Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae

Plant Breeding and Biotechnology 2013;1(4):354-365.
Published online: December 31, 2013

1Plant Systems Engineering Research Center, KRIBB, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806, Republic of Korea

2Crop Biotech Institute and Graduate School of Biotechnology, Kyung Hee University, Yongin 446-701, Korea

*Corresponding author: Suk-Yun Kwon, sykwon@kribb.re.kr, Tel: +82-42-860-4340, Fax: +82-42-860-4349

They are equally contributing authors.

• Received: November 7, 2013   • Revised: November 25, 2013   • Accepted: November 27, 2013

Copyright © 2013 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 213 Views
  • 0 Download
  • 10 Crossref
prev next
  • We analyzed the transcriptional profile of the Xoo infected bbr1 mutant using a commercial rice gene chip containing 51,279 transcripts. Microarray revealed 92 genes with increased levels of expression and 22 genes with decreased levels of expression in bbr1. Some of the differentially expressed genes were validated by qRT-PCR. Higher expression of defense-related genes and AP2 domain containing transcription factors along with lower expression of reactive oxygen scavenging enzymes may be responsible for defense signaling in the bbr1 upon Xoo infection. The putative target genes of AP2 domain containing transcription factors also showed differential gene expression during Xoo infection, some of which encoded bacterial pathogen resistance-related protein. Induction of AP2 domain containing transcription factors along with up-regulation of their putative target genes during Xoo infection may inhibit pathogen spread in the bbr1. This observation supports the hypothesis that AP2 domain containing transcription factors is involved in the regulation of differentially expressed genes in bbr1.
Rice (Oryza sativa L.) is the most important crop in the world as it feeds half of the world’s population. The stable production of rice is affected by biotic and abiotic stress. The rice diseases caused by plant pathogenic fungi, bacteria and viruses are capable of causing heavy loss on rice crop, the global yields of which is annually decreasing by 10–15% (Dai et al. 2007). The use of resistant cultivars is one of the most important factors used to control diseases.
Because worldwide rice production has been severely affected by bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo), early research efforts have been focused on the utilizing disease resistance (R) genes in rice. Since the first cloning of the R gene Xa21 which confers resistance to Xoo almost twenty years ago (Song et al. 1995), nearly 30 major R genes for resistance to Xoo have been identified (Kurata and Yamazaki 2006) and five of them: Xa1, Xa3/Xa26, xa5, xa13 and Xa27, have been cloned: (Yoshimura et al. 1998; Iyer and McCouch 2004; Sun et al. 2004; Gu et al. 2005; Chu et al. 2006; Jiang et al. 2006). Genetic studies of BB resistance have resulted in the development of donor lines carrying major R genes. A number of these donor lines have been used in rice breeding programs around the world. Using transgenic approach, agronomically important cultivars such as IR64 and IR72 have been transformed with the Xa21 gene and field trials of selected lines were successfully undertaken in China (Zhang et al. 1998; Tu et al. 2000). Further, the Xa21 gene has been introduced into a widely used restorer of hybrid rice in China, Minghui 63, in order to produce BB-resistant hybrid rice with elite agronomic characters (Zhai et al. 2002).
Mutation breeding is also an important tool for crop improvement. During the past 75 years, more than 3,100 mutant varieties have been produced worldwide (The FAO/IAEA Mutant Varieties Database, http://mvgs.iaea.org/AboutMutantVarities.aspx). More than 501 new varieties in rice have been obtained by applying different mutagenic agents. In Asia Pacific, there are approximately 343 mutants of rice released (Ahloowalia et al. 2004).
DNA microarray can measure the individual transcript level of tens of thousands of genes simultaneously, thus providing a high-throughput means for analyzing gene expression levels at the whole-genome scale (Schena et al. 1995; Chu et al. 1998) that may help elucidate the network of defense response. For example, microarray has been used to characterize the rice-pathogen interaction, such as the interaction of rice-Xoo (Li et al. 2006; Kottapalli et al. 2007), -flagellin (Fujiwara et al. 2004), -lipopolysaccharides (Desaki et al. 2006), -fungal elicitor (Kim et al. 2005), -rice dwarf virus (Shimizu et al. 2007) and -plant hopper (Cho et al. 2005).
In previous study, six rice mutant lines (M5 generation); TILL300-534, TILL300-537, TILL300-1212, TILL300-793, TILL300-693 and TILL300-651, which present resistant phenotype against Xoo KXO85 were selected from 3000 lines of gamma-ray mutated M3 plants (Lim et al. 2010). Among selected six mutant lines TILL300-651 (Bacterial Blight Resistance 1; bbr1) showed relatively strong induction of rice R gene Xa21 which confers resistance to Xoo and other rice R genes such as Pi36 and Pi-ta against Magnaporthe oryzae (Lim et al. 2010). To further understand defense response in the bbr1-Xoo interaction, we profiled the expression of rice genes involved in the phenotype of rice mutant, bbr1, using a commercial rice gene chip containing 51,279 transcripts representing two rice cultivars, indica and japonica.
Plant materials and pathogen inoculation
‘Dongan’ seeds (Oryza sativa L. cv. japonica) were allowed to imbibe water overnight at 22°C and kept on moistened filter paper until germination. Germinated seeds were grown in soil in a greenhouse for 40 days prior to Xoo inoculation.
Bacterial cells of Xoo were suspended in sterile distilled water and the inoculation concentration was adjusted to OD600 = 1.0 (Song et al. 1995). Rice leaves were inoculated with the bacterial suspension using the leaf clipping method (Kauffman et al. 1973). For gene expression analysis, leaf samples were collected from untreated control and infected leaves at 10 days after inoculation. The samples were flash frozen in liquid nitrogen and stored at −80°C.
RNA Isolation and qRT-PCR analysis
Total RNA was isolated from the collected samples using RNaesy mini kit (Qiagen) according to the manufacturer’s instruction. Approximately 1 μg DNA-free RNA was used for first-strand cDNA synthesis using the Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase for quantitative real-time polymerase chain reaction (qRT-PCR; Fermentas). The qRT-PCR reactions were performed using a Thermal Cycler Dice Real Time System TP850 (TaKaRa, http://www.takara-bio.com) and SYBR Premix Ex Taq (TaKaRa). Primer sets prepared at 0.1 μM final concentration were used for a final volume of 25 μL. The thermal profile of the qRT-PCR reactions was 10 min at 95°C, 40 cycles of 5 s at 95°C/20 s at 60°C. Subsequently, a dissociation curve was generated. All reactions were carried out in triplicate. Primers used for qRT-PCR are listed in the Table 1.
Microarray analysis
The microarray experiment was conducted by the DNA Link Corporation (Seoul, Korea) according to the Affymetrix technical manual (http://www.affymetrix.com/support/index.affx). Total RNAs were extracted from the samples stored at −80 °C and gene expression was compared between the wild type ‘Dongan’ and bbr1 mutant with two replicates. Hybridization, washing, staining and scanning procedures were performed as described in the Affymetrix technical manual. The analysis software was the Affymetrix Command Console, R affy-package (2.9.2), Expression Console1.1, DAVID.
Isolation of the bbr1 mutant with enhanced Xoo resistance
To examine whether the Xoo resistant phenotype can be maintained in the next generation, progeny from the TILL300-651 (M5) were tested for the Xoo resistance phenotype. Figure 1a shows a picture of typical leaves from each of the following inoculated wild type ‘Dongan’ and bbr1 mutant. While all bbr1 mutant progenies tested were resistant, showing relatively short lesions, inoculated leaves of wild type ‘Dongan’ developed water soaked long lesions (Fig. 1a, b). This result demonstrates that the bbr1 mutant enhanced resistance to Xoo.
Differential gene expression in the leaves of bbr1 mutant plants
Leaf samples were collected from the uninoculated (no treatment; NT) and Xoo-inoculated (10 DAI) wild type ‘Dongan’ (WT) and bbr1 mutant (M6), to detect differential gene expression under both conditions. To reduce experimental variation we separately pooled the leaf samples from eight inoculated/uninoculated WT and bbr1 mutant of individual biological replicate. Total RNA was then isolated from pooled samples and used for labeling. To identify the significantly differential expression of Xoo responsive genes in bbr1 compared to WT, we applied the following criteria; (a) the gene expression change occurred at the same direction (increase or decrease) in replication; and (b) the average ratio (fold change of bbr1/WT signal intensity) of expression levels in all microarray analyses was greater than 4 or less than −4. Applying these criteria, we detected 92 genes with increased (up-regulated) levels of expression and 22 genes with decreased (down-regulated) levels of expression in bbr1 (Fig. 2). These genes were considered as characteristics of the bbr1 mutant during Xoo infection. These 114 differentially expressed genes (DEGs) were further analyzed and annotated using public access databases (http://www.genome.jp/kegg). According to predicted functions of their homologous genes in Arabidopsis, these genes could be assigned to eleven biological process categories (Fig. 2), including defense and/or stress response, carbohydrate metabolic process, hormone responses, lipid metabolic process, nucleic acid metabolism, oxidation reduction, phosphate metabolism, protein metabolism, structure, transport and unknown function. Major categories of DEGs were biotic and abiotic stress related and transcription factors (Table 2). Thirty-three genes were classified into these categories and only considered for functions on specific pathways to further illustrate the differential response of WT and bbr1 mutant to Xoo infection (Table 2).
Defense-related genes induced in bbr1 mutant
Higher expression of β-1,3-glucanase-like protein (Os01g0944900; >19 fold), lipoxygenase 2.3, chloroplast precursor (Os02g0194700; >10 fold), seven transmembrane protein MLO2 (Os03g0129100; >8 fold), protein phosphatase 2C family protein (Os06g0698300; 7 fold) and basic secretory protein (Os10g0490800; >14 fold) genes were detected at 10 DAI in bbr1 mutant plant. On the other hand, lower expression of iron-phytosiderophore transporter protein yellow stripe 1 (Os02g0649900; >6 fold) and pathogen-related protein (Os01g0731100; >8 fold) were detected in Xoo-infected bbr1 leaf tissue (Table 1). qRT-PCR analysis further confirmed the expression of representative five genes (R-1 ~ R-5; Table 1) that were highly up-regulated in bbr1 mutant 10 DAI. Among the five genes, three [Os01g0944900 (β-1,3-glucanase-like protein; R-1), Os02g0194700 (lipoxygenase 2.3 chloroplast precursor (R-2); and Os03g0129100 (seven transmembrane protein MLO2; R-3) were expressed at higher levels in bbr1 than in WT after Xoo inoculation (Fig. 3a).
As a member of the PR-2 group of pathogenesis-related (PR) proteins, β-1,3-glucanase is induced by pathogen infection and plays an active antifungal role in hydrolyzing β-1,3-glucan, a major structural component of fungal cell walls (Sela-Buurlage et al. 1993; Jach et al. 1995). Lipid peroxidation, triggered by lipoxygenases and reactive oxygen species (ROS), is a hallmark of plant pathogen responses, both in signal transduction processes and during the execution of programmed cell death. Lipoxygenases oxidize free fatty acids in the cytosol or chloroplasts, thereby initiating several oxylipin pathways including the jasmonic acid and hydroperoxide lyase pathway (Mosblech et al. 2009). Twelve predicted Mlo homologs were identified in the rice genome (Goff et al. 2002). The seven transmembrane MLO protein (Devoto et al. 1999) is thought to mediate defense suppression against Blumeria graminis f. sp. hordei attack via direct Ca2+-dependent interaction with calmodulin (Kim et al. 2002). MLO- mediated defense suppression also likely involves one or several small GTP-binding proteins of the ROP (Rho- related GTPases from plants) family (Schultheiss et al. 2002). Consistent with its involvement in plant-microbe interactions, MLO expression is induced upon biotic and abiotic stress stimuli (Piffanelli et al. 2002). Induction of defense related genes during Xoo infection may inhibit pathogen spread in the bbr1.
Peroxidase genes reduced in bbr1 mutant
Four class III peroxidases genes [Os03g0235000 (POD-1), Os07g0677100 (POD-2), Os07g0677200 (POD-3) and Os08g0113000 (POD-4) were expressed at lower levels in the bbr1 mutant than in WT 10 DAI (Table 2). qRT-PCR also confirmed lower level of four peroxidases expression (Fig. 3b). Peroxidases belong to well-known class of PR-9 proteins (van Loon et al. 2006). They are expressed to limit cellular spreading of the infection through the establishment of structural barriers or generation of highly toxic environments by massively producing ROS and reactive nitrogen species (RNS) (Passardi et al. 2005). Since POD scavenges the ROS, a reduced activity of this enzyme will increase the levels of ROS and result in hastened cell death. Down-regulation of PODs in bbr1 may therefore result in enhanced resistance against the invading pathogen. A lower expression of four PODs in bbr1 mutant implies the ROS involvement in defense against Xoo invasion.
Induced and suppressed genes encoding transcription factors
WRKY, myeloblastosis (MYB), APETALA2 (AP2) domain containing transcription factors (ethylene-responsive element-binding proteins; EREBPs, C-repeat-binding proteins; CBFs, related to ABI3/VP1; RAV), basic region/leucine zipper motif (bZIP), no apical meristem (NAM), zinc- finger proteins, and heat shock factors (HSFs) are encoded by large gene families and have been intensively studied for their roles in stress responses (Kagaya et al. 1999; Singh et al. 2002; Saibo et al. 2009; Hirayama and Shinozaki 2010; Santos et al. 2011; Scharf et al. 2012).
Higher expression of heat shock transcription factor 31 (Os02g0527300; >11 fold), RAP2.6 (Os08g0474000; >50 fold) and CBF-like protein (Os06g0127100; >40 fold), MYB domain containing protein LHY (Os04g0583900; >6 fold) and LBM1 (Os07g0558100; >6 fold) and NAM domain containing protein (Os03g0327800; >5 fold) genes were detected in bbr1 mutant plant 10 DAI. On the other hand, lower expression of typical P-type R2R3 MYB protein (Os01g0975300; >7 fold) and AP2 domain containing protein RAV (Os01g0141000; >4 fold) were detected in Xoo-infected bbr1 leaf tissue (Table 2). qRT-PCR analysis further confirmed the expression of eight representative transcription factor genes (TF1-1 ~ TF-8; Table 1) that were highly up- and down-regulated in bbr1 mutant 10 DAI. The result showed that expression levels of TF-1 (heat shock transcription factor 31), TF-2 (CBF-like protein) and TF-3 (RAP2.6) were increased in bbr1 whereas TF-7 (typical P-type R2R3 Myb protein) and TF-8 (RAV-like protein) were suppressed in bbr1 which are in agreement with the microarray results (Fig. 3c). Due to the central role of ERF and CBFs/DREBs in biotic and abiotic stress responses and their ability to regulate a large number of stress-responsive target genes, induction of these transcription factors are involved in the regulation of differentially expressed genes in bbr1.
AP2 domain containing transcription factors is involved in the regulation of differentially expressed genes in bbr1
On the basis of the number of AP2/ERF domains encoded and the gene function, the AP2/EREBP gene family has been divided into four subfamilies: AP2, RAV, DREB and ERF (Sakuma et al. 2002). Both ERF and DREB/CBF subfamilies are of particular interest owing to their involvement in plant responses to stresses. ERF subfamily genes encode a large number of ERFs (Fujimoto et al. 2000), which have been shown to participate in the plant response to biotic stress such as pathogens by recognizing the cis-acting element GCCGCC, known as the GCC-box (Hao et al. 1998). The DREB subfamily genes play an important role in the resistance of plants to abiotic stresses by recognizing the dehydration responsive element (DRE), which has a core motif CCGAC (Liu et al. 1998). The transcription factors, RAV1 and RAV2, contain an AP2 domain in the N-terminal regions and a B3 domain in the C-terminal regions (Kagaya et al. 1999). Using binding site selection assays, the AP2 and B3 domains of RAV1 were found to bind to the CAACA and CACCTG motifs (Kagaya et al. 1999). Ectopic expression of the CaRAV1 gene in transgenic Arabidopsis plants resulted in the induction of some pathogenesis related (PR) genes, enhancing resistance against infection by bacterial pathogens, and tolerance to osmotic stresses caused by high salinity and dehydration conditions (Sohn et al. 2006).
Among the differentially expressed transcription factor genes observed in this study, the average expression fold change of RAP2.6 (51.32 fold higher than wild type) and CBF like protein (43.92 fold higher than wild type) are the highest in the bbr1. Another AP2 domain containing transcription factor RAV-like protein (4.17 fold lower than wild type) is also suppressed in the bbr1 after Xoo infection (Table 2). The extent of induction or repression of an individual gene by Xoo infection in bbr1 depends on a complex interaction between its transcription apparatus and associated regulation related sequences. To analyze the promoter region of target genes we selected 117 candidates which are more than two fold up- or down-regulated genes in bbr1 and used sequences located 2 kb upstream of the 5′ termini of each candidate genes. Among 117 candidate genes, GCC-box (GCCGCC; Table S1), DRE-related core motifs (CCGAC; Table S2) and AP2+B3 binding motif (CAACA and CACCTG; Table S3) are found in the promoter regions of 90 (73.77%) putative target genes (Fig. 4). Among the genes we detected, several were reported to be related to disease resistance, such as F-BOX STRESS INDUCED 2 (Maldonado-Calderon et al. 2012), PEN3 (Xin et al. 2013), RPM1-INDUCED PROTEIN KINASE (Feng et al. 2012), WRKY108 (Higashi et al. 2008) and BETA-1,3-GLUCANASE 2 (Silipo et al. 2005). This observation supports the hypothesis that AP2 domain containing transcription factors are involved in the regulation of differentially expressed genes in bbr1.
Japonica rice mutant bbr1 which is selected by mutant screening in this study was characterized. The up- and down-regulated genes identified in Xoo resistant bbr1 may play a role in resistance. To investigate the Xoo resistance of the gamma-ray irradiated mutant line, bbr1, we performed the commercial rice gene chip analysis. Through DNA microarray analysis, we found significantly elevated expression of AP2 domain containing transcription factor genes, RAP2.6 (Os08g0474000) and CBF (Os06g0127100). Because the primary role of ERF and CBFs/DREBs is the regulation of a large number of target stress-responsive genes in biotic and abiotic stress, the enriched expression of the transcription factors suggests that they might be involved in the regulation of differentially expressed genes in bbr1. Also, the suppression of ROS scavenging enzyme, class III POD genes (Os03g023500, Os07g0677100, Os07g0677200, and Os08g0113000) was detected from DNA microarray analysis of bbr1. Down-regulation of PODs in bbr1 may contribute to the resistance against the invading pathogen. A lower expression of four PODs in bbr1 mutant than wild-type implies that increased ROS may have influence on the defense against Xoo invasion. These observations support the hypothesis that the genes mentioned above, contribute to bacterial blight resistance in bbr1 mutant.
Table S1
Thirty-six GCC-box containing differentially expressed genes in bbr1 mutant compared to wild type.
Table S1
Gene Description Gene Title AGI Number Number of GCC-box in putative promoter regiona Average fold changeb

