Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Breeding Hybrid Rice with Genes Resistant to Diseases and Insects Using Marker-Assisted Selection and Evaluation of Biological Assay

Plant Breeding and Biotechnology 2019;7(3):272-286.
Published online: September 1, 2019

1Department of Crop Science, Chungbuk National University, Cheongju 28644, Korea

2Department of Central Area Crop Science, National Institute of Crop Science, RDA, Suwon 16429, Korea

*Yong-Gu Cho, ygcho@cbnu.ac.kr, Tel: +82-43-261-2514, Fax: +82-43-273-1598
• Received: August 14, 2019   • Revised: August 21, 2019   • Accepted: August 21, 2019

Copyright © 2019 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 5 Views
  • 0 Download
  • 11 Crossref
prev next
  • Developing elite hybrid rice varieties is one important objective of rice breeding programs. Several genes related to male sterilities, restores, and pollinators have been identified through map-based gene cloning within natural variations of rice. These identified genes are good targets for introducing genetic traits in molecular breeding. This study was conducted to breed elite hybrid lines with major genes related to hybrid traits and disease/insect resistance in 240 genetic resources and F1 hybrid combinations of rice. Molecular markers were reset for three major hybrid genes (S5, Rf3, Rf4) and thirteen disease/insect resistant genes (rice bacterial blight resistance genes Xa3, Xa4, xa5, Xa7, xa13, Xa21; blast resistance genes Pita, Pib, Pi5, Pii; brown planthopper resistant genes Bph18(t) and tungro virus resistance gene tsv1). Genotypes were then analyzed using molecular marker-assisted selection (MAS). Biological assay was then performed at the Red River Delta region in Vietnam using eleven F1 hybrid combinations and two control vatieties. Results showed that nine F1 hybrid combinations were highly resistant to rice bacterial blight and blast. Finally, eight F1 hybrid rice varieties with resistance to disease/insect were selected from eleven F1 hybrid combinations. Their characteristics such as agricultural traits and yields were then investigated. These F1 hybrid rice varieties developed with major genes related to hybrid traits and disease/insect resistant genes could be useful for hybrid breeding programs to achieve high yield with biotic and abiotic resistance.
Rice (Oryza sativa L.) is one of the most important crops in the world. It has been estimated that more than 414 million metric tons (MT) of milled rice are consumed in developing countries in 2018 (Ikeda-Kawakatsu et al. 2012). According to USDA’s Economic Research Service (USDA-ERS), rice consumption in Africa is expected to reach 3,500 tons by 2028. Thus, it is essential to enhance rice productivity (Thome et al. 2018). Most heterosis researches of F1 hybrid rice have been focused on yield increase or related genes. Hybrid rice area is expanding in major rice-producting countries in Asia. Most of hybrid rice varieties have high yield and resistance to disease and insect such as bacterial blight, blast, and brown planthopper (Viet 2008; Dyah et al. 2013). Since 1970s, China has been conducting hybrid rice research, commercialization, and cultivation in 18 million hectares, comprising more than fifty percent of total national rice area. Meanwhile, hybrid rice varieties have yield increases of more than 30% compared to their parental inbred lines in Vietnam (FAORAP 2014).
Hybrid rice can be produced using either a three-line or a two-line system. The former is derived from cytoplasmic male sterility (CMS) while the latter is derived from genic male sterility (GMS). Well-known GMS materials are photo-period-sensitive genic male sterile rice (PGMS) and temperature-sensitive genic male sterile rice (TGMS). The female parent of three-line hybrid rice is a GMS line and the male parent is a restorer line (Li et al. 2007; Lee et al. 2011; Jo and Kim 2016). To breed various CGMS and restorer lines with backgrounds of Korean japonica rice varieties, CGMS line BT-CMS was crossed with restorer line AR-3 (Seo and Song 1993). In CMS line, one or more nuclear genes known as restorer-of-fertility (Rf) genes can suppress the expression of aberrant mitochondrial CMS genes and restore viable pollen production (Chase 2007). The CMS/Rf system has been an indispensable resource for commercial hybrid seed production (Lin and Yuan 1980; Chen and Liu 2014; Bohra et al. 2016). Jing et al. (2001) have found that Rf4 locus in IR24 is flanked by RM171 (OSR33) and RM228 on the long arm of chromosome 10. Rf3 is mapped on chromosome 1 and linked to RM1 about 1.9 cM (Zhang et al. 1996; He et al. 2002; Balaji et al. 2012). Wide compatibility gene S5 is known as one of the loci that can enhance wide compatibility during crossing made between indica and japonica lines. When sequences of indica (S5i) and japonica (S5j) are compared, two SNPs are identified in the coding region located at 1,010 bp [C/A] and 1,604 bp [C/T] downstream of the start codon (Ouyang et al. 2009; Sundaram et al. 2010).
Crop yield losses are caused by diseases and insect pests of tropical and temperate rice cultivation area in Asia, including bacterial blight (50–80%), blast (50–85%), tungro virus (5–10%), and brown planthopper (60%) (Park et al. 2011; Shin et al. 2011; Fujita et al. 2013). About thirty major bacterial blight resistance genes have been identified in rice of many countries. Bacterial blight R-genes are distributed across 9 of 12 chromosomes in rice (none on chromosome 1, 9, or 10). More than eight bacterial blight R-genes are intensively clustered on chromosome 11 (Jin et al. 2007; Cheema et al. 2008; Xia et al. 2012; Zhang et al. 2015). Approximately 350 quantitative trait loci (QTLs) for resistance to rice blast have been identified and 23 of them have been molecularly characterized (Yang et al. 2009; Liu et al. 2010). Tungro virus resistance in Ultri Merah has been found to be under the control of a recessive gene (tsv1) (Lee et al. 2010). The gene was mapped on chromosome 7 where a gene encoding initiation factor (eIF4G) was strongly associated with tungro virus resistance (Lee et al. 2010). Rice brown planthopper resistance gene Bph18(t) was identified by SSR marker RM463 and STR marker S15552 in an indica introgression line (Myint et al. 2012). It expresses strong resistance to brown planthopper biotype of Korea (Myint et al. 2012).
