Abstract
Plants are often exposed to biotic and abiotic stresses that affect plant growth, development, and productivity. Drought is an important abiotic stress that has a particularly serious impact on plant growth and development. We transformed rice with PsGPD using Agrobacterium-mediated transformation. We generated independent PsGPD-homozygous transgenic rice plants selected as single copy/intergenic lines by the TaqMan copy number assay and by T-DNA flanking sequences. These transgenic rice plants showed improvement of drought tolerance compared to wild-type plants under drought condition. RNA sequencing analysis showed that 2,992 genes were transcriptionally affected by the PsGPD transgene or drought treatment. In total, 145 genes were modulated by the PsGPD transgene before and after drought treatment. Among these candidate genes, 4 were up- and downregulated in all four comparisons. Several genes, including Os04t0576900, Os03t0629800, and Os04t0518400 (OsPAL7), were involved in tetrapyrrole synthesis. Os09t0522200 (DREB1A), an important component in hormone signal transduction, is a transcription factor (TF) gene that plays vital roles in stress responses. We partially characterized the functions of PsGPD in the drought stress response and the role of major TFs in the drought tolerance mechanism. These genes will be useful targets for both future research and the breeding of drought tolerance in rice.
-
Key words: PsGPD, Drought, Intergenic transformation, TaqMan copy number assay, RNA sequencing
INTRODUCTION
Plants are exposed to various forms of environmental stresses both biological and abiotic. Abiotic stress is a major contributor to crop loss, reducing the average yield by more than 50% (
Boyer 1982;
Pandey and Shukla 2015). Climate change is considered to be a major cause of abiotic stress in crops. Climate change due to global warming is expected to seriously damage agricultural productivity and the erosion of agricultural land.
Most of the water consumed worldwide is used as agricultural water (
Jarraud 2012), and drought stress has sharply reduced agricultural production (
Boyer 1982). The efficiency of agricultural water use for crops is an important issue. Drought is a major abiotic stress that has severe effects on crop growth and yield (
Manavalan et al. 2009;
Santner et al. 2009;
Zhang et al. 2010). In particular, young seedlings are highly vulnerable to drought stress because of their high water demand. Transformation of rice with genes that regulate drought-resistant cellular processes is an effective way to address future environmental disasters.
Genetically modified (GM) research is one of key solutions for the challenge of global food security, which will be caused by population growth and climate change. To develop a variety of useful GM crops that add value to new features, a technology platform for developing commercially available biotech crops has been built (
Park et al. 2018). To understand the molecular mechanisms of abiotic stress and plant adaptation, it is essential to identify drought tolerance genes in young seedling. The development of plant genes that are resistant to drought stress has focused on transcription factors (TFs) in
Arabidopsis thaliana. Recent studies have shown that
E. coli genes involved in the metabolism of trehalose, a nonreducing disaccharide, are involved in drought tolerance mechanisms and can be used for crop development; thus, the effect of the trehalose biosynthesis genes from
E. coli on the growth of rice is being investigated.
In order for a plant to be stress-resistant, gene expression of the enzyme is required (
Vaidyanathan et al. 1999;
Siddiqui et al. 2018). Many organisms have developed multiple mechanisms that promote survival in extreme environments. Glyceraldehyde-3-phosphate dehydrogenase (GPD) is an essential enzyme in glycolysis synthesis and gluconeogenesis. The GPD gene isolated from the oyster mushroom
Pleurotus sajor-caju encodes an enzyme involved in carbon metabolism. This enzyme can also be useful for the development of crops that tolerate various forms of environmental stress, such as drought, salinity, and low temperature. When the
PsGPD gene was introduced into yeast, the survival rate was higher than that of the control under various forms of environmental stress. Potato plants with the
PsGPD gene can reportedly grow under salt stress conditions (
Jeong et al. 2001).
To date, the function of
PsGPD in the rice response to drought stress remains unknown. In a previous research, we reported on studies that are useful for T-DNA tagged rice population and the database of rice genome sequences flanking T-DNA inserts (
Lim et al. 2016). In this study, we found that
PsGPD positively regulates drought stress tolerance. After drought treatment, overexpression of
PsGPD improved the survival rate compared to that of the wild type (WT). Furthermore, transcriptomic changes caused by drought were monitored.