GCCGCC GGCGGC Total No NT Xoo
Transcription factor activity
 MYB family transcription factor Os01g0863300 AT2G38090 3 3 6 7.5 8.72
 MYB family transcription factor Os02g0104500 AT1G76890 5 10 15 −5.62 −2.1
Response to stress
 HSF-type DNA-binding domain containing protein Os06g0553100 AT3G24520 0 4 4 2.69 24.93
 VQ domain containing protein Os01g0278000 AT2G41010 1 1 2 4.84 7.29
 oxidoreductase/transition metal ion binding protein Os09g0445600 AT5G19875 1 5 6 3.57 6.87
 Similar to F-BOX STRESS INDUCED 2 Os07g0561300 AT4G21510 5 3 8 3.64 6.57
 Calmodulin-related calcium sensor protein Os01g0955100 AT1G76640 1 1 2 7.24 6.32
 phosphate carrier protein Os09g0454600 AT3G48850 4 2 6 3.86 6.19
 diacylglycerol kinase 1 Os12g0224000 AT5G63770 1 1 2 2.31 2.75
 PR (pathogenesis-related) peptide Os12g0437800 AT2G38870 12 5 17 −3.81 1.06
Protein modification process
 protein phosphatase 2C Os03g0268600 AT2G29380 1 2 3 7.29 9.99
 STE_MEKK_ste11_MAP3K.6 - STE kinases Os01g0699500 AT5G55090 2 0 2 9.48 9
 receptor protein kinase CRINKLY4 precursor Os08g0374600 AT3G55950 2 0 2 4.94 8.88
 protein kinase Os02g0165100 AT1G16670 2 0 2 6.63 8.63
 STE_MEKK_ste11_MAP3K.4 - STE kinases Os01g0699100 AT5G55090 2 2 4 3.1 7.44
 protein phosphatase 2C Os01g0583100 AT1G17550 1 1 2 2.93 3.77
Nucleotide binding
 WD domain containing protein Os01g0383700 AT4G03020 2 0 2 4.42 5.19
Development
 late embryogenesis abundant protein D-34 Os06g0341300 AT3G22490 4 3 7 5.39 15.56
 senescence-associated gene 29 Os02g0513100 AT3G48740 2 0 2 4.47 10.93
 Auxin regulated protein? Os01g0851100 AT2G37980 1 1 2 3.86 6.41
Metabolic procss
 fringe-related protein Os03g0269900 AT2G37730 3 2 5 3.86 6.94
 gibberellin receptor GID1L2 Os03g0790500 AT5G06570 1 1 2 4.76 6.82
 Anthranilate synthase alpha 2 subunit Os03g0264400 AT2G29690 2 0 2 3.4 3.23
 starch synthase Os06g0133000 AT1G32900 1 1 2 13.45 1.23
Unknown function
 transposon protein Os01g0186900 0 3 3 17.03 15.89
 expressed protein Os01g0305200 AT1G69510 1 9 10 4.3 9.88
 RPGR, putative Os03g0296200 1 1 2 6.77 8.97
 expressed protein Os02g0527200 AT2G27830 2 4 6 5.1 8.57
 expressed protein Os02g0601000 4 0 4 4.99 6.54
 expressed protein Os06g0133300 4 2 6 4.3 4.13
 expressed protein Os01g0138500 AT2G01260 0 1 1 2.88 4.13
 DUF966 domain containing protein Os01g0975000 AT5G59790 2 3 5 3.48 4.04
 cyclase/dehydrase family protein Os01g0772400 AT4G17650 1 3 4 3.36 3.38
 expressed protein Os12g0209700 AT4G10930 2 3 5 −2.31 −2.19
 expressed protein Os11g0307600 2 0 2 −7.41 −2.37
 Similar to pnn protein Os12g0516700 1 23 24 −3.88 −3.67