Marker-assisted selection (MAS) has become an important approach to develop new varieties with genes related to disease/insect resistance. It also accelerates the application of marker-assisted backcross (MAB) (Lau et al. 2015; Suh et al. 2015; Franz et al. 2016; Hu et al. 2016).
The objective of this study was to identify F1 hybrid rice with hybrid traits and genes related to disease/insect resistance using MAS and phenotypic selection for improving grain yield of F1 hybrid rice and developing excellent variety of hybrid rice for export.
Plan meterials
We used a rice panel comprised of 240 genetic resources and F1 hybrid combinations (Table 1) provided by National Institute of Crop Science, Rural Development Administration (RDA), Republic of Korea. F1 hybrid combinations were selected using MAS. They were applied for screening disease/insect resistance in the rice field of the Red River Delta region in Vietnam.
DNA extraction
Total genomic DNA was extracted from fresh leaves of two-week-old rice seedlings using TissueLyser II system (QIAGEN, UK) with modified Cetyl Trimethyl Ammonium Bromide (CTAB) method as described previously by Cho et. al. (2007). DNA concentration was quantified using a spectrophotometer (NanoDropTM One, Thermo Fisher Scientific, USA). DNA solution was then diluted to a working concentration with distilled water and stored at −20°C until use.
Genotyping
Polymerase chain reaction (PCR) was performed using gene-specific primers reported in previous studies (Song et al. 2016) and developed precisely in this study (Table 2).
Control varieties were used to compare the size and presence/absence of amplicon between resistant and susceptible lines (Table 3). Approximately 40 ng of genomic DNA was used in a 20 μL PCR reaction containing 2 μL of primer pairs (10 pmol/μL), 2.0 μL of 10 × PCR buffer, 1.6 μL of dNTP (2.5 mM), and 0.2 μL of Taq DNA polymerase (5 unit/μL; Promega, USA). The reaction mixture was subjected to the following PCR conditions: initial denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55–60°C for 30 seconds, and extension at 72°C for 45–60 seconds, and a final extension step at 72°C for 10 minutes. PCR amplified products of genes related to hybrid traits (S5, Rf4), bacterial blight (Xa3, Xa7, xa13, and Xa21), blast (Pib, Pita, Pi5, and Pii), and tungro virus (tsv1) resistant genes were separated on 1.5–2.0% agarose gel and stained with ethidium bromide. PCR amplified products of Rf3, Xa4, and xa5 were run on a fragment capillary gel electrophoresis system (Fragment analyzer, USA). Fragments were sized and scored using PROSize 2.0 software (Fragment analyzer, USA). Amplification of Bph18(t) was performed on an EcoTM Real-Time PCR System (Illumina, San Diego, CA, USA) according to the user guide manual. Allele callings of amplified fragments of hybrid lines and control varieties were based on their respective resistance and susceptible controls.
Evaluation of disease and insect resistance responses
Resistance to disease and insect was assessed during summer season (2018) in an experimental field at Haihau District, Namdinh Province, Vietnam. To evaluate bacterial blight, rice blast, and brown planthopper resistance, we selected F1 hybrid lines (Table 4) and control varieties with hybrid related genes. A randomized complete block design with three replicates was used. Eleven F1 hybrid lines and control varieties were sown on February 15, 2018 and transplanted a week later. Plot size was 1 m × 1 m. Row to row and plant to plant spacing were 20 cm × 20 cm. Three varieties, namely TN1, B40, and Tetep, were used as control varieties to compare resistant and susceptible lines. Disease/insect pest outbreaks and damages in the filed were screened three times (April 3, April 24, and May 4) to determine degree of resistance and susceptibility. Levels of resistance were bioassayed with a standard seed-box screening test (rice brown planthopper), sequential planting and nursery screening test (rice blast), and inoculation screening under a net house (bacterial blight) according to IRRI protocol for accurate determination.
Investigation of agronomic traits and yields
Investigation of agronomic traits and yields was performed during rainy season at the same place as bioassay. A randomized complete block design with three replicates was used and eight F1 hybrid combinations and two control varieties were transplanted on June 29, 2018. Plot size was 4.8 m2. Row to row and plant to plant spacing were 20 cm × 20 cm. IIA838 and BC15 were used as control varieties to compare agronomic traits and yield performance. Measurement of plant height, tiller number, heading date, and ripening conditions was conducted during cultivation period. Yields were investigated from October 8 to October 18.
Development of F1 hybrid combinations with genes related to hybrid traits and disease/insect resistance using MAS
A total of 240 genetic resources and F1 hybrid combinations were genotyped using PCR-based markers related to hybrid traits and disease/insect resistance genes based on fragment size differences and presence/absence (Figs. 1, 2).
We examined the genotype of S5 gene with Indel markers targeting sequences flanking the 136-bp deletion and SNP markers converting SNPs between indica and japonica alleles into PCR-based allele specific markers. S5-Indel amplified a 281-bp fragment with 136-bp deletion of intron in 18 hybrid breeding lines (Entry No. 111–128 in Table 1) with wide-compatibility. The restorer of fertility gene Rf3 was detected in 176 and 216 hybrid lines using microsatellite marker RF3-5 and RF3-10, respectively. The major gene Rf4 was amplified in 96 and 125 hybrid lines using RF4-14 and M19280, respectively (Supplementary Table S1).
We determined the presence of bacterial blight resistance genes (Xa3, Xa4, xa5, Xa7, xa13, Xa21), blast resistance genes (Pita, Pib, Pi5, Pii), a brown planthopper resistance gene (Bph18(t)), and a tungro virus resistance gene (tsv1) in genetic resources and F1 hybrid combinations (Supplementary Table S2). Among 240 genetic resources and F1 hybrid combinations, bacterial blight genes Xa3, Xa4, xa5, Xa7, xa13, Xa21 were found in 20, 32, 36, 10, 3, and 4 F1 hybrid combinations, respectively, while most lines (226 genetic resources) were detected to carry Pib. We further surveyed the distribution of resistant genes to brown planthopper using High Resolution Melt (HRM) markers in hybrid rice breeding lines. Bph18(t) was present in 24.1% of total genetic resources and F1 hybrid combinations (Fig. 3A). Distribution of different gene combination varied greatly among lines. Number of lines with three genes was found to be the highest (27.4%), followed by two-gene-containing lines (25%) and four-gene-containg lines (20.4%). Seven resistance genes combination, Xa4 + Xa5 + Pi-ta + Pib + Pi5 + Bph18(t) + tsv1, was identified in indica variety ‘Rumpe’ (Fig. 3B, Supplementary Table S3).
