Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Comparative Analysis of Gene Expression Related to Salt Tolerance with Sorghum (Sorghum bicolor L. Moench) Mutants

Plant Breeding and Biotechnology 2022;10(2):128-138.
Published online: June 1, 2022

1Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 56212, Korea

2Department of Applied Plant Science, Chonnam National University, Gwangju 61186, Korea

3Department of Horticulture, College of Industrial Sciences, Kongju National University, Yesan 32439, Korea

4Department of Crop Science, College of Agricultural and Life Sciences, Chungnam National University, Daejeon 34134, Korea

*Corresponding author Soon-Jae Kwon, soonjaekwon@kaeri.re.kr, Tel: +82-63-570-3312, Fax: +82-63-570-3813, *Corresponding author Bo-Keun Ha, bkha@jnu.ac.kr, Tel: +82-62-530-2055, Fax: +82-62-530-2059, †These authors contributed equally.
• Received: May 9, 2022   • Revised: May 17, 2022   • Accepted: May 19, 2022

Copyright © 2022 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 19 Views
  • 0 Download
  • 2 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Alteration of gene expression profiles in the mutant line of Sorghum bicolor
    Sehyun Choi, Ji-Su Seo, Joon-Woo Ahn, Soon-Jae Kwon, Donghyun Jeon, Changsoo Kim
    Journal of Crop Science and Biotechnology.2023; 26(5): 537.     CrossRef
  • Deciphering the Genetic Mechanisms of Salt Tolerance in Sorghum bicolor L.: Key Genes and SNP Associations from Comparative Transcriptomic Analyses
    Donghyun Jeon, Jin-Baek Kim, Beum-Chang Kang, Changsoo Kim
    Plants.2023; 12(14): 2639.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Comparative Analysis of Gene Expression Related to Salt Tolerance with Sorghum (Sorghum bicolor L. Moench) Mutants
Plant Breed. Biotech.. 2022;10(2):128-138.   Published online June 1, 2022
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Comparative Analysis of Gene Expression Related to Salt Tolerance with Sorghum (Sorghum bicolor L. Moench) Mutants
Plant Breed. Biotech.. 2022;10(2):128-138.   Published online June 1, 2022
Close

Figure

  • 0
  • 1
Comparative Analysis of Gene Expression Related to Salt Tolerance with Sorghum (Sorghum bicolor L. Moench) Mutants
Image Image
Fig. 1 Growth of original accession (C3) and mutant lines (B5, SY6, SY7) at 2 week after salt treatment. Scale bar = 5 cm.
Fig. 2 Relative transcript levels of 15 genes in the most salt-tolerant mutant (B5) and its original accession (C3). C_N: C3 no salt, C_T: C3 salt treatment, M_N: B5 no salt, M_T: B5 salt treatment.
Comparative Analysis of Gene Expression Related to Salt Tolerance with Sorghum (Sorghum bicolor L. Moench) Mutants

Agronomic characteristics of original materials (seven accessions and one cultivar) and 28 mutants.