aOccurrence of GCC-box (GCCGCC or GGCGGC) in 2 kb upstream region of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Table S2
Seventy-nine DRE binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.
Table S2
Description Gene Title AGI Number Number of DRE-box in putative promoter regiona Average fold changeb

CCGAC GTCGG Total No. NT Xoo
Transcription factor activity
 Tify domain containing protein Os10g0391400 No 5 3 8 2.98 85.24
 transcription factor bHLH92-like Os03g0741100 No 1 1 2 2.4 35.02
 Heat shock transcription factor 31 Os02g0527300 AT2G26150 0 1 1 3.05 26.01
 WRKY DNA -binding domain Os01g0821300 No 2 6 8 2.14 25.72
 Similar to MCB2 protein (Myb-type) Os01g0863300 AT5G04760 4 0 4 3.39 19.37
 Chitin-inducible gibberellin-responsive protein Os07g0545800 AT5G48150 1 3 4 2.08 12.32
 RING/FYVE/PHD-type domain containing protein Os02g0682300 No 1 0 1 2.65 8.86
 Tify domain containing protein Os09g0439200 No 2 1 3 3.07 8.84
 MYC/bHLH transcription factor-like Os06g0164400 AT5G67110 2 1 3 2.51 6.05
 NAM protein domain containing protein Os12g0123800 AT5G18270 0 1 1 2.85 4.36
Response to stress
 Avr9Cf-9 rapidly elicited protein 74 Os06g0248500 No 4 1 5 3.24 95.27
 hypothetical protein Os01g0186900 AT5G12010 1 1 2 2.97 92.16
 Avr9Cf-9 rapidly elicited protein 74 Os03g0240600 No 1 0 1 2.65 57.38
 EF-hand Ca2+-binding protein CCD1 Os06g0683400 AT4G27280 8 1 9 2.33 23.83
 GLYCINE-RICH PROTEIN 8 Os01g0278000 AT4G39260 2 0 2 2.56 13.9
 RPM1-INDUCED PROTEIN KINASE Os09g0442100 AT2G05940 2 0 2 2.58 13.33
 phosphate transport protein Os09g0454600 AT5G14040 1 2 3 2.46 9.71
 expressed protein Os01g0582600 AT5G12010 2 1 3 2.18 9.36
 putative beta-1,3 glucanase Os09g0542900 AT1G76070 1 1 2 2.23 9.32
 Similar to Protein phosphatase 2C Os01g0583100 AT5G57050 1 1 2 2.93 5.22
 heat shock protein Oshsp18.0 Os03g0267000 AT3G46230 0 5 5 2.54 4.68
 Dehydrin Rab25 Os01g0702500 No 2 1 3 4.59 3.68
 subtilisin-chymotrypsin inhibitor-2A-like Os12g0437800 No 3 6 9 −3.81 1.06
Protein modification precess
 protein kinase domain containing protein Os01g0699600 No 0 1 1 3.65 70.53
 protein kinase domain containing protein. Os01g0699500 No 2 0 2 3.25 26.42
 HIGHLY ABA-INDUCED PP2C GENE 3 Os03g0268600 AT2G29380 3 1 4 3.24 22.68
 Protein kinase Os02g0165100 No 2 1 3 2.76 20.92
 Similar to Receptor kinase-like Os08g0374600 No 1 1 2 3.02 14.39
 MAPKKK18 Os01g0699400 AT1G05100 2 0 2 2.93 11.11
 Oryza sativa MAP kinase BIMK1 Os03g0285800 No 3 2 5 2.61 10.7
 protein kinase domain containing protein Os01g0699100 No 4 3 7 3.61 6.43
 diacylglycerol kinase Os12g0224000 No 2 1 3 2.04 3.19
 Similar to Chaperone protein dnaJ 1 Os03g0822800 AT5G59610 1 1 2 2.6 −1.12
Biosynthetic process
 Similar to Viviparous-14 Os07g0154100 No 0 1 1 2.48 16.14
 Mog1/PsbP Os01g0934400 AT3G05410 1 2 3 4.89 8.9
 GRANULE BOUND STARCH SYNTHASE 1 Os06g0133000 AT1G32900 2 2 4 13.45 1.23
 Similar to Cytochrome P450 Os07g0635500 AT2G46960 6 1 7 2.82 6.25
Development
 zinc finger protein ZFP15 mRNA Os03g0820400 No 4 2 6 3.91 34.75
 Seed maturation protein domain containing protein Os06g0341300 AT3G22490 1 2 3 4.37 19.29
 CALMODULIN LIKE 39 Os01g0955100 AT1G76640 1 1 2.53 18.25
 Late embryogenesis abundant protein Os01g0705200 No 1 0 1 3.21 6.62
Gene regulation
 arginine/serine-rich 12 Os12g0516700 1 17 18 −3.84 −3.63
Metabolic process
 hypothetical protein Os01g0952900 No 1 3 4 3.73 248.65
 Nuclease, Phoaphatase Os01g0716800 AT1G71710 1 2 3 2.87 15.91
 α/β hydrolase fold-3 domain containing protein Os03g0790500 AT5G06570 2 0 2 2.83 11.52
 putative beta-1,3 glucanase Os03g0792800 AT1G64760 1 2 3 2.91 6.35
 putative 4-coumarate-CoA ligase Os01g0901600 AT5G63380 1 1 2 2.25 5.04
 Similar to H-ATPase Os03g0689300 AT5G62670 0 1 1 3.53 4.88
Transport
 peptidylprolyl isomerase ROC7 Os06g0708300 AT4G39220 1 1 2 2.65 10.09
 Similar to MtN3 protein precursor Os02g0513100 AT5G50800 1 1 2 5.73 8.59
 putative axi 1 protein Os01g0851100 AT2G37980 2 0 2 3.62 6.9
 Anthranilate synthase component I family protein Os03g0264400 AT5G05730 2 2 4 2.24 4.94
 dehydrase family protein Os01g0772400 AT4G17650 2 1 3 4.09 2.8
 Similar to GTP-binding nuclear protein Ran1B Os06g0600301 AT5G55190 1 0 1 2.15 2.12
Nucleotide binding
 WD-40 repeat family protein Os01g0383700 AT4G03020 4 2 6 3.56 6.49
Unknown function
 ZIM domain containing protein Os03g0181100 No 3 5 8 2.73 56.55
 hypothetical protein Os06g0133500 No 1 0 1 3.01 45.58
 hypothetical protein Os02g0733900 No 1 1 2 3.47 44.9
 DWNN domain domain containing protein Os03g0659400 No 1 2 3 2.91 19.86
 hypothetical protein Os02g0527200 No 4 4 8 2.55 17.3
 hypothetical protein Os02g0601000 No 3 5 8 2.47 13.29
 hypothetical protein Os01g0305200 No 4 5 9 3.23 13.21
 hypothetical protein Os01g0121600 No 0 2 2 2.51 10.85
 hypothetical protein Os03g0296200 No 4 0 4 6.64 9.28
 hypothetical protein Os07g0115500 No 1 1 2 2.58 9.08
 hypothetical protein Os06g0133300 No 0 1 1 2.34 7.59
 DUF604 family protein Os03g0269900 AT2G37730 1 0 1 3.6 7.49
 DUF966 family protein Os01g0975000 No 2 2 4 2.24 6.31
 Cyclin-like F-box domain containing protein Os07g0561300 No 5 2 7 3.9 6.17
 hypothetical protein Os09g0445600 AT2G31940 0 2 2 4.22 5.75
 DUF789 family protein Os01g0138500 AT2G01260 4 4 8 2.28 5.22
 TonB box domain containing protein Os09g0532000 No 1 0 1 2.35 4.15
 Conserved hypothetical protein Os01g0121500 No 1 0 1 2.88 3.07
 hypothetical protein Os07g0516400 No 1 2 3 4.83 3
 metallothionein-like type 2 (OsMT-2) mRNA Os01g0149200 No 1 3 4 2.77 2.78
 hypothetical protein Os12g0209700 No 4 2 6 −2.36 −2.14
 Hydroxyproline-rich glycoprotein DZ-HRGP Os11g0307600 No 3 0 3 −4.59 −2.89
 similar to GT-2 factor Os02g0104500 No 2 0 2 −5.62 −2.1
 hypothetical protein Os01g0303800 No 3 3 6 −2.08 −14.42

aOccurrence of DRE binding domain (CCGAC or GTCGG ) in 2 kb region up stream of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. -3 = 3-fold decrease)

Table S3
Fifty-one RAV1 binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.
Table S3
Gene Description Gene Title AGI Number Number of RAV-binding site in putative promoter regiona Average fold changeb