Selection of F1 hybrid combinations for disease/insect resistance in bioassay
In this study, we selected eleven F1 combinations having S5+Rf3+Rf4 related to hybrid traits among 240 genetic resources and F1 hybrid combinations. Field screening was performed to identify lines resistant to bacterial blight, blast, and brown planthopper. Eight F1 hybrid combinations excluding KR0695H, KR0696H, and KR1444H showed resistance to bacterial blight. Meanwhile, in ten F1 hybrid combinations excluding KR1487H, blast resistance genes were integrated with more than three other resistance genes. F1 hybrid combinations containing brown planthopper and tungro virus resistance genes had fewer than two combinations. A F1 hybrid combination, KR2116H, had the most resistance genes among eleven F1 combinations (Table 5).
To evaluate resistance to bacterial blight, blast, and brown planthopper, we performed field screen with the selected eleven F1 combinations and control varieties in the Red Rever Delta region, Vietnam. F1 hybrid combination KR1994H without a resistance gene of rice brown planthopper showed resistance to rice brown planthopper at 6 days after treatment compared to BTP 33 (resistant variety) but showed medium sensitivity to rice brown planthopper at 8 days after treatment. Most of F1 hybrid combinations (except KR1994H) with two or most blast resistance genes were found to have very strong resistance to blast fungus. F1 hybrid combination KR0203H showed the same level of resistance to bacterial blight as OM 1490 (susceptible variety). Eleven F1 combinations were found to have strong resistance to bacterial blight (Table 6).
Evaluation of agronomic traits and yields of selected F1 hybrid combinations
We developed eight F1 hybrid combinations selected from eleven F1 combinations that accumulated genes related to hybrid traits and disease/insect resistance genes by genetic analysis and bioassay (Table 7). Their agronimic traits were compared with control varieties. Heading date was the earilest in a control variety, IIA838 (May 12), while it was the latest in F1 hybrid combinations KR1454H (May 19) and KR1354H (May 19). Heading days of KR0695H, KR0696H, KR1497H, and KR2116H were the same (May 15). Regarding plant height, KR0695H (122.6 cm) and KR0696H (122.9 cm) were the highest while KR1497H (111.6 cm) was the shortest. Panicle length of KR1354H (31.1 cm) was the longest, followed by that of KR0203H (29.4 cm) and KR2116H (29.0 cm). Panicle lengths of control varieties and F1 hybrid combinations were slimilar (within 27–28 cm). Percent ripened grain was the hightest in KR1498H (88.5%) but the lowest in KR0695H (65.2%). Thousand grain weights of KR0203H (27.0 g) and KR0696H (27.0 g) were heavier than other F1 combinations. KR0695H (11.8 Ton/ha) showed the hightest yield of rough rice among the eight F1 combinations selected. KR1455H (9.6 Ton/ha) had lower yield while the rest had yield of 10–11 Ton/ha (Table 7). F1 hybrid combinations KR0695H (11.8 Ton/ha) and KR0696 (11.1 Ton/ha) showed the highest yield as seen in Fig. 4.
Plant breeding based on MAS has become an important approach to ensure the development of crop varieties with durable resistance to diseases and insects and to accelerate the application of MAB (Lau et al. 2015; Hu et al. 2016). In this study, we conducted screening of hybrid traits and genes related to disease/insect resistance using molecular MAS. We also performed field screening of responses to diseases and insects for developing F1 hybrid rice varieties with high yield.
Three hybrid genes (S5, Rf3, Rf4) and thirteen disease/insect resistance genes (bacterial blight resistance genes, Xa3, Xa4, xa5, Xa7, xa13, Xa21; blast disease resistance genes, Pi-ta, Pib, Pi5, Pii; a leafhopper resistance gene, Bph; tungro virus resistance gene, tsv1) were analyzed for 240 genetic resources and F1 hybrid combinations using molecular marker analysis. Most of these genetic resources showed correlation with S5, Rf3, and Rf4 genes. The total number of combinations with diease/insect resistance genes was 72. All possible combinations were made by a maximum of seven resistance genes. The seven resistance gene combination, Xa4 + Xa5 + Pi-ta + Pib + Pi5 + Bph18(t) + tsv1, was identified in indica variety. Eleven F1 combinations that accumulated useful genes related to hybrid traits were selected and used for field screening at the Red River Delta, Vietnam. As a result, they exhibited high resistance to bacterial blight and blast diseases. Nine F1 combinations that accumuated F1 hybrid genes, S5, Rf3, and Rf4, and biotic stress resistance genes for bacterial blight, blast, and brown planthopper resistance were also integrated. Agronomic traits were compared with control varieties and the productivity of F1 combinations was analyzed. KR1498H (88.5%) showed the highest in percent ripened grain, but KR0695H (65.2%) was the lowest. Thousand grain weights of KR0203H (27.0 g) and KR0696H (27.0 g) were heavier than those of other F1 combinations. Among the eight selected hybrid combinations, KR0695H (11.8 Ton/ha) and KR0696 (11.1 Ton/ha) showed the hightest rough rice yield (Fig. 4). These two hybrid rice combinations showed higher yield than those of Suweon Hybrid 1 (8.34 Ton/ha) and Suweon Hybrid 2 (7.34 Ton/ha) bred in Korea in 1990s and also much higher than those of ICGHR 2 (6.99 Ton/ha) and Hao uu 19 (6.75 Ton/ha) grown in Vietnam, implying that these two hybrid variety candidates would be competitive for future export.
Recently, damages by diseases and pests have increased due to climate change. As a result, rice production is falling into an unstable state. Accordingly, developing new varieties with high yield and durable resistance to disease and pest is indespensible. Philippines and China have developed varieties that integrate two, three, or more than four resistance genes using MAS. For example, Xa21 resistance gene has been integrated into IR72, showing a widespread resistance (Tu et al. 1998; Singh et al. 2011). In South Korea, breeders have also developed countermeasures against mutant strain K3a by breeding a resistance variety Jinbaek which integrates Xa3 and xa5 genes (Kim et al. 2009; Shin et al. 2011). These varieties have diversified single-resistance genes and integrated main genes for stabilizing yield and durability of rice varieties.