MATERIALS AND METHODS
Plant materials and growth conditions
We used
Oryza sativa L. japonica cv. Dongjin (provided by the Rural Development Administration) as the WT rice in these experiments. Rice transformation using
Agrobacterium-mediated cocultivation, selection, and plant generation was conducted as described by
Toki et al. (2006). After surface sterilization with 2% (w/v) sodium hypochlorite, seeds were washed several times with distilled water before seeding. The sterilized seeds of WT and transgenic rice plants were grown in a greenhouse with a light/dark cycle of 16 hours/8 hours at 30℃ during the day and 20℃ during the night.
Vector construction and rice transformation
We isolated full-length cDNA clones of the oyster mushroom
P. sajor-caju (
Jeong et al. 2001) using gene-specific primers. The following primer were designed to construct the overexpression vectors for 35S::
PsGPD: GPD-XbaI-F1 (5ʹ-TCTAGAATGGTCAACGTCGGCATCAACGGG-3ʹ) and GPD-SmaI-R1 (5ʹ-CCCGGGCTACTGCGCACCGTCCTTCTCCG-3ʹ).
We inserted the amplified cDNA between XbaI/SmaI and then subcloned it into pNCGC15-BAR (derived from the binary vector pPZP200) (
Fuse et al. 2001). We inserted the
PsGPD gene between the CaMV35S promoter and PinII terminator in the pPZP vector, which includes the bar gene as a plant-selectable marker. The construct was introduced into
Agrobacterium tumefaciens LBA4404 and transformed into rice (
O. sativa L. japonica cv. Dongjin) using
Agrobacterium-mediated cocultivation (
Toki et al. 2006).
TaqMan copy number assay
We isolated genomic DNA from the leaf samples of WT and PsGPD-transgenic rice plants using the Genomic DNA Prep Kit for Plants (Inclone, Korea). For the endogenous control, primers and probes were obtained from a predesigned TaqMan copy number assay for the rice tubulin alpha-1 chain gene (AK102560). For the transgene, primers and probes were specific to the terminator of the NOS gene and were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA). The primers used for the terminator of NOS were NOS-F 5ʹ-GCATGACGTTATTTATGAGATGGGTTT-3ʹ and NOS-R 5ʹ-TGCGCGCTATATTTTGTTTTCTATCG-3ʹ, and the NOS-probe was 5ʹ-TAGAGTCCCGCAATTAT-3ʹ. The amplification conditions consisted of one cycle of 2 minutes at 50℃ and 10 minutes at 95℃, followed by 40 cycles of 15 seconds at 95℃ and 1 minute at 60℃. In the reaction plate, we measured each sample in triplicates. We used CopyCaller software version 2.0 (Applied Biosystems, Foster City, CA, USA) to determine the copy number of the inserted T-DNA in PsGPD-transgenic rice plants.
Identification of DNA sequences flanking the T-DNA using adapter ligation-mediated PCR
The DNA sequences flanking the T-DNA were isolated using polymerase chain reaction (PCR) amplification by adaptor ligation. Genomic DNA (100 ng) cleaved with 2 units of restriction enzyme was ligated with the adapter using 5 U of T4 DNA ligase (Takara, Tokyo, Japan) at 37℃ for 2 hours.
The first PCR was conducted with 5 mL of digestion/ligation mixture, 10 mL of 2× PCR premix (SolGent, Korea), 0.5 pmol of Ada1 (TAATACGACTCACTATAGC), and either the LB1 (TTCAAGCACGGGAACTGGCATGAC) or RB1 (AAGCTTAGCTTGAGCTTGGATCAGATTGTC) primer, The cycling conditions were as follows: a first step at 95℃ for 5 minutes, followed by 20 cycles of 94℃ for 30 seconds and 68℃ for 2 minutes and a final step at 72℃ for 5 minutes. Next, the second PCR was performed using 5 mL of the first PCR product, 0.5 pmol of Ada2 (GACTCACT ATAGCAATTAAC), and either the LB2 (GTTTCTGGCAGCTGGACTTC) or RB2 (TTGTCGTTTCCCGCCTTCAG) primer. The cycling conditions were as follows: a first step at 95℃ for 5 minutes; 39 cycles of 30 seconds at 95℃, 30 seconds at 60℃, and 2 minutes at 72℃; and a final step at 72℃ for 5 minutes. The PCR products were loaded onto a 2% agarose gel, purified using DF buffer (RBC), and sequenced with the LB2 or RB2 primer.