CAACA+ CACCTG TGTTG+ CAGGTG Total NO NT Xoo
Transcription factor activity
 WRKY108, expressed Os01g0821300 AT4G11070 1 1 2 5.86 9.35
 HSF-type DNA-binding domain containing protein Os06g0553100 AT3G24520 1 0 1 2.69 4.03
Response to stress
 U-box protein CMPG1 Os06g0248500 AT5G37490 0 1 1 14.72 20.82
 cytochrome P450 Os12g0150200 AT2G27690 1 1 2 14.57 18.57
 Similar to ATL31 and ATL6 Os02g0759400 AT5G27420 3 0 3 9.25 12.55
 HSF-type DNA-binding domain containing protein Os02g0527300 AT5G03720 1 1 2 6.84 11.51
 Similar to RAP 2.4 Os03g0191900 AT1G78080 1 2 3 6.15 9.38
 late embryogenesis abundant protein, group 3 Os01g0705200 AT3G15670 1 0 1 2.87 7.34
 oxidoreductase/transition metal ion binding protein Os09g0445600 AT5G19875 1 0 1 3.57 6.87
 phosphate carrier protein Os09g0454600 AT3G48850 1 0 1 3.86 6.19
 Similar to RPM1-induced kinase Os09g0442100 AT2G05940 1 0 1 5.76 5.96
 Similar to PEN3 Os01g0609300 AT1G59870 1 0 1 5.68 5.62
 expressed protein Os01g0582600 AT5G12010 1 0 1 4.24 4.81
 Similar to 4CL Os08g0448000 AT3G21240 0 1 1 4.55 4
 glutamate decarboxylase Os03g0236200 AT5G17330 2 1 3 4.27 3.46
 Similar to PR-6 proteinase inhibitor family Os12g0437800 AT2G38870 1 0 1 −3.81 1.06
 heat shock protein DnaJ Os03g0822800 AT5G59610 1 0 1 2.6 −1.12
Protein modification process
 STE_MEKK_ste11_MAP3K.7 - STE kinases Os01g0699600 AT2G32510 1 2 3 18.13 14.07
 STE_MEKK_ste11_MAP3K.6 - STE kinases Os01g0699500 AT5G55090 0 3 3 9.48 9
 receptor protein kinase CRINKLY4 precursor Os08g0374600 AT3G55950 0 1 1 4.94 8.75
 protein kinase Os02g0165100 AT1G16670 1 0 1 6.66 8.63
 protein phosphatase 2C Os09g0325700 AT2G29380 1 0 1 4.76 7.59
 STE_MEKK_ste11_MAP3K.4 - STE kinases Os01g0699100 AT5G55090 1 0 1 3.1 7.44
 STE_MEKK_ste11_MAP3K.5 - STE kinases Os01g0699400 AT5G55090 1 0 1 4.63 6.99
 protein phosphatase 2C Os01g0583100 AT1G17550 2 1 3 4.03 3.77
Nucleotide binding
 CCHC-type zinc finger Os03g0659400 AT5G47430 0 1 1 6.23 9.25
 WD domain Os01g0383700 AT4G03020 1 0 1 4.42 5.19
Development
 EF hand family protein Os06g0683400 AT2G46600 1 0 1 7.94 6.94
 growth regulator related protein Os01g0851100 AT2G37980 1 0 1 3.86 6.41
 glucan endo-1,3-beta-glucosidase precursor Os03g0792800 AT2G19440 1 0 1 3.13 5.9
 senescence-inducible chloroplast stay-green protein 1 Os09g0532000 AT4G11910 0 1 1 2.72 3.57
Metabolic procss
 lumenal PsbP Os01g0934400 AT3G05410 0 2 2 5.08 12.04
 expressed protein Os06g0203600 AT2G26310 1 0 1 9.19 11.35
 AMP-binding domain containing protein Os01g0901600 AT5G63380 1 0 1 2.69 4.2
Transport
 white-brown complex homolog protein 7 Os01g0121600 AT2G01320 1 2 3 4.87 5.54
 Rer1 protein Os06g0708300 AT4G39220 1 0 1 4.58 5.8
 ras-related protein Os06g0600301 AT5G55190 0 1 1 2.17 2.06
Unknown function
 expressed protein Os01g0952900 AT5G12340 1 0 1 27.86 33.01
 transposon protein Os01g0186900 2 0 2 17.09 15.89
 expressed protein Os06g0133500 1 0 1 10.78 12.64
 expressed protein Os01g0305200 AT1G69510 1 0 1 4.3 9.88
 RPGR, putative, Os03g0296200 1 0 1 6.82 9
 expressed protein Os02g0527200 AT2G27830 1 0 1 5.1 8.57
 expressed protein Os02g0601000 1 1 2 4.99 6.5
 expressed protein Os07g0516400 1 0 1 2.27 6.34
 expressed protein Os01g0138500 AT2G01260 1 0 1 2.88 4.07
 expressed protein Os09g0542900 AT1G76070 1 0 1 5.26 3.93
 transposon protein Os01g0872900 1 0 1 5.68 3.64
 cyclase/dehydrase family protein Os01g0772400 AT4G17650 0 1 1 3.36 3.38
 expressed protein Os12g0209700 AT4G10930 0 1 1 −2.31 −2.13

aOccurrence of RAV1 binding domain (CAACA--CACCTG or TGTTG--CAGGTG) in 2 kb region upstream of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

This work was supported by grants from the Technology Development Program for Agriculture and Forestry, Ministry of Agriculture, Food and Rural Affairs, Republic of Korea, and the KRIBB Research Initiative Program.
Fig. 1
Phenotypic analysis of the rice bbr1 mutant. (a) Water-soaked disease lesions on three leaves from wild type ‘Dongan’ (WT) and bbr1 mutants (M6). 40-day-old plants were inoculated with Xoo. Image was taken two weeks after Xoo inoculation. (b) Leaf lesion lengths of eight bbr1 M6 progeny. Lesion lengths were measured at two weeks post Xoo inoculation. Experiments were repeated two times with similar results. Each data point represents the average and standard deviation of at least three leaves.
pbb-01-354f1.jpg
Fig. 2
Gene ontology classification of differentially expressed genes in rice leaves at 10 day post inoculation. Functional categories are derived from the primary annotation of biological process retrieved from the Kyoto Encyclopedia of Genes and Genomes (KEGG; www.genome.jp/kegg). Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses. White bars indicated the number of four-fold down regulated genes and black bars indicated the number of four-fold up-regulated genes compared to the WT.
pbb-01-354f2.jpg
Fig. 3
Altered expressions of genes related to Xoo inoculation in bbr1. The rice ACTIN gene was used as an internal positive control and transcript levels of the tested genes were normalized with that of ACTIN. Relative expressions of the tested genes were compared with that in WT plants. Bar represents standard deviation (three replicates) (a) qRT-PCR analysis was performed to study the transcript levels of peroxidase genes in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include POD-1, Os03g0235000; POD-2, Os07g0677100; POD-3, Os07g0677200; POD-4, Os08g0113000. (b) qRT-PCR analysis of the transcripts level of defense-related genes in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include R-1, Os01g0944900; R-2, Os02g0194700; R-3, Os03g0129100. (c) qRT-PCR analysis of the transcripts level of transcription factor genes in the in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include TF-1, Os02g0527300; TF-2, Os06g0127100; TF-3, Os08g0474000; TF-7, Os01g0975300; TF-8, Os01g0141000.
pbb-01-354f3.jpg
Fig. 4
Venn diagram of more than two folds up- and down-regulated genes with different AP2 domain binding motif in bbr1 mutant. A total 117 genes were differentially expressed before and after Xoo infection, among which 90 putative target genes contain DRE-related core motifs (80 genes), GCC-box (36 genes) and AP2+B3 binding motif (51 genes) in their putative promoter regions.
pbb-01-354f4.jpg
Table 1
Summary table displaying Arabidopsis orthologous of differentially expressed genes with known roles in disease resistance (R- ), transcript regulation (TF- ) and oxidative stress (POD- ) and sequences of forward and reverse primers used in quantitative RT-PCR to validate the 17 selected gene expression changes determined by microarray analysis. TF, Transcription factor; R, Resistance; POD, Peroxidase.
Table 1
Primer name Gene title Arabidopsis orthologous Forward-primer Reverset-primer
TF-1 Os02g0527300 AT2G26150 gtggcactagtcagcaagca tactctcccaagctgcgttt
TF-2 Os06g0127100 AT4G25480 ctacgcgtactacggcaaca gaggagcaaagctggttgag
TF-3 Os08g0474000 AT4G34410 gagacaggggaccagctct ttcaattagtacaccagagccaat
TF-4 Os04g0583900 AT5G37260 ctccacaaaacagggagtgg tgttttctttagctcgcctgt
TF-5 Os03g0327800 AT3G04070 ctaggtcgtccgatcatgc ccggctttatgatcttgaca
TF-6 Os07g0558100 AT4G21440 gcaacaaccacaacgtcaac agtgttcgattcggctctgt
TF-7 Os01g0975300 AT5G59780 cagccagaggatgagtcgt gcgaataatccgagcagaag
TF-8 Os01g0141000 AT1G13260 atcagcgtactcctgcccta tgcaatctctgacctgacaaa
R-1 Os01g0944900 AT4G16260 gcttactacccggacgtcaa atgacggatgggttggtg
R-2 Os02g0194700 AT3G45140 gctgcatttgggacaagatt atccgtccgcatgacatact
R-3 Os03g0129100 AT2G39200 aaagggtgaggtcggaagat ggccatcaccgttgtacact
R-4 Os06g0698300 AT4G31750 ctgcaaagaagctcctccag tctgcttggcacaagacaac
R-5 Os10g0490800 AT2G15130 gtggactacgcgaagcaggt gtcacctccgtcctcacg
POD-1 Os03g0235000 AT5G06720 ggcaactccatggtcaagat gcgctccacaacacattaaa
POD-2 Os07g0677100 AT5G05340 atcaggcttagctgctccaa tcggtacataacatgggcttc
POD-3 Os07g0677200 AT5G05340 agctgctccaaggtgaactc atggctgctctgctccatac
POD-4 Os08g0113000 AT4G33420 ctgaattgcccgccttag cctccatgccacaatacaaa
ACTIN Os03g50890 AT3G18780 ggaactggataggtcaaggc agtctcatggatacccgcag
Table 2
Highlight of differentially expressed genes with known or putative roles in stress response and transcript regulation. Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses.
Table 2
Description Gene Title Average fold changea
Transcription factor activity
 TF-1; Similar to Heat shock transcription factor 31 Os02g0527300 11.52
 TF-2; AP2, Similar to CBF-like protein Os06g0127100 43.92
 TF-3; AP2, Similar to AP2 domain containing protein RAP2.6 Os08g0474000 51.32
 TF-4; MYB, Similar to LHY protein Os04g0583900 6.12
 TF-5; NAM, No apical meristem (NAM) domain containing protein Os03g0327800 5.37
 TF-6; MYB, Similar to Myb-related transcription factor LBM1 Os07g0558100 6.04
 TF-7; MYB, Similar to Typical P-type R2R3 Myb protein Os01g0975300 −7.52
 TF-8; AP2, RAV-like protein Os01g0141000 −4.17
Response to biotic stress
 R-1; Similar to Beta-1,3-glucanase-like protein Os01g0944900 19.29
 R-2; Similar to Lipoxygenase 2.3, chloroplast precursor Os02g0194700 10.9
 R-3; Seven transmembrane protein MLO2 Os03g0129100 8.27
 R-4; Protein phosphatase 2C family protein Os06g0698300 7
 R-5; Similar to NtPRp27 Os10g0490800 14.22
 Similar to Iron-phytosiderophore transporter protein yellow stripe 1 Os02g0649900 −6.28
 Similar to Pathogen-related protein Os01g0731100 −8.17
Response to oxidative stress
 POD-1; Peroxidase Os03g0235000 −42.2
 POD-2; Peroxidase Os07g0677100 −7.73
 POD-3; Peroxidase Os07g0677200 −4.79
 POD-4; Similar to Peroxidase 47 precursor Os08g0113000 −14.6
Response to abiotic stress
 Late embryogenesis abundant (LEA) group 1 family Os04g0589800 25.25
 Similar to Low-temperature induced protein lt101.2 Os05g0122700 16.92
 Similar to Allyl alcohol dehydrogenase Os04g0497000 11.48
 Similar to 1-Cys peroxiredoxin; Os07g0638300 9.16
 Similar to Small heat stress protein class CIII Os02g0782500 8.33
 GRAM domain containing protein; Os12g0478100 7.53
 Similar to Acyl-CoA-binding protein 2 (ACBP 2) Os06g0115300 6.89
 Hly-III related proteins family protein Os06g0652200 6.54
 Similar to Dehydrin DHN1 (B8) Os01g0702500 6.42
 Heat shock protein DnaJ, N-terminal domain containing protein Os01g0606900 6.34
 EFA27 for EF hand, abscisic acid, 27kD Os04g0511200 4.86
 Glycoside hydrolase, family 17 protein Os01g0860800 4.44
 Similar to germin-like protein 8 Os08g0189850 −6.45
 Similar to germin-like protein 12 Os08g0189900 −6.92

aAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation; positive values represent up-regulation (e. g. 3 = 3-fold increase) negative values down-regulation (e. g. −3 = 3-fold decrease).

  • Ahloowalia BS, Maluszynski M, Nichterlein K. 2004. Global impact of mutation-derived varieties. Euphytica. 135: 187-204.
  • Cho SK, Jung KW, Jeung JU, Kang KH, Shim KS, You MK, Yoo KS, Ok SH, Shin JS. 2005. Analysis of differentially expressed transcripts from planthopper-infested wild rice (Oryza minuta). Plant Cell Rep. 24: 59-67.
  • Chu S, DeRisi J, Eisen M, Mulholland J, Botstein D, Brown PO, Herskowitz I. 1998. The transcriptional program of sporulation in budding yeast. Science. 282: 699-705.
  • Chu Z, Yuan M, Yao J, Ge X, Yuan B, Xu C, Li X, Fu B, Li Z, Bennetzen JL, Zhang Q, Wang S. 2006. Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev. 20: 1250-1255.
  • Dai LY, Liu XL, Xiao YH, Wang GL. 2007. Recent advances in cloning and characterization of disease resistance genes in rice. J Integr Plant Biol. 49: 112-119.
  • Desaki Y, Miya A, Venkatesh B, Tsuyumu S, Yamane H, Kaku H, Minami E, Shibuya N. 2006. Bacterial lipopolysaccharides induce defense responses associated with programmed cell death in rice cells. Plant Cell Physiol. 47: 1530-1540.
  • Devoto A, Piffanelli P, Nilsson I, Wallin E, Panstruga R, von Heijne G, Schulze-Lefert P. 1999. Topology, subcellular localization, and sequence diversity of the Mlo family in plants. J Biol Chem. 274: 34993-35004.
  • Feng F, Yang F, Rong W, Wu X, Zhang J, Chen S, He C, Zhou JM. 2012. A Xanthomonas uridine 5′-monophosphate transferase inhibits plant immune kinases. Nature. 485: 114-118.
  • Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M. 2000. Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box-mediated gene expression. Plant Cell. 12: 393-404.
  • Fujiwara S, Tanaka N, Kaneda T, Takayama S, Isogai A, Che FS. 2004. Rice cDNA microarray-based gene expression profiling of the response to flagellin perception in cultured rice cells. Mol Plant-Microbe Interact. 17: 986-998.
  • Goff SA, Ricke D, Lan TH, Presting G, Wang R, Dunn M, Glazebrook J, Sessions A, Oeller P, Varma H, Hadley D, Hutchison D, Martin C, Katagiri F, Lange BM, Moughamer T, Xia Y, Budworth P, Zhong J, Miguel T, Paszkowski U, Zhang S, Colbert M, Sun WL, Chen L, Cooper B, Park S, Wood TC, Mao L, Quail P, Wing R, Dean R, Yu Y, Zharkikh A, Shen R, Sahasrabudhe S, Thomas A, Cannings R, Gutin A, Pruss D, Reid J, Tavtigian S, Mitchell J, Eldredge G, Scholl T, Miller RM, Bhatnagar S, Adey N, Rubano T, Tusneem N, Robinson R, Feldhaus J, Macalma T, Oliphant A, Briggs S. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science. 296: 92-100.
  • Gu K, Yang B, Tian D, Wu L, Wang D, Sreekala C, Yang F, Chu Z, Wang GL, White FF, Yin Z. 2005. R gene expression induced by a type-III effector triggers disease resistance in rice. Nature. 435: 1122-1125.
  • Hao D, Ohme-Takagi M, Sarai A. 1998. Unique mode of GCC box recognition by the DNA-binding domain of ethylene-responsive element-binding factor (ERF domain) in plant. J Biol Chem. 273: 26857-26861.
  • Higashi K, Ishiga Y, Inagaki Y, Toyoda K, Shiraishi T, Ichinose Y. 2008. Modulation of defense signal transduction by flagellin-induced WRKY41 transcription factor in Arabidopsis thaliana. Mol Genet Genomics. 279: 303-312.
  • Hirayama T, Shinozaki K. 2010. Research on plant abiotic stress responses in the post-genome era: past, present and future. Plant J. 61: 1041-1052.
  • Iyer AS, McCouch SR. 2004. The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Mol Plant Microbe Interact. 17: 1348-1354.
  • Jach G, Gornhardt B, Mundy J, Logemann J, Pinsdorf E, Leah R, Schell J, Maas C. 1995. Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco. Plant J. 8: 97-109.
  • Jiang GH, Xia ZH, Zhou YL, Wan J, Li DY, Chen RS, Zhai WX, Zhu LH. 2006. Testifying the rice bacterial blight resistance gene xa5 by genetic complementation and further analyzing xa5 (Xa5) in comparison with its homolog TFIIAgamma1. Mol Genet Genomics. 275: 354-366.
  • Kagaya Y, Ohmiya K, Hattori T. 1999. RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants. Nucleic Acids Res. 27: 470-478.
  • Kauffman HE, Reddy APK, Hsieh SPV, Marca SD. 1973. An improved technique for evaluation of resistance of rice varieties to Xanthomonas oryzae. Plant Dis Rep. 57: 537-541.
  • Kim KM, Cho SK, Shin SH, Kim GT, Lee JH, Oh BJ, Kang KH, Hong JC, Choi JY, Shin JS, Chung YS. 2005. Analysis of differentially expressed transcripts of fungal elicitor- and wound-treated wild rice (Oryza grandiglumis). J Plant Res. 118: 347-354.
  • Kim MC, Panstruga R, Elliott C, Muller J, Devoto A, Yoon HW, Park HC, Cho MJ, Schulze-Lefert P. 2002. Calmodulin interacts with MLO protein to regulate defence against mildew in barley. Nature. 416: 447-451.
  • Kottapalli KR, Rakwal R, Satoh K, Shibato J, Kottapalli P, Iwahashi H, Kikuchi S. 2007. Transcriptional profiling of indica rice cultivar IET8585 (Ajaya) infected with bacterial leaf blight pathogen Xanthomonas oryzae pv oryzae. Plant Physiol Biochem. 45: 834-850.
  • Kurata N, Yamazaki Y. 2006. Oryzabase. An integrated biological and genome information database for rice. Plant Physiol. 140: 12-17.
  • Li Q, Chen F, Sun L, Zhang Z, Yang Y, He Z. 2006. Expression profiling of rice genes in early defense responses to blast and bacterial blight pathogens using cDNA microarray. Physiological and Mol Plant Pathol. 68: 51-60.
  • Lim CJ, Lee HY, Kim WB, Ahmad R, Moon JS, Kim DS, Kwon SY. 2010. Screening of gamma radiation-induced pathogen resistance rice lines against Xanthomonas oryzae pv. oryxae. J Radiation Ind. 4: 209-213.
  • Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. 1998. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell. 10: 1391-1406.
  • Maldonado-Calderon MT, Sepulveda-Garcia E, Rocha-Sosa M. 2012. Characterization of novel F-box proteins in plants induced by biotic and abiotic stress. Plant Sci. 185–186: 208-217.
  • Mosblech A, Feussner I, Heilmann I. 2009. Oxylipins: structurally diverse metabolites from fatty acid oxidation. Plant Physiol Biochem. 47: 511-517.
  • Passardi F, Cosio C, Penel C, Dunand C. 2005. Peroxidases have more functions than a Swiss army knife. Plant Cell Rep. 24: 255-265.
  • Piffanelli P, Zhou F, Casais C, Orme J, Jarosch B, Schaffrath U, Collins NC, Panstruga R, Schulze-Lefert P. 2002. The barley MLO modulator of defense and cell death is responsive to biotic and abiotic stress stimuli. Plant Physiol. 129: 1076-1085.
  • Saibo NJ, Lourenco T, Oliveira MM. 2009. Transcription factors and regulation of photosynthetic and related metabolism under environmental stresses. Ann Bot. 103: 609-623.
  • Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K. 2002. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem Biophys Res Commun. 290: 998-1009.
  • Santos AP, Serra T, Figueiredo DD, Barros P, Lourenco T, Chander S, Oliveira MM, Saibo NJ. 2011. Transcription regulation of abiotic stress responses in rice: a combined action of transcription factors and epigenetic mechanisms. OMICS. 15: 839-857.
  • Scharf KD, Berberich T, Ebersberger I, Nover L. 2012. The plant heat stress transcription factor (Hsf) family: structure, function and evolution. Biochim Biophys Acta. 1819. 104-119.
  • Schena M, Shalon D, Davis RW, Brown PO. 1995. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science. 270: 467-470.
  • Schultheiss H, Dechert C, Kogel KH, Huckelhoven R. 2002. A small GTP-binding host protein is required for entry of powdery mildew fungus into epidermal cells of barley. Plant Physiol. 128: 1447-1454.
  • Sela-Buurlage MB, Ponstein AS, Bres-Vloemans SA, Melchers LS, Van Den Elzen P, Cornelissen B. 1993. Only Specific Tobacco (Nicotiana tabacum) Chitinases and [beta]-1,3-Glucanases Exhibit Antifungal Activity. Plant Physiol. 101: 857-863.
  • Shimizu T, Satoh K, Kikuchi S, Omura T. 2007. The repression of cell wall- and plastid-related genes and the induction of defense-related genes in rice plants infected with Rice dwarf virus. Mol Plant-Microbe Interact. 20: 247-254.
  • Silipo A, Molinaro A, Sturiale L, Dow JM, Erbs G, Lanzetta R, Newman MA, Parrilli M. 2005. The elicitation of plant innate immunity by lipooligosaccharide of Xanthomonas campestris. J Biol Chem. 280: 33660-33668.
  • Singh K, Foley RC, Onate-Sanchez L. 2002. Transcription factors in plant defense and stress responses. Curr Opin Plant Biol. 5: 430-436.
  • Sohn KH, Lee SC, Jung HW, Hong JK, Hwang BK. 2006. Expression and functional roles of the pepper pathogen-induced transcription factor RAV1 in bacterial disease resistance, and drought and salt stress tolerance. Plant Mol Biol. 61: 897-915.
  • Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH, Fauquet C, Ronald P. 1995. A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science. 270: 1804-1806.
  • Sun X, Cao Y, Yang Z, Xu C, Li X, Wang S, Zhang Q. 2004. Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein. Plant J. 37: 517-527.
  • Tu J, Zhang G, Datta K, Xu C, He Y, Zhang Q, Khush GS, Datta SK. 2000. Field performance of transgenic elite commercial hybrid rice expressing bacillus thuringiensis delta-endotoxin. Natl Biotechnol. 18: 1101-1104.
  • van Loon LC, Rep M, Pieterse CM. 2006. Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol. 44: 135-162.
  • Xin XF, Nomura K, Underwood W, He SY. 2013. Induction and suppression of PEN3 focal accumulation during Pseudomonas syringae pv. tomato DC3000 infection of Arabidopsis. Mol Plant-Microbe Interact. 26: 861-867.
  • Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang ZX, Kono I, Kurata N, Yano M, Iwata N, Sasaki T. 1998. Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci U S A. 95: 1663-1668.
  • Zhai W, Wang W, Zhou Y, Li X, Zheng X, Zhang Q, Wang G, Zhu L. 2002. Breeding bacterial blight-resistant hybrid rice with the cloned bacterial blight resistance gene Xa21. Mol Breed. 8: 285-293.
  • Zhang S, Song W-Y, Chen L, Ruan D, Taylor N, Ronald P, Beachy R, Fauquet C. 1998. Transgenic elite Indica rice varieties, resistant to Xanthomonas oryzae pv. oryzae. Mol Breed. 4: 551-558.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae
Plant Breed. Biotech.. 2013;1(4):354-365.   Published online December 31, 2013
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae
Plant Breed. Biotech.. 2013;1(4):354-365.   Published online December 31, 2013
Close