Symbol Accession no./sources Plant height (cm) Panicle length (cm) Stalks diameter (mm) Sugar content (brix) Fresh weight (kg)
C1 IT100992 271.67e 21.33d 17.25ab 9.53ab 3.77a
B1 Irradiated 100 Gy 373.33d 38bc 21.1ab 7.47bc 2.97a
B2 Irradiated 100 Gy 443bc 44.33abc 23.32a 7.63bc 3.0a
SY1 Irradiated 100 Gy 404cd 42.67abc 23.97a 11.73a 2.8a
SY2 Irradiated 100 Gy 519.67a 46ab 17.97ab 7.57bc 2.83a
SY3 Irradiated 100 Gy 419.33c 44.33abc 17.11ab 6c 2.47a
SY4 Irradiated 100 Gy 369d 34.67c 14.92b 8.1bc 1.03a
SY5 Irradiated 100 Gy 465.67b 52.67a 19.1ab 6.3bc 2.87a
C2 IT124065 281d 15.33c 15.59c 13.8a 3.1a
B3 Irradiated 100 Gy 443.33a 53a 20.9b 10.43a 2.8ab
B4 Irradiated 200 Gy 340b 19c 32.97a 12.6a 1.5c
E1 Irradiated 200 Gy 311c 28b 18.19bc 12.47a 2.73b
C3 IT124115 290c 35a 21.89bc 17.3a 2.9bc
B5 Irradiated 400 Gy 422.67a 32.33a 23.98b 8.87c 3.43a
B6 Irradiated 400 Gy 332b 30.67a 22.07bc 9.13c 2.7c
SY6 Irradiated 300 Gy 261c 31a 32.31a 12.8b 1.5d
SY7 Irradiated 400 Gy 454.33a 36a 19.35c 7.23d 3b
C4 IT028269 369.33b 32.33b 18.92b 9.03b 3.2a
SY8 Irradiated 200 Gy 437a 40.33ab 26.19a 13.43a 2.97a
SY9 Irradiated 200 Gy 413.33ab 45.33a 24.87a 10.8b 2.9a
C7 IS8777 357c 25b 17.03a 15.73a 2.37c
B7 Irradiated 200 Gy 442.67b 46a 19.1a 14.77a 2.73b
B8 Irradiated 200 Gy 553.67a 44.33a 21.7a 7.9b 3.13a
B9 Irradiated 200 Gy 387.33bc 25.33b 17.99a 14.57a 2.67bc
C10 IS20740 347.67bc 31.33a 16.69a 10.73b 2.53a
E4 Irradiated 300 Gy 367.67b 35.67a 17.83a 12.63ab 2.53a
B10 Irradiated 100 Gy 328c 31a 19.82a 16.5a 1b
B11 Irradiated 200 Gy 424.33a 36.33a 19.34a 9.93b 2.6a
C12 IS27887 364b 33.67b 25.84a 11.2a 3.4a
B12 Irradiated 200 Gy 375.33b 31b 17.09b 11.93a 2.5c
B13 Irradiated 400 Gy 424a 49a 20.85b 13.6a 2.83b
C13 Dansusu2ho 294.33b 25b 20.39a 14.67ab 2.5b
E2 Irradiated 100 Gy 338.33ab 38a 18.77a 16.73a 2.53ab
E3 Irradiated 300 Gy 333ab 26b 21.67a 15.7ab 2.7ab
SY10 Irradiated 100 Gy 345.67ab 33.33ab 17.68a 16.43a 2.43b
SY11 Irradiated 200 Gy 402.67a 32.67ab 22.3a 13.37b 2.83a

Sequences of gene primers used in this study, and information about the roles of encoded proteins in the salt tolerance of sorghum.

