48
 Similar to 1-Cys peroxiredoxin; Os07g0638300 9.16
 Similar to Small heat stress protein class CIII Os02g0782500 8.33
 GRAM domain containing protein; Os12g0478100 7.53
 Similar to Acyl-CoA-binding protein 2 (ACBP 2) Os06g0115300 6.89
 Hly-III related proteins family protein Os06g0652200 6.54
 Similar to Dehydrin DHN1 (B8) Os01g0702500 6.42
 Heat shock protein DnaJ, N-terminal domain containing protein Os01g0606900 6.34
 EFA27 for EF hand, abscisic acid, 27kD Os04g0511200 4.86
 Glycoside hydrolase, family 17 protein Os01g0860800 4.44
 Similar to germin-like protein 8 Os08g0189850 −6.45
 Similar to germin-like protein 12 Os08g0189900 −6.92

aAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation; positive values represent up-regulation (e. g. 3 = 3-fold increase) negative values down-regulation (e. g. −3 = 3-fold decrease).

Table S1 Thirty-six GCC-box containing differentially expressed genes in bbr1 mutant compared to wild type.

Occurrence of GCC-box (GCCGCC or GGCGGC) in 2 kb upstream region of differentially expressed genes in bbr1 mutant compared to wild type.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Table S2 Seventy-nine DRE binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Occurrence of DRE binding domain (CCGAC or GTCGG ) in 2 kb region up stream of differentially expressed genes in bbr1 mutant compared to wild type.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. -3 = 3-fold decrease)

Table S3 Fifty-one RAV1 binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Occurrence of RAV1 binding domain (CAACA--CACCTG or TGTTG--CAGGTG) in 2 kb region upstream of differentially expressed genes in bbr1 mutant compared to wild type.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Table 1 Summary table displaying Arabidopsis orthologous of differentially expressed genes with known roles in disease resistance (R- ), transcript regulation (TF- ) and oxidative stress (POD- ) and sequences of forward and reverse primers used in quantitative RT-PCR to validate the 17 selected gene expression changes determined by microarray analysis. TF, Transcription factor; R, Resistance; POD, Peroxidase.
Table 2 Highlight of differentially expressed genes with known or putative roles in stress response and transcript regulation. Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation; positive values represent up-regulation (e. g. 3 = 3-fold increase) negative values down-regulation (e. g. −3 = 3-fold decrease).