Drought treatment of rice plants
WT and transgenic rice plants (single copy/intergenic/homozygous transgenic rice with 35S::PsGPD) were grown to four weeks old in a greenhouse (with a light/dark cycle 16 hours/8 hours and a temperature of 30℃ during the day and 20℃ during the night).
WT and transgenic rice plants (four weeks old, grown in pots) were subjected to drought stress by withholding water for 2-4 days and recovered by rewatering. After 13-27 days, we counted the number of plants that survived without withering. Drought tolerance was assessed in terms of the proportion of surviving plants after the recovery period. The experiment was repeated three times.
cDNA library construction and RNA sequencing
PsGPD-transgenic and WT plant under normal (WT–control, PsGPD–control) or drought stress (WT-drought and PsGPD-drought) were used for RNA sequencing analysis in replicates.
Total RNA was isolated from leaves using the Hybrid R RNA Extration Kit (GeneAll, Korea). We purified and fragmented mRNA using the TruSeq RNA Sample Kit Sample Prep Kit (Illumina, San Diego, CA, USA) based on the manufacturer’s instructions. First-strand cDNA was synthesized by reverse transcriptase with random primers. Second-strand cDNA was synthesized using DNA polymerase I and RNase H. We performed the following steps: an end-repair reaction, an A single-base addition, and adaptor ligation. The products were purified and enriched by PCR and immobilized on a proprietary flow cell surface. The libraries were sequenced using the Illumina NovaSeq6000 platform. Eight RNA sequencing (RNA-seq) libraries were sequenced with 2.7 to 3.0 Gb reads per library.
Data processing
Hisat2, SAMtools, and dexseq_count.py were used for the RNA-seq data analysis. Raw sequence reads were mapped to the rice genome sequence (IRGSP-1.0) in the RAP database (
http://rapdb.lab.nig.ac.jp). Reads in FASTQ files were aligned using hisat2 based on the Hisat2 and Bowtie2 implementations with data-cufflinks options (
Kim et al. 2013). In the program, SAMtools (version 1.2) was used for indexing and sorting of bam and sam files. To extract exons from the transcripts, we defined nonoverlapping exonic regions with dexseq_prepare_annotation.py and then extracted the per-exon read counts with the script dexseq_count.py using the annotated GTF file (
Anders et al. 2015) in the DEXseq package. The program returned one file for each biological replicate with the exon counts. We tested the differential exon usage with the DEXseq package in Bioconductor (
https://www.bioconductor.org/).
Real-time PCR
For first-strand cDNA synthesis, we used 1 mg of total RNA with oligo (dT) primer and RevertAid H Minus Reverse Transcriptase (Fermentas) in a 20-mL mixture, according to the manufacturer’s instructions. The rice cDNA mixture was then diluted 5 times. The PCR was conducted in a solution with a final volume of 20 mL, containing 2 mL of cDNA, 0.2 pmol/mL gene-specific primers, and 10 mL of 2× PCR mixture (GeneAll, Korea), with two technical replicates. The PCR conditions were as follows: 5 minutes at 95℃; 39 cycles of 95℃, 39 cycles of 95℃ for 30 seconds, 55℃ for 30 seconds, and 72℃ for 30 seconds; and 72℃ for 5 minutes. Real-time PCR was performed on a CFX-96 real-time PCR system (Bio-Rad, Hercules, USA), following the manufacturer’s instructions. The expression of target genes was normalized to that of the action gene (
Livak and Schmittgen 2001).
Gene ontology (GO) and pathway enrichment analyses
RESULTS
Screen of single copy/intergenic/homozygous transgenic rice plants
Expression of the
P. sajor-caju GPD gene is strongly induced by various forms of stress, such as saline, dry, low-temperature, and high-temperature conditions. Transgenic potato plants that overexpress the
PsGPD gene can increase their tolerance to salt stress (
Jeong et al. 2001). To investigate the function of
PsGPD in rice under drought stress, we generated transgenic rice plants containing
PsGPD driven by the CaMV35S promoter (
Fig. 1A). Single copy transgenic rice plants were screened using TaqMan copy number analysis (
Fig. 1B) (
Cho et al. 2014). Transgenic plants with T-DNA inserted into the intergenic region are less likely to be affected by surrounding genes; therefore, we examined whether the transformed gene was inserted into an intergenic location to avoid altering the expression of surrounding genes. We selected intergenic transgenic rice plants by T-DNA flanking sequence analysis (
Table 1). Furthermore, we used homozygous lines of intergenic and single copy insertion transgenic rice plants selected by the TaqMan copy number assay (
Fig. 1B). We obtained 19 independent lines of single copy/intergenic/homozygous transgenic rice plants that contained
PsGPD.
