Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Evaluation of the Rsistant to Bakanae Disease in Korean Rice Landraces (Oryza sativa L.)

Plant Breeding and Biotechnology 2021;9(4):355-359.
Published online: December 1, 2021

1Department of Plant Bioscience, College of Natural Resources and Life Science, Pusan National University, Miryang 50463, Korea

2Life and Industry Convergence Research Institute, Pusan National University Miryang 50463, Korea

3Department of Cropscience, Konkuk University, Seoul 05029, Korea

*Corresponding author Joohyun Lee, edmund@konkuk.ac.kr, Tel: +82-2-450-3769, Fax: +82-2-455-1044
• Received: October 12, 2021   • Revised: October 29, 2021   • Accepted: November 1, 2021

Copyright © 2021 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 6 Views
  • 0 Download
  • 3 Crossref
prev

Citations

Citations to this article as recorded by  Crossref logo
  • Genome-Wide Association Study to identify Bakanae disease resistance-related QTLs carrying novel candidate genes in rice (Oryza sativa L.)
    Yuting Zeng, Fang-Yuan Cao, Ah-Rim Lee, Dongryung Lee, Backki Kim, Soon-Wook Kwon
    npj Science of Plants.2025;[Epub]     CrossRef
  • Current insights on rice (Oryza sativa L.) bakanae disease and exploration of its management strategies
    Chinnannan Karthik, Qingyao Shu
    Journal of Zhejiang University-SCIENCE B.2023; 24(9): 755.     CrossRef
  • Evaluation of Major Rice Varieties for Bakanae Disease Resistance in Korea
    Sais-Beul Lee, Ju-Won Kang, Ji-Yoon Lee, Gi-Un Seong, Youngho Kwon, So-Myeong Lee, Nkulu Rolly Kabang, Jun-Hyeon Cho, Seong-Hwan Oh, Dongjin Shin, Jong-Hee Lee, Ki-Won Oh, Dong-Soo Park
    Korean Journal of Breeding Science.2023; 55(2): 103.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Evaluation of the Rsistant to Bakanae Disease in Korean Rice Landraces (Oryza sativa L.)
Plant Breed. Biotech.. 2021;9(4):355-359.   Published online December 1, 2021
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Evaluation of the Rsistant to Bakanae Disease in Korean Rice Landraces (Oryza sativa L.)
Plant Breed. Biotech.. 2021;9(4):355-359.   Published online December 1, 2021
Close

Figure

  • 0
  • 1
Evaluation of the Rsistant to Bakanae Disease in Korean Rice Landraces (Oryza sativa L.)
Image Image
Fig. 1 Evaluation of resistance to bakanae disease. (a) 1: resistance-9: sensitive. (b) Categoryzing resistant, moderately-resistant, susceptible.
Fig. 2 Results from genotype screen of 24 resistant accessions with (a) 1625IND and (b) 1675IND. M: 100bp ladder, IP; ILPUM, SG; SHINGWANG, 1: Taegujo, 2: Guwangdo, 3: Weonsanchalbyeo, 4: Jjokjebichal, 5: Hongdo, 6: Joslbichal, 7: Daejichal, 8: Guhwangdo, 9: Hyoseongjaeraejong, 10: Gangweondo, 11: Daesona, 12: Chanarak, 13: Akkudichal, 14: Baekcheon, 15: Ssalbyeo, 16: Sukna, 17: Cheonjeungdo, 18: Annamjo, 19: Gakssina, 20: Kangnungdo, 21: Jinhwa, 22: Jeokseongna, 23: Sukna, 24: Yongcheon.
Evaluation of the Rsistant to Bakanae Disease in Korean Rice Landraces (Oryza sativa L.)

Sequences of screening resistant genotype to bakanae disease.

Marker Sequence Reference
1625IND F AAACAAGTTGGTTGGCGAGCTAC Cheon et al. (2019)
R AGATTACGCCTTGGAACCTGTTA
1675IND F TTTCTACTAAGTCACGTAGCATGCTCC
R ATGTTCGTCGTATGCATAGCCAAAC

Some agricultural traits of 24 rice landraces with strong resistant to bakanae disease.

No. Name IT no. Headingdate Culm length Grain length Grain width Endosperm type Bakanae resistance(%)
1 Taegujo k026144 08월 15일 109 6.4 3.3 Normal 91.3
2 Guwangdo IT005044 08월 29일 124 6.2 3.4 Normal 94.8
3 Weonsanchalbyeo IT151696 08월 16일 78 6.6 3.4 Waxy 94
4 Jjokjebichal IT010631 09월 07일 101 7.7 3.5 Waxy 90
5 Hongdo IT009118 08월 13일 100 7 3.4 Normal 92.6
6 Joslbichal IT155896 08월 27일 90 6.5 3.2 Normal 85.7
7 Daejichal IT155895 09월 08일 90 6.6 3.5 Normal 91.1
8 Guhwangdo IT005068 08월 16일 92 7.4 3.3 Normal 87.9
9 Hyoseongjaeraejong IT009221 08월 13일 85 7.6 3.1 Normal 87
10 Gangweondo IT004770 08월 11일 78 6.1 3.4 Waxy 94.6
11 Daesona k026156 08월 15일 91 6.5 4 Waxy 87
12 Chanarak IT008732 08월 26일 100 6.5 3.6 Waxy 86.5
13 Akkudichal k026159 08월 29일 106 7.1 3.3 Waxy 100
14 Baekcheon IT006385 08월 02일 90 7 3.6 Normal 92.6
15 Ssalbyeo IT006578 08월 23일 109 6.1 3.2 Normal 93.3
16 Sukna IT007274 08월 25일 112 6.3 3.2 Normal 91.4
17 Cheonjeungdo IT008804 08월 27일 125 6.7 3.6 Normal 91.4
18 Annamjo IT007464 08월 24일 100 6.8 3.2 Waxy 94.2
19 Gakssina k026169 08월 04일 83 6.6 3.3 Waxy 93.8
20 Kangnungdo k026171 09월 02일 102 6.8 3.3 Waxy 96.7
21 Jinhwa IT008725 08월 29일 106 6.1 3.4 Waxy 88.3
22 Jeokseongna k026175 08월 26일 110 6.5 3.2 Waxy 91.1
23 Sukna IT007270 08월 29일 109 6.1 3.3 Waxy 92.6
24 Yongcheon IT007747 08월 15일 120 7.2 3.4 Waxy 88.5
Table 1 Sequences of screening resistant genotype to bakanae disease.
Table 2 Some agricultural traits of 24 rice landraces with strong resistant to bakanae disease.