The current direction of plant breeding is to select resistance lines by using molecular markers. By using molecular markers for selection, it can reduce the effort of screening resistance genes. Stable resistance genotypes can be selected at early generation so that its resistance can remain longer (Peleman and Voort 2003). However, to confirm whether genes inserted or accumulated by MAS show resistance or not, it is nessary to screen selected plants by inoculation or in the field. To develop resistance varieties with useful genes and resistant genes into practically cultivated varieties, comprehensive considerations are needed through selection of phenotypes of various agronomic traits in the breeding process.
In this study, eight F1 combinations were superior F1 combinations that expressed useful genes with complex disease and pest resistance. This result could be useful for breeding F1 hybrid varieties with complex biotic resistance genes for future export.
This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Golden Seed Project funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) (213009-05-3-WT211).
Fig. 1
PCR products for genotyping with each marker linked to disease and insect resistance in breeding lines. S5, Rf4, Pita, Pib, Pii, and Pi5 show band patterns on agarose gel electrophoresis; Rf3 indicates size differentiation by fragment analyzer gel electrophoresis. L, R, S indicates ladder marker, resistant, and susceptible control variety, respectively.
pbb-7-272f1.jpg
Fig. 2
PCR products for genotyping with each marker linked to hybried related genes and blast resistance genes in breeding lines. Xa3, Xa7, xa13, and Xa21 show band patterns on gel electrophoresis; xa4, xa5, and tsv1 indicate size differentiation by fragment analyzer gel electrophoresis. Bph18(t) shows HRM curve profiles of 240 genetic resources and F1 hybrid combinations. L, R, S indicates ladder marker, resistant, and susceptible control variety, respectively.
pbb-7-272f2.jpg
Fig. 3
(A) Frequency distribution of disease and insect resistant genes among 240 genetic resources and F1 hybrid combinations, and (B) Frequency of rice lines having different numbers of resistant genes.
pbb-7-272f3.jpg
Fig. 4
Panicle type and growth performance of F1 hybrid combinations, KR0695H, and KR0696H. (A) Panicle length and morphologies of KR0695H and KR0696H; (B) Growth performance of KR0695H and KR0696H at Hai Hau field in Vietnam.
pbb-7-272f4.jpg
Table 1
List of 240 genetic resources and hybrid rice combinations used in this study.
Table 1
Entry No. Designation Cross/Origin Remark Source
1 9019 China Restorer 811001
2 Basmati 370 India Aromatic rice 811005
3 Chiherang Cambodia Local variety 811007
4 Cigeulis Cambodia Local variety 811009
5 Ciliwung Cambodia Local variety 811011
6 FFZ1 China Local variety 811017
7 Giza178 Egypt Local variety 811019
8 HHZ12-SAL2-Y3-Y1 China Breeding line 811025
9 HHZ12-SAL8-Y1-Y2 China Breeding line 811027
10 IR05N412 IR72875-94-3-3-2/IR73707-45-3-2-3 Breeding line, IRRI 811029
11 IR05N412 IR72875-94-3-3-2/IR73707-45-3-2-3 Breeding line, IRRI 811030
12 IR06A145 IR02A127/JANAKI Breeding line, IRRI 811031
13 IR09N538 IRRI 132/PR 30138-35-2//IR04N114 Breeding line, IRRI 811033
14 IR10A267 IR02A483/IRBB 60-1 Breeding line, IRRI 811035
15 IR10N305-1 IRRI Breeding line, IRRI 811037
16 IR78581-12-3-2-2-1 IRRI Breeding line, IRRI 811041
17 IR98070-kB13-1-2-2-1-1-1 IR72903-131-1-2-3R/IR72998-78-1-3-2 R Restorer 811047
18 IR98070-kB14-1-2-3-1-4-1 IR72903-131-1-2-3R/IR72998-78-1-3-2 R Restorer 811051
19 IR98102-kB9-1-1-1-1-1-1 IR65622-151-2-2-2R/IR73885-1-4-3-2-1-10R Restorer 811055
20 IR98102-kB9-1-1-3-1-1-B2-1 IR65622-151-2-2-2R/IR73885-1-4-3-2-1-10R Restorer 811059
21 IR98229-9-2-1-k1-1-6-1-1 IR08A138/IR72998-93-3-3-2R Restorer 811060
22 IR98229-24-1-1-k1-1-1-1-1 IR08A138/IR72998-93-3-3-2R Restorer 811062
23 IR98241-24-2-1-k1-1-1-1 IR06N172/IR86612-38-2-2-1-1-1-1-1 Breeding line, IRRI 811068
24 IR101872-46-1-K1-1-2-1 MingHui63/IR86590-22-2-2-1-3-1-1-1 Breeding line, IRRI 811078
25 L24 China Local variety 811084
26 NSIC 238 Philippines Local variety 811094
27 KR3R MY3R(SSLR-12, Myanma Col. 2012) Local variety 811096
28 OM52 Vietnam Local variety 811098
29 TLR353 Vietnam Local variety 811102
30 TLR363 Vietnam Local variety 811104
31 Vietnam collection 1 Vietnam Local variety 811106
32 WEED TOLERANT RICE 1-1 IRRI Breeding line, IRRI 811108
33 Zhong419 China Local variety 811110
34 6527 Unknown Local variety 811113
35 Com. Collection 3 Com Col. (Cambodia Col. 2015) Local variety 811114
36 HHZ1-Y4-Y1 HUANG-HUA-ZHAN*2/YUE-XIANG-ZHAN Breeding line, China 811120
37 HUA564 China Breeding line 811122
38 IR02A127 IR00A107/IR62243-41-1-3-3 Breeding line, IRRI 811124
39 IR05N359 IR72158-11-5-2-3/Ir72903-121-2-1-2 Breeding line, IRRI 811126
40 IR06A181 IR71718-59-1-2-3/IR72 Breeding line, IRRI 811128
41 IR08N136 IR72967-12-2-3/PR 31090-33-2-1 Breeding line, IRRI 811130
42 IR10K153 HR 24580-15-1/IR03K105 Breeding line, IRRI 811132
43 IR11A303 IR04A427/IR72875-94-3-3-2 Breeding line, IRRI 811134
44 IR11A334 IR04A427/IRRI 115 Breeding line, IRRI 811136
45 Japonica 1 Philippines Local variety 811138
46 SACG4 IRRI Local variety 811150
47 SAGC-02 IRRI Local variety 811152
48 ZH1 China Local variety 811156
49 HHZ11-Y10-DT3-Y3 China Breeding line 811158
50 HHZ5-DT1-DT1 China Breeding line 811160
51 HHZ5-SAL12-DT3-Y2 China Breeding line 811162
52 HHZ5-SAL8-DT2-SAL1 China Breeding line 811164
53 HHZ8-SAL14-SAL1-SUB1 China Breeding line 811166
54 HHZ8-SAL6-SAL3-SAL1 China Breeding line 811168
55 HHZ8-SAL6-SAL3-Y1 China Breeding line 811170
56 HHZ8-SAL6-SAL3-Y2 HUANG-HUA-ZHAN*2/PHALGUNA Breeding line 811172
57 IR06M150 MEM BERANO/PADI ABANG GOGO Breeding line, IRRI 811174
58 IR72 (IR72) IR19661-9-2-3-3/IR15795-199-3-3//IR9129-209-2-2-2-1 Advanced variety, IRRI 811178
59 Teqing China Local variety 811180
60 TME80518 TME 80518 Local variety 811182
61 KR2R MR2R(Myanma Col. 2012) Restorer 811184
62 A 69-1 IRRI Breeding line 811186
63 BR 28-SalTol Bangladesh Breeding line 811188
64 Chulsa Cambodia Local variety 811190
65 IR04A395 IRRI Breeding line 811192
66 IR07A234 NSIC RC 138/IRRI 123 Breeding line 811194
67 IR10A 227 IR01A154/IR72870-19-2-2-3//Irri 123 Breeding line 811196
68 IR65482-4-136 IRRI Breeding line 811198
69 AN 424627 IRRI Local variety 811200
70 BR 26 Bangladesh Local variety 811202
71 Daerip H-R11-2-1-1-1 78/Daelipbyeo F1 Breeding line 811204
72 IR64 Sub1 IRRI Breeding line 811206