Figure

  • 0
  • 1
  • 2
  • 3
Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae
Image Image Image Image
Fig. 1 Phenotypic analysis of the rice bbr1 mutant. (a) Water-soaked disease lesions on three leaves from wild type ‘Dongan’ (WT) and bbr1 mutants (M6). 40-day-old plants were inoculated with Xoo. Image was taken two weeks after Xoo inoculation. (b) Leaf lesion lengths of eight bbr1 M6 progeny. Lesion lengths were measured at two weeks post Xoo inoculation. Experiments were repeated two times with similar results. Each data point represents the average and standard deviation of at least three leaves.
Fig. 2 Gene ontology classification of differentially expressed genes in rice leaves at 10 day post inoculation. Functional categories are derived from the primary annotation of biological process retrieved from the Kyoto Encyclopedia of Genes and Genomes (KEGG; www.genome.jp/kegg). Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses. White bars indicated the number of four-fold down regulated genes and black bars indicated the number of four-fold up-regulated genes compared to the WT.
Fig. 3 Altered expressions of genes related to Xoo inoculation in bbr1. The rice ACTIN gene was used as an internal positive control and transcript levels of the tested genes were normalized with that of ACTIN. Relative expressions of the tested genes were compared with that in WT plants. Bar represents standard deviation (three replicates) (a) qRT-PCR analysis was performed to study the transcript levels of peroxidase genes in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include POD-1, Os03g0235000; POD-2, Os07g0677100; POD-3, Os07g0677200; POD-4, Os08g0113000. (b) qRT-PCR analysis of the transcripts level of defense-related genes in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include R-1, Os01g0944900; R-2, Os02g0194700; R-3, Os03g0129100. (c) qRT-PCR analysis of the transcripts level of transcription factor genes in the in the leaves of WT and bbr1 plants at the 40-day-old stage. The tested genes include TF-1, Os02g0527300; TF-2, Os06g0127100; TF-3, Os08g0474000; TF-7, Os01g0975300; TF-8, Os01g0141000.
Fig. 4 Venn diagram of more than two folds up- and down-regulated genes with different AP2 domain binding motif in bbr1 mutant. A total 117 genes were differentially expressed before and after Xoo infection, among which 90 putative target genes contain DRE-related core motifs (80 genes), GCC-box (36 genes) and AP2+B3 binding motif (51 genes) in their putative promoter regions.
Microarray Analysis of bacterial blight resistance 1 mutant rice infected with Xanthomonas oryzae pv. oryzae

Thirty-six GCC-box containing differentially expressed genes in bbr1 mutant compared to wild type.

Gene Description Gene Title AGI Number Number of GCC-box in putative promoter regiona Average fold changeb

GCCGCC GGCGGC Total No NT Xoo
Transcription factor activity
 MYB family transcription factor Os01g0863300 AT2G38090 3 3 6 7.5 8.72
 MYB family transcription factor Os02g0104500 AT1G76890 5 10 15 −5.62 −2.1
Response to stress
 HSF-type DNA-binding domain containing protein Os06g0553100 AT3G24520 0 4 4 2.69 24.93
 VQ domain containing protein Os01g0278000 AT2G41010 1 1 2 4.84 7.29
 oxidoreductase/transition metal ion binding protein Os09g0445600 AT5G19875 1 5 6 3.57 6.87
 Similar to F-BOX STRESS INDUCED 2 Os07g0561300 AT4G21510 5 3 8 3.64 6.57
 Calmodulin-related calcium sensor protein Os01g0955100 AT1G76640 1 1 2 7.24 6.32
 phosphate carrier protein Os09g0454600 AT3G48850 4 2 6 3.86 6.19
 diacylglycerol kinase 1 Os12g0224000 AT5G63770 1 1 2 2.31 2.75
 PR (pathogenesis-related) peptide Os12g0437800 AT2G38870 12 5 17 −3.81 1.06
Protein modification process
 protein phosphatase 2C Os03g0268600 AT2G29380 1 2 3 7.29 9.99
 STE_MEKK_ste11_MAP3K.6 - STE kinases Os01g0699500 AT5G55090 2 0 2 9.48 9
 receptor protein kinase CRINKLY4 precursor Os08g0374600 AT3G55950 2 0 2 4.94 8.88
 protein kinase Os02g0165100 AT1G16670 2 0 2 6.63 8.63
 STE_MEKK_ste11_MAP3K.4 - STE kinases Os01g0699100 AT5G55090 2 2 4 3.1 7.44
 protein phosphatase 2C Os01g0583100 AT1G17550 1 1 2 2.93 3.77
Nucleotide binding
 WD domain containing protein Os01g0383700 AT4G03020 2 0 2 4.42 5.19
Development
 late embryogenesis abundant protein D-34 Os06g0341300 AT3G22490 4 3 7 5.39 15.56
 senescence-associated gene 29 Os02g0513100 AT3G48740 2 0 2 4.47 10.93
 Auxin regulated protein? Os01g0851100 AT2G37980 1 1 2 3.86 6.41
Metabolic procss
 fringe-related protein Os03g0269900 AT2G37730 3 2 5 3.86 6.94
 gibberellin receptor GID1L2 Os03g0790500 AT5G06570 1 1 2 4.76 6.82
 Anthranilate synthase alpha 2 subunit Os03g0264400 AT2G29690 2 0 2 3.4 3.23
 starch synthase Os06g0133000 AT1G32900 1 1 2 13.45 1.23
Unknown function
 transposon protein Os01g0186900 0 3 3 17.03 15.89
 expressed protein Os01g0305200 AT1G69510 1 9 10 4.3 9.88
 RPGR, putative Os03g0296200 1 1 2 6.77 8.97
 expressed protein Os02g0527200 AT2G27830 2 4 6 5.1 8.57
 expressed protein Os02g0601000 4 0 4 4.99 6.54
 expressed protein Os06g0133300 4 2 6 4.3 4.13
 expressed protein Os01g0138500 AT2G01260 0 1 1 2.88 4.13
 DUF966 domain containing protein Os01g0975000 AT5G59790 2 3 5 3.48 4.04
 cyclase/dehydrase family protein Os01g0772400 AT4G17650 1 3 4 3.36 3.38
 expressed protein Os12g0209700 AT4G10930 2 3 5 −2.31 −2.19
 expressed protein Os11g0307600 2 0 2 −7.41 −2.37
 Similar to pnn protein Os12g0516700 1 23 24 −3.88 −3.67

aOccurrence of GCC-box (GCCGCC or GGCGGC) in 2 kb upstream region of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Seventy-nine DRE binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Description Gene Title AGI Number Number of DRE-box in putative promoter regiona Average fold changeb