Overexpression of PsGPD improves drought tolerance at the young seedling stage
To characterize the function of PsGPD in response to drought stress, we generated WT and transgenic rice plants. The four-week-old WT and transgenic rice plants had water withheld for two to four days (d) and then were rehydrated.
As shown in
Fig. 2, after drought treatment, the WT plants showed serious withering and damage; after 13-27 days, their survival rate was at 18%. The
PsGPD-transgenic rice plants showed less wilting and better recovery than the WT plants.
After three weeks of drought treatment, PsGPD-transgenic rice plants appeared relatively healthy and vigorous. After rewatering, the survival rate of PsGPD-transgenic rice plants was ∼90%. These results suggest that overexpression of PsGPD increases the drought tolerance of rice.
Transcriptomic analysis of PsGPD-transgenic rice plants under drought conditions
To study how transformation with PsGPD confers drought tolerance to rice, we conducted RNA-seq analysis of genotype 71671. In total, eight samples with two biological replicates were used for RNA-seq analysis. Total RNA extracted from leaves of PsGPD-transgenic and WT plants under normal and drought stress conditions (WT–control, PsGPD–control, WT–drought, and PsGPD–drought) was used for RNA-seq in replicates.
Comparative analysis revealed that 2,992 genes were transcriptionally affected by
PsGPD transgene or drought treatment. In WT plants, 1,825 and 865 genes (total 2,690 genes) were up- and downregulated, respectively, under drought stress conditions. In comparison, in the transgenic rice plants, the expression of 1,115 genes (754 upregulated and 361 downregulated) was changed by drought treatment, compared to normal conditions. There were fewer changes in expression under drought stress in
PsGPD-transgenic rice than in WT plants. This result indicates that several genes were activated due to overexpression of
PsGPD, regardless of stress (
Fig. 3A). For both WT and
PsGPD-transgenic rice under drought stress, 992 genes overlapped (
Fig. 3B), and the remaining 123 genes could be regulated only in the transgenic rice plants after drought treatment.
The expression levels of 345 and 1,185 genes were changed in the
PsGPD-transgenic rice under normal and drought stress conditions, respectively, compared to the levels WT rice under the same conditions (
Fig. 3A). Among these genes, 145 genes overlapped, indicating that they were regulated by the
PsGPD gene, regardless of drought stress (
Fig. 3B).
Table 2 lists these coexpressed genes, which can be considered putative target genes of
PsGPD.
Enriched GO terms and pathways
To find significantly enriched gene ontology (GO) terms, we used both 123 and 145 genes regulated by the
PsGPD gene under drought-stressed and untreated conditions, respectively. The top five enriched GO terms in the biological process category were metabolic and cellular processes, biological regulation, response to stimulus, and localization (
Fig. 4). Among cellular components, cells, organelles, cell junctions, and protein-containing complexes were highly ranked. The enriched GO terms among molecular functions were classified into four categories: catalytic activities, binding, transcription regulators, and transporter activities (
Fig. 4). Moreover, we also found four pathways using genes affected by both the
PsGPD gene and drought treatment, including biosynthesis of secondary metabolites, metabolic pathways, plant–pathogen interactions, and KEGG signaling pathway (
Fig. 5).
Identification of candidate target genes of PsGPD
In total, 145 genes were transcriptionally modulated by the
PsGPD transgene before and after drought treatments (
Fig. 3A). Functional analysis revealed that the enriched pathways included the biosynthesis of secondary metabolites and metabolic pathways, while enriched GO terms included the response to stimulus and metabolic process.
Among these candidate genes, 4 were up- and downregulated in all four comparisons. Several genes, including Os04t0576900, Os03t0629800, and Os04t0518400 (OsPAL7), were involved in tetrapyrrole synthesis. Os09t0522200 (DREB1A), an important component in hormone signal transduction, is a TF gene that plays vital roles in the stress response.