73 IR68897H-B24-B-1-1-2 IRRI Breeding line 811208
74 IR09A228 PR29232-B-17-2-1-1/IR 64 Breeding line, 811210
75 J.P.5-IR946-2-2-2/IR1635-1F IRRI Breeding line 811212
76 IR97727-82-1-2-2 IRRI Breeding line 811214
77 IR98073-3-1-1-K1-1 IR72903-131-1-2-3R/IR85485-106-B-B-1-1-1-1 Breeding line 811216
78 IR98107-kB3-1-1-2-1-1 IR71604-4-1-4-4-4-2-2-2R/IR65622-151-2-2-2R Breeding line 811218
79 IR98108-kB13-1-2-3-1-2-1 IRRI Breeding line 811220
80 IR98161-2-1-1-k2-2-2 IR86409-3-1-1-1-1-1/IRBB66 Breeding line 811222
81 IR98194-9-2-1-k1-1-1 IRRI Breeding line 811224
82 IR101861-7-1-K1-1-1 MingHui63/IR03A550 Breeding line 811226
83 IRRI 102 IR4215-301-2-2-6/BG90-2//IR19661-131-1-2 Advanced variety, IRRI 811234
84 Jasponica Bulk Aroma4-1 Philippines Breeding line 811236
85 Jasponica Bulk Aroma5-1 Philippines Breeding line 811238
86 KCD1 IRRI Local variety 811240
87 MY1H-R23-3-1-1-1-1 MY 1 A/R Breeding line 811242
88 MY1H-R23-3-2-1-1-1 MY 1 A/R Breeding line 811244
89 NSIC 222 Philippines Local variety 811246
90 OM100411 Vietnam Local variety 811248
91 OM10375 Vietnam Local variety 811250
92 OM4900 Vietnam Local variety 811252
93 OM7347 Vietnam Local variety 811254
94 OM8108 Vietnam Local variety 811256
95 OMCS 2012 Vietnam Local variety 811258
96 Pearl riceH-R28-3-2-1-1 IRRI Breeding line 811260
97 Pearl riceH-R52-2-1-1-1 IRRI Breeding line 811262
98 PHB73H-R9-2-1-1-1 IRRI Breeding line 811264
99 Phka Romeat Cambodia Local variety 811266
100 Phka Rumchang Cambodia Local variety 811268
101 Phka Rumchek Cambodia Local variety 811270
102 Phka Rumdeng Cambodia Local variety 811272
103 Phka Rumduol Cambodia Local variety 811274
104 Popoul Cambodia Local variety 811276
105 Rumpe Cambodia Local variety 811278
106 S430 China Local variety 811280
107 San pidao Cambodia Local variety 811283
108 TH82H-R2-1-1-1-1-1 Vietnam Breeding line 811284
109 TLR405 Vietnam - 811286
110 TLR407 Vietnam - 811288
111 WC467-2-1-1-1-2-2-1-1 (Milyang154/Norin PL9//Milyang154)/Milyang154 Breeding line 811290
112 WC467-2-3-2-1-2-1-1-1 (Milyang154/Norin PL9//Milyang154)/Milyang154 Breeding line 811292
113 WC468-2-1-3-1-2-3-1-1 (Milyang154/Norin PL9//Milyang154)/Milyang154 Breeding line 811294
114 WC488-6-1-1-2-1-1-1-1 (Milyang23//Norin PL9/Dular///Milyang23)/Milyang23 Breeding line 811296
115 WC488-6-1-1-2-1-3-1-1 (Milyang23//Norin PL9/Dular///Milyang23)/Milyang23 Breeding line 811298
116 WC495-1-1-1-1-2-3-1-1 (Milyang160//Norin PL9/Dular///Areumbyeo)/Areumbyeo Breeding line 811300
117 WC509-4-1-2-1-2-3-1-1 (Jangsungbyeo/Dular//Jangsungbyeo)/Jangsungbyeo Breeding line 811302
118 WC540-2-1-3-1-1-1-1-1 (Milyang160/CPSLO 17//Areumbyeo)/Areumbyeo Breeding line 811304
119 WC540-2-1-3-1-2-2-1-1 (Milyang160/CPSLO 17//Areumbyeo)/Areumbyeo Breeding line 811308
120 WC540-2-3-3-1-2-3-1-1 (Milyang160/CPSLO 17//Areumbyeo)/Areumbyeo Breeding line 811312
121 WC549-1-1-2-1-1-1-1-1 (Yongmunbyeo/CPSLO 17//Yongmunbyeo)/Yongmunbyeo Breeding line 811314
122 WC570-2-1-3-1-1-1-1-1 (Samgangbyeo//Dular/Samgangbyeo///Samgangbyeo)/Samganbyeo Breeding line 811316
123 WC634-1-1-2-1-2-1-1-1 (Yongjubyeo//N22/Yongjubyeo)/Yongjubyeo Breeding line 811320
124 WC647-1-1-1-1-1-2-1-1 Ilpumbyeo/IR65600-96-1-2-2//Ilpumbyeo)/Ilpumbyeo Breeding line 811324
125 WC962-1-2-1-1-1-1 02428-97-2/Areumbyeo//3*Yeonghaebyeo Breeding line 811328
126 WC964-1-1-2-1-3-1-1-1 Sambaekbyeo/02428-97-1//3*Sambaekbyeo Breeding line 811332
127 WC972-3-3-1-1-1-1 02428/3*Yongmunbyeo Breeding line 811334
128 WC972-4-2-1-3-2-1 02428/3*Yongmunbyeo Breeding line 811340
129 Corn rice China Local variety 811375
130 Restorer 1-1 Unknown Breeding line 811377
131 Restorer 2-1 Unknown Breeding line 811379
132 Restorer 3-1 Unknown Breeding line 811381
133 Indonesia col. 1(2016) Indonesia Col. (Cambodia Col. 2016) Local variety 811383
134 Indonesia col. 2(2016) Indonesia Col. (Cambodia Col. 2016) Local variety 811385
135 HYT 116H-3-1-3-2-1-1 HYT 116 H Breeding line 811391
136 HYT 116H-17-2-1-1-2-1 HYT 116 H Breeding line 811395
137 HYT 116H-31-2-3-1-1-1 HYT 116 H Breeding line 811397
138 HYT 116H-46-1-1-1-1-1 HYT 116 H Breeding line 811401
139 HYT 116H-50-1-1-2-1-1 HYT 116 H Breeding line 811405
140 HYT 119H-18-2-2-2-1-1 HYT 119 H Breeding line 811407
141 HYT 119H-18-3-2-2-2-2 HYT 119 H Breeding line 811411
142 HYT 119H-21-1-3-2-2-1 HYT 119 H Breeding line 811414
143 HYT 123H-13-3-3-1-2-1 HYT 123H Breeding line 811416
144 HYT 124H-3-3-1-1-2-1 HYT 124H Breeding line 811420
145 HYT 128H-8-2-2-2-2-1 HYT 128H Breeding line 811426
146 HYT 128H-11-2-1-1-2-1 HYT 128H Breeding line 811428
147 HYT 130H-3-2-3-1-1-1 HYT 130H Breeding line 811432
148 CASH 1H-1-2-3-1-1-1 CASH 1H Breeding line 811434
149 CASH 1H-4-3-2-1-1-1 CASH 1H Breeding line 811440
150 CASH 1H-34-2-2-2-1-1 CASH 1H Breeding line 811444
151 Hipa Jatim 1H-5-2-2-3-2-1 Hipa Jatim 1 H Breeding line 811446
152 IR68897H-94 B-1-3-3-1-1 IR68897H Breeding line 811448
153 IR101922-BK-KB-2-2-1 Maybelle/PSBRC80 Breeding line 811452
154 IR101922-BK-KB-6-1-1 Maybelle/PSBRC80 Breeding line 811456
155 IR101923-BK-KB-1-2-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811458
156 IR101923-BK-KB-3-2-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811460
157 IR101923-BK-KB-4-2-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811462
158 IR101923-BK-KB-4-3-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811464
159 IR101923-BK-KB-7-1-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811466
160 IR101924-BK-KB-2-3-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811468
161 IR101924-BK-KB-7-2-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811470
162 IR101924-BK-KB-10-2-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811472
163 IR101924-BK-KB-11-3-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811474
164 IR101924-BK-KB-14-1-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811476
165 IR101924-BK-KB-14-2-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811478
166 IR101933-BK-KB-2-1-1 IR86505-6-4-3-1-1-1-1-1/MingHui63 Breeding line 811480
167 IR101937-BK-KB-3-2-1 IR86505-6-4-3-1-1-1-1-1/IR86612-26-1-1-1-1-2-1-1 Breeding line 811482
168 IR101937-BK-KB-9-3-1 IR86505-6-4-3-1-1-1-1-1/IR86612-26-1-1-1-1-2-1-1 Breeding line 811484
169 KR0301-B-12-1-1-1 OM 052/NSIC RC 238 Breeding line 811485
170 KR0302-B-5-2-2-1 OM 052/Minghui 63 Breeding line 811490
171 KR0302-B-5-3-1-1 OM 052/Minghui 63 Breeding line 811492
172 KR0302-B-14-2-1-1 OM 052/Minghui 63 Breeding line 811496
173 KR0302-B-17-1-3-1 OM 052/Minghui 63 Breeding line 811498
174 KR0302-B-10-2-1-1 OM 052/Minghui 63 Breeding line 811500