CCGAC GTCGG Total No. NT Xoo
Transcription factor activity
 Tify domain containing protein Os10g0391400 No 5 3 8 2.98 85.24
 transcription factor bHLH92-like Os03g0741100 No 1 1 2 2.4 35.02
 Heat shock transcription factor 31 Os02g0527300 AT2G26150 0 1 1 3.05 26.01
 WRKY DNA -binding domain Os01g0821300 No 2 6 8 2.14 25.72
 Similar to MCB2 protein (Myb-type) Os01g0863300 AT5G04760 4 0 4 3.39 19.37
 Chitin-inducible gibberellin-responsive protein Os07g0545800 AT5G48150 1 3 4 2.08 12.32
 RING/FYVE/PHD-type domain containing protein Os02g0682300 No 1 0 1 2.65 8.86
 Tify domain containing protein Os09g0439200 No 2 1 3 3.07 8.84
 MYC/bHLH transcription factor-like Os06g0164400 AT5G67110 2 1 3 2.51 6.05
 NAM protein domain containing protein Os12g0123800 AT5G18270 0 1 1 2.85 4.36
Response to stress
 Avr9Cf-9 rapidly elicited protein 74 Os06g0248500 No 4 1 5 3.24 95.27
 hypothetical protein Os01g0186900 AT5G12010 1 1 2 2.97 92.16
 Avr9Cf-9 rapidly elicited protein 74 Os03g0240600 No 1 0 1 2.65 57.38
 EF-hand Ca2+-binding protein CCD1 Os06g0683400 AT4G27280 8 1 9 2.33 23.83
 GLYCINE-RICH PROTEIN 8 Os01g0278000 AT4G39260 2 0 2 2.56 13.9
 RPM1-INDUCED PROTEIN KINASE Os09g0442100 AT2G05940 2 0 2 2.58 13.33
 phosphate transport protein Os09g0454600 AT5G14040 1 2 3 2.46 9.71
 expressed protein Os01g0582600 AT5G12010 2 1 3 2.18 9.36
 putative beta-1,3 glucanase Os09g0542900 AT1G76070 1 1 2 2.23 9.32
 Similar to Protein phosphatase 2C Os01g0583100 AT5G57050 1 1 2 2.93 5.22
 heat shock protein Oshsp18.0 Os03g0267000 AT3G46230 0 5 5 2.54 4.68
 Dehydrin Rab25 Os01g0702500 No 2 1 3 4.59 3.68
 subtilisin-chymotrypsin inhibitor-2A-like Os12g0437800 No 3 6 9 −3.81 1.06
Protein modification precess
 protein kinase domain containing protein Os01g0699600 No 0 1 1 3.65 70.53
 protein kinase domain containing protein. Os01g0699500 No 2 0 2 3.25 26.42
 HIGHLY ABA-INDUCED PP2C GENE 3 Os03g0268600 AT2G29380 3 1 4 3.24 22.68
 Protein kinase Os02g0165100 No 2 1 3 2.76 20.92
 Similar to Receptor kinase-like Os08g0374600 No 1 1 2 3.02 14.39
 MAPKKK18 Os01g0699400 AT1G05100 2 0 2 2.93 11.11
 Oryza sativa MAP kinase BIMK1 Os03g0285800 No 3 2 5 2.61 10.7
 protein kinase domain containing protein Os01g0699100 No 4 3 7 3.61 6.43
 diacylglycerol kinase Os12g0224000 No 2 1 3 2.04 3.19
 Similar to Chaperone protein dnaJ 1 Os03g0822800 AT5G59610 1 1 2 2.6 −1.12
Biosynthetic process
 Similar to Viviparous-14 Os07g0154100 No 0 1 1 2.48 16.14
 Mog1/PsbP Os01g0934400 AT3G05410 1 2 3 4.89 8.9
 GRANULE BOUND STARCH SYNTHASE 1 Os06g0133000 AT1G32900 2 2 4 13.45 1.23
 Similar to Cytochrome P450 Os07g0635500 AT2G46960 6 1 7 2.82 6.25
Development
 zinc finger protein ZFP15 mRNA Os03g0820400 No 4 2 6 3.91 34.75
 Seed maturation protein domain containing protein Os06g0341300 AT3G22490 1 2 3 4.37 19.29
 CALMODULIN LIKE 39 Os01g0955100 AT1G76640 1 1 2.53 18.25
 Late embryogenesis abundant protein Os01g0705200 No 1 0 1 3.21 6.62
Gene regulation
 arginine/serine-rich 12 Os12g0516700 1 17 18 −3.84 −3.63
Metabolic process
 hypothetical protein Os01g0952900 No 1 3 4 3.73 248.65
 Nuclease, Phoaphatase Os01g0716800 AT1G71710 1 2 3 2.87 15.91
 α/β hydrolase fold-3 domain containing protein Os03g0790500 AT5G06570 2 0 2 2.83 11.52
 putative beta-1,3 glucanase Os03g0792800 AT1G64760 1 2 3 2.91 6.35
 putative 4-coumarate-CoA ligase Os01g0901600 AT5G63380 1 1 2 2.25 5.04
 Similar to H-ATPase Os03g0689300 AT5G62670 0 1 1 3.53 4.88
Transport
 peptidylprolyl isomerase ROC7 Os06g0708300 AT4G39220 1 1 2 2.65 10.09
 Similar to MtN3 protein precursor Os02g0513100 AT5G50800 1 1 2 5.73 8.59
 putative axi 1 protein Os01g0851100 AT2G37980 2 0 2 3.62 6.9
 Anthranilate synthase component I family protein Os03g0264400 AT5G05730 2 2 4 2.24 4.94
 dehydrase family protein Os01g0772400 AT4G17650 2 1 3 4.09 2.8
 Similar to GTP-binding nuclear protein Ran1B Os06g0600301 AT5G55190 1 0 1 2.15 2.12
Nucleotide binding
 WD-40 repeat family protein Os01g0383700 AT4G03020 4 2 6 3.56 6.49
Unknown function
 ZIM domain containing protein Os03g0181100 No 3 5 8 2.73 56.55
 hypothetical protein Os06g0133500 No 1 0 1 3.01 45.58
 hypothetical protein Os02g0733900 No 1 1 2 3.47 44.9
 DWNN domain domain containing protein Os03g0659400 No 1 2 3 2.91 19.86
 hypothetical protein Os02g0527200 No 4 4 8 2.55 17.3
 hypothetical protein Os02g0601000 No 3 5 8 2.47 13.29
 hypothetical protein Os01g0305200 No 4 5 9 3.23 13.21
 hypothetical protein Os01g0121600 No 0 2 2 2.51 10.85
 hypothetical protein Os03g0296200 No 4 0 4 6.64 9.28
 hypothetical protein Os07g0115500 No 1 1 2 2.58 9.08
 hypothetical protein Os06g0133300 No 0 1 1 2.34 7.59
 DUF604 family protein Os03g0269900 AT2G37730 1 0 1 3.6 7.49
 DUF966 family protein Os01g0975000 No 2 2 4 2.24 6.31
 Cyclin-like F-box domain containing protein Os07g0561300 No 5 2 7 3.9 6.17
 hypothetical protein Os09g0445600 AT2G31940 0 2 2 4.22 5.75
 DUF789 family protein Os01g0138500 AT2G01260 4 4 8 2.28 5.22
 TonB box domain containing protein Os09g0532000 No 1 0 1 2.35 4.15
 Conserved hypothetical protein Os01g0121500 No 1 0 1 2.88 3.07
 hypothetical protein Os07g0516400 No 1 2 3 4.83 3
 metallothionein-like type 2 (OsMT-2) mRNA Os01g0149200 No 1 3 4 2.77 2.78
 hypothetical protein Os12g0209700 No 4 2 6 −2.36 −2.14
 Hydroxyproline-rich glycoprotein DZ-HRGP Os11g0307600 No 3 0 3 −4.59 −2.89
 similar to GT-2 factor Os02g0104500 No 2 0 2 −5.62 −2.1
 hypothetical protein Os01g0303800 No 3 3 6 −2.08 −14.42

aOccurrence of DRE binding domain (CCGAC or GTCGG ) in 2 kb region up stream of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. -3 = 3-fold decrease)

Fifty-one RAV1 binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Gene Description Gene Title AGI Number Number of RAV-binding site in putative promoter regiona Average fold changeb