To validate the RNA-seq, we performed qRT-PCR of the four selected drought-responsive genes. Comparison of the expression values of the RNA-seq and qRT-PCR results under the control and drought stress conditions indicated consistent correlation. The expression of the obviously upregulated genes (i.e.,
Os03t0629800,
Os04t0518400, and
Os09t0522200) was highly induced in
PsGPD-transgenic rice plants.
Os04t0576900 expression in
PsGPD-transgenic rice plants was also significantly lower than that in the WT rice plants (
Fig. 6). Finally, the expression pattern found through qRT-PCR of the four selected genes supported the results obtained through the RNA-seq analysis. We partially examined the functions of
PsGPD in the drought stress response and the role of major TFs in the drought tolerance mechanism. These genes will be useful targets for both future research and the breeding of drought tolerance in rice.
DISCUSSION
In this study, we generated independent single copy/intergenic/homozygous transgenic rice with 35S::PsGPD. We partially characterized the functions of PsGPD in the drought stress response and the role of major TFs in the drought tolerance mechanism. Transgenic plants with T-DNA inserted into the intergenic region are less likely to be affected by surrounding genes; therefore, we examined whether the transformed gene was inserted into an intergenic location to avoid altering the expression of surrounding genes. Comparison of the expression values of the RNA-seq and qRT-PCR results under the control and drought stress conditions indicated consistent correlation. The expression of the obviously upregulated genes (i.e., Os03t0629800, Os04t0518400, and Os09t0522200) was highly induced in PsGPD-transgenic rice plants. These genes will be useful targets for both future research and the breeding of drought tolerance in rice.
ACKNOWLEDGEMENTS
This study was supported by grants from the Rural Development Administration’s Agenda Program (Project No. PJ013562), the New Breeding Technologies Development Program (Project No. PJ01479302) and the Next-Generation Bio-Green 21 Program (Project No. PJ01367503), Rural Development Administration, Republic of Korea. Our authors are also truly grateful to all researchers who participated in this study.
Fig. 1The PsGPD-OX vector and molecular identification of transgenic rice. (A) Schematic of the overexpression construct. RB: right border, CaMV35S: cauliflower mosaic virus 35Spromter, TNOS: nopaline synthase gene terminator, Bar: selection marker, LB: left border. (B) Copy number assay by quantitative RT-PCR.
Fig. 2Drought treatment between wild-type and PsGPD-overexpressing rice at the young seedling stage. (A) Phenotype of transgenic rice under drought. (B) Survival rate of transgenic rice.
Fig. 3The PsGPD transgene and drought stress-modulated genes identified through RNA-seq analysis of genotype 71671. (A) Number of genes affected by the PsGPD transgene and drought stress. (B) Overlapping analysis of genes up- and downregulated by PsGPD or drought stress.
Fig. 4GO term enrichment analysis of genes affected by PsGPD transgene and drought stress treatment. Differentially expressed genes (fold change ≥ 4 and P-value ≤ 0.05) were annotated using the PANTHER classification system (v.14.0). GO was used as the classification source. N71671_n17DJ: PsGPD_Control Vs. WT_Control, S71671_S17DJ: PsGPD_Drought Vs. WT_Drought, S17DJ_n17DJ: WT_Drought Vs. WT_Control, S71671_n71671: PsGPD_Drought Vs. PsGPD_Control.
Fig. 5Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of genes affected by the PsGPD transgene and drought stress treatment.
Fig. 6qRT-PCR of genes affected by both the PsGPD transgene and drought stress for comparison of the RNA-seq data. n17DJ: WT_Control, S17DJ: WT_Drought, n71671: PsGPD_Control, S71671: PsGPD_Drought.
Table 1Analysis of the integration site of T-DNA based on flanking sequences.
Table 1
|
Line |
Chromosome |
Insertion site |
Insertion type |
Gene ID |
|
71663 |
Chr04 |
29845424-29847167 |
Intergenic |
Os04t0581266-00 upstream 2.3kb |
|
71664 |
Chr04 |
29346227-29348282 |
Intergenic |
Os04t0581100-01 upstream 6.561kb |
|
71671 |
Chr04 |
29577793-29578251 |
Intergenic |
Os04t0576850-00 upstream 4.282kb |
|
71847 |
Chr01 |
13476206-13476371 |
Intergenic |
Os01t0339400-00 upstream 8.546kb |
Table 2Genes affected by both the PsGPD transgene and drought stress.