175 KR0302-B-10-2-2-1 OM 052/Minghui 63 Breeding line 811502
176 KR0302-B-13-1-1-1 OM 052/Minghui 63 Breeding line 811506
177 GR19-1-8-2-2-1 2A/3m164 Breeding line 811510
178 GR20-1-3-1-1-1 2A/3m170 Breeding line 811512
179 PHB 73H-1-2-3-1-2-1 PHB 73 Breeding line 811514
180 PHB 73H-18-2-2-3-1-1 PHB 73 Breeding line 811522
181 Matibay H-5-3-1-1-1-1 Matibay Breeding line 811526
182 ABp H-20-2-1-1-1-1 Arize Bigante plusH Breeding line 811532
183 ABp H-29-2-1-1-2-1 Arize Bigante plusH Breeding line 811538
184 ABp H-33-2-3-2-1-1 Arize Bigante plusH Breeding line 811540
185 Hipa Jatim 2H-1-3-3-1-2-1 Hipa Jatim 2 H Breeding line 811542
186 HYT 106H-17-2-1-2-1-1 HYT 106H Breeding line 811544
187 HYT 106H-17-2-2-3-2-1 HYT 106H Breeding line 811548
188 HYT 106H-17-2-3-1-2-1 HYT 106H Breeding line 811551
189 HYT 106H-17-3-1-1-1-1 HYT 106H Breeding line 811559
190 HYT 106H-17-3-2-3-2-1 HYT 106H Breeding line 811563
191 HYT 108H-10-2-3-1-3-1 HYT 108H Breeding line 811565
192 Jasponica-4-1-1-2-2-1 SH 9 Breeding line 811569
193 Jasponica-12-1-1-2-3-1 SH 9 Breeding line 811575
194 Jasponica-14-3-1-1-1-1 SH 9 Breeding line 811577
195 Jasponica-15-1-1-1-1-1 SH 9 Breeding line 811583
196 Jasponica-26-1-1-1-3-1 SH 9 Breeding line 811585
197 Jasponica-29-3-1-1-2-1 SH 9 Breeding line 811587
198 Jasponica-40-3-1-1-2-1 SH 9 Breeding line 811599
199 IR24 IRRI Advanced variety 811601
200 IRBB1 IRRI Bacterial Blight 811603
201 IRBB3 IRRI Bacterial Blight 811605
202 IRBB7 IRRI Bacterial Blight 811607
203 IRBB13 IRRI Bacterial Blight 811609
204 IRBB55 IRRI Bacterial Blight 811611
205 IRBB59 IRRI Bacterial Blight 811613
206 Dasan Korea Local variety 810801
207 Hanareum Korea Local variety 810802
208 KR0203H Korea Hybrid rice F1 810803
209 KR0695H Korea Hybrid rice F1 810804
210 KR0696H Korea Hybrid rice F1 810805
211 KR1454H Korea Hybrid rice F1 810806
212 KR1455H Korea Hybrid rice F1 810807
213 KR1354H Korea Hybrid rice F1 810808
214 KR1497H Korea Hybrid rice F1 810809
215 KR1444H Korea Hybrid rice F1 810810
216 KR1487H Korea Hybrid rice F1 810811
217 KR1994H Korea Hybrid rice F1 810812
218 KR2116H Korea Hybrid rice F1 810813
219 KR2117H Korea Hybrid rice F1 810814
220 KR 1B Korea Maintainer 812501
221 KR 1A Korea CGMS 812503
222 KR 2B Korea Maintainer 812526
223 KR 2A Korea CGMS 812528
224 KR 211B Korea Maintainer 812551
225 KR 211A Korea CGMS 812553
226 MingHui 63 China Local variety, Restorer 812571
227 IR75589-31-27-8-33S-5-1 IRRI Breeding line, TGMS 812608
228 IR102100-KB5S2-1-4-1-1-1-1 IRRI Breeding line, TGMS 812618
229 OM052 Vietnam Local variety, Restorer 812636
230 IR102100-KB14-2S2-1-22-2-1-2 IRRI Breeding line, TGMS 812718
231 IR98070-kB14-1-2-3-1-1 IRRI Breeding line 812736
232 IR98229-2-2-1-K1-1-1 IRRI Breeding line 812756
233 IR98229-9-2-1-K1-1-1 IRRI Breeding line 812771
234 IR98229-9-2-1-K1-1-3 IRRI Breeding line 812776
235 IR101861-7-1-K1-1-1 IRRI Breeding line 812786
236 IR98241-24-2-1-k1-1-1 IRRI Breeding line 812806
237 IR98102-kB9-1-1-3-1-1-1 IRRI Breeding line 812821
238 IR102100-KB12S1-1-25-1-1-1-1 IRRI Breeding line, TGMS 812823
239 IR98102-kB21-1-3-1-3-1 IRRI Breeding line 812836
240 IR102452-KB3-1-2-2-1-1 IRRI Breeding line 812851
Table 2
Gene-specific PCR primers and their primer sequences used for analysis of related genes.
Table 2
Target Gene Marker name Type Primer sequence (5′→3′) Exspected size (bp) Reference
Genes related to hybrid S5 S5-Indel Fw CCTACGTTTGACTGCCTGCCTG 281/417 , Sundaram et al. 2010
Rv CTACACGCGGCTTCGGGAAAGC
Indica-specific SNP Fw GACAGCAGCATCAACGACTTCC 527
Rv TCGTCAGTGGGCAAGCAGTAGCTG
Japonica-specific SNP Fw ACCCTGATATTCTGAGTTACAAGGCATTA 325
Rv GCTCTTGATGTCCGGTGATACC
Rf3 DRRM-RF3-5 Fw GATGGCACAGCTTCAGAACA 120/134 Suresh et al. 2012
Rv CTAATTCTGGGCGAGCAAAG
DRRM-RF3-10 Fw TCACCTCTTCCTGCTTCGAC 180/195
Rv CTCCACCAGTGCAGGTTTTT
Rf4 DRCG-RF4-14 Fw GCAATGCTTGTATTCAGCAAA 845/885 , Tang et al. 2014
Rv TCCAGCTGTAAATCCGTCAA
M19280 Fw ATCTGTCCAGACACCATTTTC 147/141
Rv TCCACTGATGAGTGCATTG
Blast Pita YL155/87 Fw AGCAGGTTATAAGCTAGGCC 1042 , Jia et al. 2002, 2004
Rv CTACCAACAAGTTCATCAAA
YL183/87 Fw AGCAGGTTATAAGCTAGCTAT
Rv CTACCAACAAGTTCATCAAA
Pib NSb Fw ATCAACTCTGCCACAAAATCC 629 , Kwon et al. 2008
Rv CCCATATCACCACTTGTTCCCC
Pi5 JJ817 Fw GATATGGTTGAAAAGCTAATCTCA 1450 , Kwon et al. 2008
Rv ATCATTGTCCTTCATATTCAGAGT
Pii JJ113 Fw GGATGATGTGATCTGCAGAG 484 Jeon 2002
Rv CTCTTGGTGATCTTTGTTAC
Bacterial blight (BB) Xa3 BB3-Sus Fw CGGAGCGACACAGCTATCAT 743 , Hu et al. 2013
Rv CGTGAGGTTCCCTATGGCGATT
BB3-Re Fw CCACAATGCCATGTCAGGTGGCATCCCTGCA 255 , Hu et al. 2013
Rv AGGTGTTGGAGGATTGGCAT
Xa4 RM224 Fw ATCGATCGATCTTCACGAGG 150/120 , McCouch et al. 2002
Rv TGCTATAAAAGGCATTCGGG
Xa5 RM122 Fw GCACTGCAACCATCAATGAATC 236/232 , Chen et al. 1997
Rv CCTAGGAGAAACTAGCCGTCCA
Xa7 M5 Fw CGATCTTACTGGCTCTGCAACTCTGT 294/1170 , Porter et al. 2013
Rv GCATGTCTGTGTCGATTCGTCCGTACGA
Xa13 Xa13prom Fw GGCCATGGCTCAGTGTTTAT 1000/520 , Zhang et al. 1996; Singh et al. 2011
Rv GAGCTCCAGCTCTCCAAATG
Xa21 pTA248 Fw AGACGCGGAAGGGTGGTTCCCGGA 1000/750 , Huang et al. 1997
Rv AGACGCGGTAATCGAAAGATGAAA
BPH Bph18(t) Bph18(t) SNP23 CGATGGATTACCCTATCACCT CAA HRM Developed in this study
SNP24 AACCCTCTGCACACCATCGG
Tungro virus tsv1 RM6152 Fw GAATTCACCGCTCTCCAGTC 206 , Lee et al. 2010
Rv AGGAGGATCTCCTCCAGGAG
Table 3
List of control varieties used for identification of resistance genes.
Table 3
Gene Resistant controls Susceptible controls
Xa3 IRBB3 IR24
Xa4 IRBB4 IR24
xa5 IRBB5 IR24
Xa7 IRBB7 IR24
xa13 IRBB13 IR24
Xa21 IRBB21 IR24
Pib IRBL-b LTH
Pita IRBL-ta(K1), IRBL-ta(CT2), IRBL-ta2(Pi) LTH
Pi5, Pii Pi3, Pi5(t), Pii LTH
Bph18(t) Anmi, Anda IR24, Ilpum
tsv1 Utri merah, N22 Nipponbare, TN1
Table 4
List of eleven hybrid rice breeding lines and their cross combinations used for evaluating agronomic traits and screening disease/insect resistance in the Red River Delta in Vietnam.
Table 4
F1 entry Cross combination Remark
KR0203H KR2A/Minghui 63 CGMS
KR0695H KR1A/OM052 CGMS
KR0696H KR2A/OM052 CGMS
KR1454H KR1A/MY2R (= KR2R) CGMS
KR1455H KR2A/MY2R (= KR2R) CGMS
KR1354H KR2A/IR98070-KB14-1-2-3-1-1 CGMS
KR1497H IR75589-31-27-8-33S/IR98229-9-2-1-k1-1 TGMS
KR1444H IR75589-31-27-8-33S/IR102452-KB3-1-2-2-1-1 TGMS
KR1487H HYT 108 S8-1-25-2/IR98102-kB9-1-1-3-1-1 TGMS
KR1994H IR75589-31-27-8-33S/Minghui 63 TGMS
KR2116H IR102100-KB12S2-1-19-1/IR98102-kB21-1-3-1-3-1 TGMS
Table 5
Identification patterns of disease and insect resistant genes in eleven hybrid rice combinations.
Table 5
Entry Bacterial Blight No. of R genes Blast No. of R genes Bph 18(t) tsv1 Total of R genes