CAACA+ CACCTG TGTTG+ CAGGTG Total NO NT Xoo
Transcription factor activity
 WRKY108, expressed Os01g0821300 AT4G11070 1 1 2 5.86 9.35
 HSF-type DNA-binding domain containing protein Os06g0553100 AT3G24520 1 0 1 2.69 4.03
Response to stress
 U-box protein CMPG1 Os06g0248500 AT5G37490 0 1 1 14.72 20.82
 cytochrome P450 Os12g0150200 AT2G27690 1 1 2 14.57 18.57
 Similar to ATL31 and ATL6 Os02g0759400 AT5G27420 3 0 3 9.25 12.55
 HSF-type DNA-binding domain containing protein Os02g0527300 AT5G03720 1 1 2 6.84 11.51
 Similar to RAP 2.4 Os03g0191900 AT1G78080 1 2 3 6.15 9.38
 late embryogenesis abundant protein, group 3 Os01g0705200 AT3G15670 1 0 1 2.87 7.34
 oxidoreductase/transition metal ion binding protein Os09g0445600 AT5G19875 1 0 1 3.57 6.87
 phosphate carrier protein Os09g0454600 AT3G48850 1 0 1 3.86 6.19
 Similar to RPM1-induced kinase Os09g0442100 AT2G05940 1 0 1 5.76 5.96
 Similar to PEN3 Os01g0609300 AT1G59870 1 0 1 5.68 5.62
 expressed protein Os01g0582600 AT5G12010 1 0 1 4.24 4.81
 Similar to 4CL Os08g0448000 AT3G21240 0 1 1 4.55 4
 glutamate decarboxylase Os03g0236200 AT5G17330 2 1 3 4.27 3.46
 Similar to PR-6 proteinase inhibitor family Os12g0437800 AT2G38870 1 0 1 −3.81 1.06
 heat shock protein DnaJ Os03g0822800 AT5G59610 1 0 1 2.6 −1.12
Protein modification process
 STE_MEKK_ste11_MAP3K.7 - STE kinases Os01g0699600 AT2G32510 1 2 3 18.13 14.07
 STE_MEKK_ste11_MAP3K.6 - STE kinases Os01g0699500 AT5G55090 0 3 3 9.48 9
 receptor protein kinase CRINKLY4 precursor Os08g0374600 AT3G55950 0 1 1 4.94 8.75
 protein kinase Os02g0165100 AT1G16670 1 0 1 6.66 8.63
 protein phosphatase 2C Os09g0325700 AT2G29380 1 0 1 4.76 7.59
 STE_MEKK_ste11_MAP3K.4 - STE kinases Os01g0699100 AT5G55090 1 0 1 3.1 7.44
 STE_MEKK_ste11_MAP3K.5 - STE kinases Os01g0699400 AT5G55090 1 0 1 4.63 6.99
 protein phosphatase 2C Os01g0583100 AT1G17550 2 1 3 4.03 3.77
Nucleotide binding
 CCHC-type zinc finger Os03g0659400 AT5G47430 0 1 1 6.23 9.25
 WD domain Os01g0383700 AT4G03020 1 0 1 4.42 5.19
Development
 EF hand family protein Os06g0683400 AT2G46600 1 0 1 7.94 6.94
 growth regulator related protein Os01g0851100 AT2G37980 1 0 1 3.86 6.41
 glucan endo-1,3-beta-glucosidase precursor Os03g0792800 AT2G19440 1 0 1 3.13 5.9
 senescence-inducible chloroplast stay-green protein 1 Os09g0532000 AT4G11910 0 1 1 2.72 3.57
Metabolic procss
 lumenal PsbP Os01g0934400 AT3G05410 0 2 2 5.08 12.04
 expressed protein Os06g0203600 AT2G26310 1 0 1 9.19 11.35
 AMP-binding domain containing protein Os01g0901600 AT5G63380 1 0 1 2.69 4.2
Transport
 white-brown complex homolog protein 7 Os01g0121600 AT2G01320 1 2 3 4.87 5.54
 Rer1 protein Os06g0708300 AT4G39220 1 0 1 4.58 5.8
 ras-related protein Os06g0600301 AT5G55190 0 1 1 2.17 2.06
Unknown function
 expressed protein Os01g0952900 AT5G12340 1 0 1 27.86 33.01
 transposon protein Os01g0186900 2 0 2 17.09 15.89
 expressed protein Os06g0133500 1 0 1 10.78 12.64
 expressed protein Os01g0305200 AT1G69510 1 0 1 4.3 9.88
 RPGR, putative, Os03g0296200 1 0 1 6.82 9
 expressed protein Os02g0527200 AT2G27830 1 0 1 5.1 8.57
 expressed protein Os02g0601000 1 1 2 4.99 6.5
 expressed protein Os07g0516400 1 0 1 2.27 6.34
 expressed protein Os01g0138500 AT2G01260 1 0 1 2.88 4.07
 expressed protein Os09g0542900 AT1G76070 1 0 1 5.26 3.93
 transposon protein Os01g0872900 1 0 1 5.68 3.64
 cyclase/dehydrase family protein Os01g0772400 AT4G17650 0 1 1 3.36 3.38
 expressed protein Os12g0209700 AT4G10930 0 1 1 −2.31 −2.13

aOccurrence of RAV1 binding domain (CAACA--CACCTG or TGTTG--CAGGTG) in 2 kb region upstream of differentially expressed genes in bbr1 mutant compared to wild type.

bAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Summary table displaying Arabidopsis orthologous of differentially expressed genes with known roles in disease resistance (R- ), transcript regulation (TF- ) and oxidative stress (POD- ) and sequences of forward and reverse primers used in quantitative RT-PCR to validate the 17 selected gene expression changes determined by microarray analysis. TF, Transcription factor; R, Resistance; POD, Peroxidase.

Primer name Gene title Arabidopsis orthologous Forward-primer Reverset-primer
TF-1 Os02g0527300 AT2G26150 gtggcactagtcagcaagca tactctcccaagctgcgttt
TF-2 Os06g0127100 AT4G25480 ctacgcgtactacggcaaca gaggagcaaagctggttgag
TF-3 Os08g0474000 AT4G34410 gagacaggggaccagctct ttcaattagtacaccagagccaat
TF-4 Os04g0583900 AT5G37260 ctccacaaaacagggagtgg tgttttctttagctcgcctgt
TF-5 Os03g0327800 AT3G04070 ctaggtcgtccgatcatgc ccggctttatgatcttgaca
TF-6 Os07g0558100 AT4G21440 gcaacaaccacaacgtcaac agtgttcgattcggctctgt
TF-7 Os01g0975300 AT5G59780 cagccagaggatgagtcgt gcgaataatccgagcagaag
TF-8 Os01g0141000 AT1G13260 atcagcgtactcctgcccta tgcaatctctgacctgacaaa
R-1 Os01g0944900 AT4G16260 gcttactacccggacgtcaa atgacggatgggttggtg
R-2 Os02g0194700 AT3G45140 gctgcatttgggacaagatt atccgtccgcatgacatact
R-3 Os03g0129100 AT2G39200 aaagggtgaggtcggaagat ggccatcaccgttgtacact
R-4 Os06g0698300 AT4G31750 ctgcaaagaagctcctccag tctgcttggcacaagacaac
R-5 Os10g0490800 AT2G15130 gtggactacgcgaagcaggt gtcacctccgtcctcacg
POD-1 Os03g0235000 AT5G06720 ggcaactccatggtcaagat gcgctccacaacacattaaa
POD-2 Os07g0677100 AT5G05340 atcaggcttagctgctccaa tcggtacataacatgggcttc
POD-3 Os07g0677200 AT5G05340 agctgctccaaggtgaactc atggctgctctgctccatac
POD-4 Os08g0113000 AT4G33420 ctgaattgcccgccttag cctccatgccacaatacaaa
ACTIN Os03g50890 AT3G18780 ggaactggataggtcaaggc agtctcatggatacccgcag

Highlight of differentially expressed genes with known or putative roles in stress response and transcript regulation. Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses.

Description Gene Title Average fold changea
Transcription factor activity
 TF-1; Similar to Heat shock transcription factor 31 Os02g0527300 11.52
 TF-2; AP2, Similar to CBF-like protein Os06g0127100 43.92
 TF-3; AP2, Similar to AP2 domain containing protein RAP2.6 Os08g0474000 51.32
 TF-4; MYB, Similar to LHY protein Os04g0583900 6.12
 TF-5; NAM, No apical meristem (NAM) domain containing protein Os03g0327800 5.37
 TF-6; MYB, Similar to Myb-related transcription factor LBM1 Os07g0558100 6.04
 TF-7; MYB, Similar to Typical P-type R2R3 Myb protein Os01g0975300 −7.52
 TF-8; AP2, RAV-like protein Os01g0141000 −4.17
Response to biotic stress
 R-1; Similar to Beta-1,3-glucanase-like protein Os01g0944900 19.29
 R-2; Similar to Lipoxygenase 2.3, chloroplast precursor Os02g0194700 10.9
 R-3; Seven transmembrane protein MLO2 Os03g0129100 8.27
 R-4; Protein phosphatase 2C family protein Os06g0698300 7
 R-5; Similar to NtPRp27 Os10g0490800 14.22
 Similar to Iron-phytosiderophore transporter protein yellow stripe 1 Os02g0649900 −6.28
 Similar to Pathogen-related protein Os01g0731100 −8.17
Response to oxidative stress
 POD-1; Peroxidase Os03g0235000 −42.2
 POD-2; Peroxidase Os07g0677100 −7.73
 POD-3; Peroxidase Os07g0677200 −4.79
 POD-4; Similar to Peroxidase 47 precursor Os08g0113000 −14.6
Response to abiotic stress
 Late embryogenesis abundant (LEA) group 1 family Os04g0589800 25.25
 Similar to Low-temperature induced protein lt101.2 Os05g0122700 16.92
 Similar to Allyl alcohol dehydrogenase Os04g0497000 11.48
 Similar to 1-Cys peroxiredoxin; Os07g0638300 9.16
 Similar to Small heat stress protein class CIII Os02g0782500 8.33
 GRAM domain containing protein; Os12g0478100 7.53
 Similar to Acyl-CoA-binding protein 2 (ACBP 2) Os06g0115300 6.89
 Hly-III related proteins family protein Os06g0652200 6.54
 Similar to Dehydrin DHN1 (B8) Os01g0702500 6.42
 Heat shock protein DnaJ, N-terminal domain containing protein Os01g0606900 6.34
 EFA27 for EF hand, abscisic acid, 27kD Os04g0511200 4.86
 Glycoside hydrolase, family 17 protein Os01g0860800 4.44
 Similar to germin-like protein 8 Os08g0189850 −6.45
 Similar to germin-like protein 12 Os08g0189900 −6.92

aAverage values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation; positive values represent up-regulation (e. g. 3 = 3-fold increase) negative values down-regulation (e. g. −3 = 3-fold decrease).

Table S1 Thirty-six GCC-box containing differentially expressed genes in bbr1 mutant compared to wild type.

Occurrence of GCC-box (GCCGCC or GGCGGC) in 2 kb upstream region of differentially expressed genes in bbr1 mutant compared to wild type.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Table S2 Seventy-nine DRE binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Occurrence of DRE binding domain (CCGAC or GTCGG ) in 2 kb region up stream of differentially expressed genes in bbr1 mutant compared to wild type.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. -3 = 3-fold decrease)

Table S3 Fifty-one RAV1 binding domain containing differentially expressed genes in bbr1 mutant compared to wild type.

Occurrence of RAV1 binding domain (CAACA--CACCTG or TGTTG--CAGGTG) in 2 kb region upstream of differentially expressed genes in bbr1 mutant compared to wild type.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation or no treatment (NT); positive values represent up-regulation (e. g. 3 = 3-fold increase), negative values down-regulation (e. g. −3 = 3-fold decrease).

Table 1 Summary table displaying Arabidopsis orthologous of differentially expressed genes with known roles in disease resistance (R- ), transcript regulation (TF- ) and oxidative stress (POD- ) and sequences of forward and reverse primers used in quantitative RT-PCR to validate the 17 selected gene expression changes determined by microarray analysis. TF, Transcription factor; R, Resistance; POD, Peroxidase.
Table 2 Highlight of differentially expressed genes with known or putative roles in stress response and transcript regulation. Differentially-regulated genes were expressed at 4-fold higher or lower levels in the bbr1 mutant compared to wild type from two independent microarray analyses.

Average values of Xoo inoculated bbr1 samples, compared to WT samples, from two independent microarray analysis. Numbers show the factor of change between wild type and mutant after Xoo inoculation; positive values represent up-regulation (e. g. 3 = 3-fold increase) negative values down-regulation (e. g. −3 = 3-fold decrease).