Table 2
|
ID |
n17DJz)
|
n71671z)
|
S17DJz)
|
S71671z)
|
Description |
|
Os04t0576900
|
1 |
1430.8 |
1 |
111 |
Protein kinase, core domain-containing protein |
|
Os03t0629800
|
1 |
70.3 |
1 |
324.7 |
Conserved hypothetical protein |
|
Os04t0518400
|
136.65 |
1176.28 |
43.15 |
223.95 |
Similar to phenylalanine ammonia-lyase (fragment) |
|
Os09t0522200
|
21.8 |
169.45 |
38.3 |
1166.35 |
DRE-binding protein 1A |
References
- Anders S, Pyl PT, Huber W. 2015. HTSeq-a Python framework to work with high-throughput sequencing data. Bioinformatics. 31: 166-169.
- Boyer JS. 1982. Plant productivity and environment. Science. 218: 443-448.
- Cho JI, Lim HM, Siddiqui ZS, Park SH, Kim AR, Kwon TR, et al. 2014. Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants. Biotechnol. Lett.. 36: 1641-1648.
- Fuse T, Sasaki T, Yano M. 2001. Ti-plasmid vectors useful for functional analysis of rice genes. Plant Biotechnol.. 18: 219-222.
- Jarraud M. 2012. GLAAS 2012 Report. GLAAS Report. UN-Water Global Analysis and Assessment of Sanitation and Drinking-Water. UN Water Report.
- Jeong MJ, Park SC, Kwon HB, Byun MO. 2001. Improvement of salt tolerance in transgenic potato plants by glyceraldehyde-3-phosphate dehydrogenase gene transfer. Mol. Cells. 12: 185-189.
- Kanehisa M, Goto S. 2000. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res.. 28: 27-30.
- Kim J, Kim JA, McGinty RK, Nguyen UT, Muir TW, Allis CD, et al. 2013. The n-SET domain of Set1 regulates H2B ubiquitylation-dependent H3K4 methylation. Mol. Cell. 49: 1121-1133.
- Lim HM, Hwang HJ, Kim AR, Cho MH, Ji HS, Kim CK, et al. 2016. A simple, rapid and systematic method for the developed GM rice analysis. Plant Biotechnol. Rep.. 10: 25-33.
- Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2(-ΔΔCt) method. Methods. 25: 402-408.
- Manavalan LP, Guttikonda SK, Tran LS, Nguyen HT. 2009. Physiological and molecular approaches to improve drought resistance in soybean. Plant Cell Physiol.. 50: 1260-1276.
- Mi H, Muruganujan A, Huang X, Ebert D, Mills C, Guo X, et al. 2019. Protocol update for large-scale genome and gene function analysis with the PANTHER classification system (v. 14.0). Nat. Protoc.. 14: 703-721.
- Pandey V, Shukla A. 2015. Acclimation and tolerance strategies of rice under drought stress. Rice Sci.. 22: 147-161.
- Park SH, Cho JI, Kim YS, Kim SM, Lee GS, Park SC. 2018. National program for developing biotech crops in Korea. Plant Breed. Biotech.. 6: 171-176.
- Santner A, Calderon-Villalobos LI, Estelle M. 2009. Plant hormones are versatile chemical regulators of plant growth. Nat. Chem. Biol.. 5: 301-307.
- Siddiqui ZS, Lee KH, Kim YS, Lee GS, Cho JL, Park SC. 2019. Biochemical changes of CaMsrB2 expressing transgenic rice seed during germination in heavy metal stress environment. Plant Breed. Biotech.. 7: 287-294.
- Toki S, Hara N, Ono K, Onodera H, Tagiri A, Oka S, et al. 2006. Early infection of scutellum tissue with Agrobacterium allows high-speed transformation of rice. Plant J.. 47: 969-976.
- Vaidyanathan VV, Yoshino K, Jahnz M, Dorries C, Bade S, Nauenburg S, et al. 1999. Proteolysis of SNAP-25 isoforms by botulinum neurotoxin types A, C, and E: domains and amino acid residues controlling the formation of enzyme-substrate complexes and cleavage. J. Neurochem.. 72: 327-337.
- Zhang X, Li M, Xiang T. 2010. Genetic modification of MEOR bacterium Bacillus licheniformis H strain by low energy ion beam irradiation. Open Biotechnol. J.. 4: 14-17.