Xa3S Xa3R Xa4 xa5 Xa7 xa13 Xa21 Pi-ta Pib Pii Pi5
KR0203H + +/− 0 + + + + 3 +/− 3
KR0695H 0 + + + + 3 +/− 3
KR0696H + 0 + + + + + 4 +/− 4
KR1454H + + 1 + + + + 3 4
KR1455H + + 1 + + + + 3 4
KR1354H + + +/− 1 + + + + 3 +/− 4
KR1497H + + 1 + + + + + 4 5
KR1444H + 0 + + + + + 4 4
KR1487H + +/− 0 + + + 2 2
KR1994H +/− 0 + + + + 4 4
KR2116H + + +/− +/− 1 + + + + + 4 + 6

To get the whole information of 240 genetic resources and hybrid rice combinations, please see Supplementary Table S1.

Table 6
Relative levels of resistance on hybrid rice combinations and control varieties upon inoculation separately by disease and insect in the Red River Delta region in Vietnam.
Table 6
Entryz) Brown Planthopper Blast Bacterial Blight



6 DARy) 8 DAR 28 DAI 35 DAIy) 42 DAI





Score Reaction Score Reaction Score Reaction Score Reaction Score Reaction
KR0203H 6.0 MSx) 8.0 S 0.0 HR 1.0 HR 5.0 MS
KR0695H 7.0 S 9.0 HS 0.0 HR 0.0 HR 1.0 HR
KR0696H 6.0 MS 9.0 HS 0.0 HR 0.0 HR 3.0 R
KR1454H 5.0 MS 8.0 S 0.0 HR 0.0 HR 3.0 R
KR1455H 6.0 MS 8.0 S 0.0 HR 0.0 HR 3.0 R
KR1354H 7.0 S 8.0 S 1.0 HR 1.0 HR 3.0 R
KR1497H 4.0 MR 8.0 S 0.0 HR 0.0 HR 1.0 HR
KR1444H 7.0 S 9.0 HS 0.0 HR 0.0 HR 3.0 R
KR1487H 4.0 MR 9.0 HS 1.5 HR 2.0 HR 3.0 R
KR1994H 3.0 R 6.0 MS 4.0 MR 5.0 MS 0.0 HR
KR2116H 5.0 MS 9.0 HS 0.0 HR 1.0 HR 1.0 HR
BTP 33 1.0 R 1.0 R - - - - - -
TN 1 9.0 HS 9.0 HS - - - - - -
OM 1490 - - - - 9.0 HS 9.0 HS 5.0 MS

z)All of hybrid rice breeding lines, KR0203H to KR2116H, were in generation of F1.

y)DAR: Days after release, DAI: Day after inoculation.

x)HR: Highly resistance, R: Resistance, MR: Medium resistance, MS: Medium susceptible, S: Susceptible, HS: Highly susceptible.

Table 7
Agronomic traits and yields of F1 hybrid combinations with disease/insect resistantance genes introduced by MAS and control varieties.
Table 7
Entry HD (mm.dd) GP (day) PH (cm) PL (cm) PET (%) PRG (%) GW (g) Yield (tonne/ha)
KR0203H 5.18 121 114.5 29.4 64.8 78.1 27.0 10.1
KR0695H 5.15 119 122.6 27.5 74.0 65.2 26.5 11.8
KR0696H 5.15 119 122.9 27.9 75.3 71.8 27.0 11.1
KR1454H 5.19 123 118.2 27.4 71.7 68.4 26.0 9.7
KR1455H 5.18 122 114.4 27.4 72.6 73.8 26.4 9.6
KR1354H 5.19 126 113.6 31.1 71.5 69.9 26.4 10.7
KR1497H 5.15 119 111.6 28.3 76.2 88.5 26.2 10.0
KR2116H 5.15 122 113.8 29.0 83.6 68.5 26.1 10.3
IIA838 5.12 113 118.3 28.1 79.3 90.4 30.3 14.6
BC15 5.16 115 112.8 28.1 69.8 74.3 22.1 9.1

HD: Heading date, GP: Growing period, PH: Plant height, PL: Panicle length, PET: Percent effective tillers, PRG: Percent ripened grain, GW: 1000-grain weight.