Gene type Genes Forward (5’-3’) Reverse (5’-3’) Name/reported genes
Heat shock protein Sb07g028370 TCTGCACTGATCACCGTCTC GAACGTACCCTTACCGACGA 25.3 kDa heat shock protein, chloroplastic (Precursor) (Johnson et al. 2014)
Sb01g040030 GACGGCAACATCCTTCAGAT GCTTCTTGACGTCCTCCTTG 17.9 kDa class I heat shock protein (Johnson et al. 2014)
Sb04g006890 ATGGCTTTAGCTCGCCTGT AAATCTGTCTCCGGGGCTAC 23.6 kDa heat shock protein, mitochondrial (Zhang et al. 2019)
Sb04g035130 ACCGTGTGCTGGTGATGAA CTGCACGGACTTGGTCTTCT 18.6 kDa class III heat shock protein (Zhang et al. 2019)
Sb01g021170 AGTGGTGCCACTTCACCAA GGCACCTGGATGTAGAGCAT 16.6 kDa heat shock protein (Schnable et al. 2011)
Aquaporin Sb04g032900 CAACAACCTCCGCTACAACA AAGGTGATGATGATCTCGAAC Aquaporin TIP2-1 (Zhang et al. 2019)
Sb04g037800 CAACAACCTCCGCTACAACA AAGGTGATGATGATCTCGAAC Aquaporin PIP1-5 (Liu et al. 2014)
Sb0012s010440 TTCCTCTACGTGACGGTGCT CAGTAGACGAGCGCGAAGAT Aquaporin PIP2-2 (Guo et al. 2016)
Sb07g003270 ATCCCCATGCAGTGAAAGAG TTGCCACCATGTAGATCCAA Aquaporin NIP3-2 (Almodares and Hadi 2009)
Sb05g007520 CGTCCATGAACCCAGCTAAT CCCTAAAAATCCATCCAGCA Aquaporin SIP1-1 (Almodares and Hadi 2009)
ROS scavenging system Sb02g000490 CTTCCACGATTTCACCGTCT TGACGACGTTGCACTTTCTC Peroxidase 1 (Precursor) (Mizuno et al. 2018)
Sb10g030840 ACCCAAAGACCAATTTGCAG CCCTCCATGTGCCTGTAGTT Catalase isozyme 1 (Li et al. 2020)
Sb03g045840 CATTCTGGAGGACCTCTTCG CGGCTTGGTAAGCTTGTTCT Probable glutathione S-transferase (Bandara et al. 2019)
Sb04g030050 TCTTCCGTAACAAGCCCATC CGGTGGATGATGTAGACGTG Thioredoxin reductase NTRB (Forghani et al. 2018)
Sb03g010900 GCATTCTGGCAAACCTGATT TTCCCGAGACTTCTGAGCAT TPR repeat-containing thioredoxin TTL1 (Ndimba 2017)
Transcription factor Sb01g044410 CGGCTACGACGATAGATTGG CTGCAGCTGGAGAATCTGTG Ethylene-responsive transcription factor RAP2-4 (Yan et al. 2013)
Sb03g030750 CTAGCGACGACTGATCACCA GCCTGGTTGTAGCCGATTAG NAC domain-containing protein 8 (Handakumbura 2014)
Sb03g005480 CTTGAGCAGCACCAGCATAG AAGCTCGATCGGTTCATCAT Transcription factor ASG4 (Saha et al. 2019)
Sb10g007090 GAGGTGGCAAAACTCAAGGA CTTTGCCTTTGGTCCATGTT bZIP transcription factor TRAB1 (Yang et al. 2017)
Sb08g018580 TGGAGGACACACATGAGGAA CCCTTGAGGATGCTTGTGAT MYB59 [Zea mays] (Muthamilarasan et al. 2014)

Germination rate and shoot/root length of mutants and their original materials under control (0 mM NaCl) and salt treatment (150 mM NaCl) conditions.

Symbol PI number Germination (%) Shoot length (cm) Root length (cm)
0 mM 150 mM 0 mM 150 mM P value 0 mM 150 mM P value
C1 IT100992 100% 90% 17.80 1.20 ** 48.80 8.00 *
B2 Irradiated 100 Gy 100% 100% 14.20 1.20 * 46.40 2.00 **
SY3 Irradiated 100 Gy 100% 100% 5.00 0.60 34.60 2.00 *
C2 IT124065 100% 95% 5.40 1.80 24.80 2.20
B3 Irradiated 100 Gy 100% 100% 15.60 1.40 * 35.80 5.20 *
C3 IT124115 100% 90% 12.60 6.30 30.80 4.70
B5 Irradiated 400 Gy 100% 100% 21.80 14.20 58.80 11.90
SY6 Irradiated 300 Gy 100% 85% 14.40 10.30 18.20 7.20
SY7 Irradiated 400 Gy 100% 95% 5.60 8.30 13.80 9.20
C4 IT028269 100% 90% 6.20 6.00 1.80 1.20
SY8 Irradiated 200 Gy 100% 55% 13.60 1.60 * 26.40 6.80
SY9 Irradiated 200 Gy 100% 60% 19.20 1.00 * 41.80 15.20
C7 IS8777 100% 65% 3.00 1.20 3.80 2.20
B8 Irradiated 200 Gy 100% 75% 29.20 3.20 ** 68.40 3.00 **
B9 Irradiated 200 Gy 100% 95% 14.00 3.60 51.80 16.00 *
Table 1 Agronomic characteristics of original materials (seven accessions and one cultivar) and 28 mutants.

C: control, B: biomass, E: early maturing, SY: seed yield.

aSignificant difference at the 5% level as determined by Duncan’s test.

Table 2 Sequences of gene primers used in this study, and information about the roles of encoded proteins in the salt tolerance of sorghum.
Table 3 Germination rate and shoot/root length of mutants and their original materials under control (0 mM NaCl) and salt treatment (150 mM NaCl) conditions.

* and ** indicate significant difference at P < 0.05 and P < 0.01, respectively.