  • Balaji Suresh P, Srikanth B, Hemanth Kishore V, Subhakara Rao I, Vemireddy LR, Dharika N, et al. 2012. Fine mapping of Rf3 and Rf4 fertility restorer loci of WA-CMS of rice (Oryza sativa L.) and validation of the developed marker system for identification of restorer lines. Euphytica. 187: 421-435.
  • Bohra A, Jha UC, Adhimoolam P, Bisht D, Singh NP. 2016. Cytoplasmic male sterility (CMS) in hybrid breeding in field crops. Plant Cell Rep. 35: 967-993.
  • Chase CD. 2007. Cytoplasmic male sterility: a window to the world of plant mitochondrial-nuclear interactions. Trends Genet. 23: 81-90.
  • Cheema KK, Grewal NK, Vikal Y, Sharma R, Lore JS, Das A, et al. 2008. A novel bacterial blight resistance gene from Oryza nivara mapped to 38kb region on chromosome 4L and transferred to Oryza sativa L. Genet. Res. (Camb). 90: 397-407.
  • Chen L, Liu Y. 2014. Male sterility and fertility restoration in crops. Annu Rev Plant Bio. 65: 579-606.
  • Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. 1997. Development of a microsatellite framework map providing genomewide coverage in rice (Oryza sativa L.). Theor Appl Genet. 95: 553-567.
  • Dyah RP, Kei M, Bambang HT. 2013. The dynamics of rice production in Indonesia 1961–2009. J Saudi Soc Agric Sci. 12: 27-37.
  • FAORAP.2014. Hybrid rice development in Asia: Assessment of limitations and potential.
  • Franz MN, Song JY, Ouk S, Rahimi S, Kwon SW, Kang KK, et al. 2016. Current applicable DNA markers for marker assisted breeding in abiotic and biotic stress tolerance in rice (Oryza sativa L.). Plant Breed Biotech. 4: 271-284.
  • Fujita D, Kohli A, Horgan FG. 2013. Rice resistance to planthoppers and leafhoppers. Crit Rev Plant Sci. 32: 162-191.
  • He GH, Wang WM, Liu GQ, Hou L, Xiao YH, Tang M, et al. 2002. Mapping of two fertility restoring gene for WA cytoplasmic male mterility in Minghui63 using SSR markers. Acta Genet Sin. 29: 798-802.
  • Huang N, Angeles ER, Domingo J, Magpantay G, Singh S, Zhang G, et al. 1997. Pyramiding of bacterial blight resistance genes in rice: marker assisted selection using RFLP and PCR. Theor Appl Genet. 95: 313-320.
  • Hu J, Xiao C, He Y. 2016. Recent progress on the genetics and molecular breeding of brown planthopper resistance in rice. Rice (N Y). 9: 30
  • Hu YJ, Jeung JU, Kim SY, Park HS, Cho JH, Lee JY. 2013. Functional markers for bacterial blight resistance gene Xa3 in rice. Mol Breed. 31: 981-985.
  • Ikeda-Kawakatsu K, Maekawa M, Izawa T, Itoh J, Nagato Y. 2012. ABERRANT PANICLE ORGANIZATION 2/RFL, the rice ortholog of Arabidopsis LEAFY, suppresses the transition from inflorescence meristem to floral meristem through interaction with APO1. Plant J. 69: 168-180.
  • Jeon JS, Chen D, Yi GH, Wang GL, Ronald PC. 2003. Genetic and physical mapping of Pi5(t), a locus associated with broad-spectrum resistance to rice blast. Mol. Genet. Genomics. 269: 280-289.
  • Jia Y, Wang Z, Singh P. 2002. Development of dominant rice blast Pi-ta resistance gene markers. Crop Sci. 42: 2145-2149.
  • Jia Y, Redus M, Wang Z, Rutger JN. 2004. Development of a SNLP marker from the Pi-ta blast resistance gene by tri-primer PCR. Euphytica. 138: 97-105.
  • Jin XW, Wang CL, Yang Q, Jiang QX, Fan YL, Liu GC, et al. 2007. Breeding of near-isogenic line CBB30 and molecular mapping of Xa30(t), a new resistance gene to bacterial blight in rice. Sci Agric Sin. 40: 1094-1100.
  • Jing RC, Li XM, Yi P, Zhu YG. 2001. Mapping fertility-restoring genes of rice WA cytoplasmic male sterility using SSLP markers. Bot Bull Acad Sin. 42: 167-171.
  • Jo YC, Kim SG. 2016. Efficient F1 variety development using CGMS system in onion (Allium cepa L.). Trends Agric Life Sci. 53: 81-85.
  • Kim KY, Shin MS, Kim WJ, Mo YJ, Nam JK, Noh TH, et al. 2009. Effective combination of resistance genes against rice bacterial blight pathogen. Korean J Breed Sci. 41: 244-251.
  • Kwon SW, Cho YC, Kim YG, Suh JP, Jeung JU, Roh JH. 2008. Development of near-isogenic Japonica rice lines with enhanced resistance to Magnaporthe grisea. Mol Cells. 25: 407-416.
  • Lau WC, Rafii MY, Ismail MR, Puteh A, Latif MA, Ramli A. 2015. Review of functional markers for improving cooking, eating, and the nutritional qualities of rice. Front Plant Sci. 6: 832
  • Lee JD, Do JW, Han JH, An CG, Kweon OY, Kim YK, et al. 2011. Allelism and molecular marker tests for genic male sterility in paprika cultivars. Korean J Hortic Sci Technol. 29: 130-134.
  • Lee JH, Muhsin M, Atienza GA, Kwak DY, Kim SM, Leon TB. 2010. Single nucleotide polymorphisms in a gene for translation initiation factor (eIF4G) of rice (Oryza sativa) associated with resistance to Rice tungro spherical virus. Mol Plant Microbe Interact. 23: 29-38.
  • Li S, Yang D, Zhu Y. 2007. Characterization and use of male sterility in hybrid rice breeding. J Integr Plant Biol. 49: 791-804.
  • Lin SC, Yuan LP. 1980. Hybrid rice breeding in China. pp. 35-51. International Rice Research Institute.Innovative approaches to rice breeding. International Rice Research Institute. Manila, Philippines.
  • Liu J, Wang X, Mitchell T, Hu Y, Liu X, Dai L, et al. 2010. Recent progress and understanding of the molecular mechanisms of the rice-Magnaporthe oryzae interaction. Mol Plant Pathol. 11: 419-427.
  • McCouch SR, Teytelman L, Xu YB, Lobos KB, Clare K, Walton M. 2002. Development and mapping of 2,240 new SSR markers for rice (Oryza sativa L.). DNA Res. 9: 199-207.
  • Myint KKM, Fujita D, Matsumura M, Sonoda T, Yoshimura A, Yasui H. 2012. Mapping and pyramiding of two major genes for resistance to the brown planthopper (Nilaparvata lugens [Stål]) in the rice cultivar ADR52. Theor Appl Genet. 124: 495-504.
  • Ouyang YD, Chen JJ, Ding JH, Zhang QF. 2009. Advances in the understanding of inter-subspecific hybrid sterility and wide compatibility in rice. Sci Bull. 54: 2332-2341.
  • Park HS, Kim KY, Shin MS, Noh TH, Ha KY, Baek MG, et al. 2011. Breeding for japonica rice variety with resistance to bacterial blight in Korea. Korean J Breed Sci. 43: 44.
  • Peleman JD, Voort JR. 2003. Breeding by design. Trends Plant Sci. 8: 330-334.
  • Porter BW, Chittoor JM, Yano M, Sasaki T. 2003. Development and mapping of markers linked to the rice bacterial blight resistance gene Xa7. Crop Sci. 43: 1484-1492.
  • Seo HS, Song YC. 1993. Breeding hybrid rice with good quality and high yield: I. Breeding of cytoplasmic-genetic male sterile and restorer lines with backgrounds of Korean rice varieties. Korean J Crop Sci. 38: 413-417.
  • Shin MS, Kim KY, Park HS, Ko JK. 2011. Breeding for resistance to bacterial blight in rice. Korean J Breed Sci. 43: 241-251.
  • Singh AK, Gopala Krishnan S, Singh VP, Prabhu KV, Mohapatra T, Singh NK. 2011. Marker assisted selection: a paradigm shift in Basmati breeding. Indian J Genet Pl Br. 71: 1-9.
  • Song JY, Ouk S, Nogoy FM, Niño MC, Kwon SW, Ha WG, et al. 2016. Application and utilization of marker assisted selection for biotic stress resistance in hybrid rice (Oryza sativa L.). J Plant Biotechnol. 43: 317-331.
  • Suh JP, Cho YC, Won YJ, Ahn EK, Baek MK, Kim MK, et al. 2015. Development of Resistant Gene-Pyramided Japonica Rice for Multiple Biotic Stresses Using Molecular Marker-Assisted Selection. Plant Breed Biotech. 3: 333-345.
  • Sundaram RM, Sakthivel K, Hariprasad AS, Ramesha MS, Viraktamath BC, Neeraja CN, et al. 2010. Development and validation of a PCR-based functional marker system for the major wide-compatible gene locus S5 in rice. Mol Breed. 26: 719-727.
  • Suresh PB, Srikanth B, Kishore VH, Rao IS, Vemireddy LR, Dharika N, et al. 2010. Fine mapping of Rf3 and Rf4 fertility restorer loci of WA-CMS of rice (Oryza sativa L.) and validation of the developed marker system for identification of restorer lines. Euphytica. 187: 421-435.
  • Tang H, Luo D, Zhou D, Zhang Q, Tian D, Zheng X, et al. 2014. The ricer restorer Rf4 for wild-abortive cytoplasmic male sterility encodes a mitochondrial-localized PPR protein that functions in reduction of WA352 transcripts. Mol Plant. 7: 1-4.
  • Thome K, Birgit M, Kamron D, Cheryl C. 2018. International Food Security Assessment, 2018–2028, GFA-29. Departmetn of Agriculture, Economic Research Service. U.S.
  • Tu J, Ona I, Zhang Q, Mew TW, Khush GS, Datta SK. 1998. Transgenic rice variety ‘IR72’ with Xa21 is resistant to bacterial blight. Theor Appl Genet. 97: 31-36.
  • Viet NV. 2008. National agricultural research system of Vietnam. Vietnam Academy of Agricultural Sciences. Vietnam.
  • Xia C, Chen H, Zhu X. 2012. Identification, mapping, isolation of the genes resisting to bacterial blight and application in rice. Mol Plant Breed. 3: 121-131.
  • Yang Q, Lin F, Wang L, Pan Q. 2009. Identification and mapping of Pi41, a major gene conferring resistance to rice blast in the Oryza sativa subsp. indica reference cultivar, 93-11. Theor Appl Genet. 118: 1027-1034.
  • Zhang F, Zhuo DL, Huang LY, Wang WS, Xu JL, Vera Cruz C, et al. 2015. Xa39, a novel dominant gene conferring broad-spectrum resistance to Xanthomonas oryzae pv. oryzae in rice. Plant Pathol. 64: 568-575.
  • Zhang G, Angeles ER, Abenes MLP, Khush GS. 1996. RAPD and RFLP mapping of the bacterial blight resistance gene Xa-13 in rice. Theor Appl Genet. 93: 65-70.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Breeding Hybrid Rice with Genes Resistant to Diseases and Insects Using Marker-Assisted Selection and Evaluation of Biological Assay
Plant Breed. Biotech.. 2019;7(3):272-286.   Published online September 1, 2019
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Breeding Hybrid Rice with Genes Resistant to Diseases and Insects Using Marker-Assisted Selection and Evaluation of Biological Assay
Plant Breed. Biotech.. 2019;7(3):272-286.   Published online September 1, 2019
Close

Figure

  • 0
  • 1
  • 2
  • 3
Breeding Hybrid Rice with Genes Resistant to Diseases and Insects Using Marker-Assisted Selection and Evaluation of Biological Assay
Image Image Image Image
Fig. 1 PCR products for genotyping with each marker linked to disease and insect resistance in breeding lines. S5, Rf4, Pita, Pib, Pii, and Pi5 show band patterns on agarose gel electrophoresis; Rf3 indicates size differentiation by fragment analyzer gel electrophoresis. L, R, S indicates ladder marker, resistant, and susceptible control variety, respectively.
Fig. 2 PCR products for genotyping with each marker linked to hybried related genes and blast resistance genes in breeding lines. Xa3, Xa7, xa13, and Xa21 show band patterns on gel electrophoresis; xa4, xa5, and tsv1 indicate size differentiation by fragment analyzer gel electrophoresis. Bph18(t) shows HRM curve profiles of 240 genetic resources and F1 hybrid combinations. L, R, S indicates ladder marker, resistant, and susceptible control variety, respectively.
Fig. 3 (A) Frequency distribution of disease and insect resistant genes among 240 genetic resources and F1 hybrid combinations, and (B) Frequency of rice lines having different numbers of resistant genes.
Fig. 4 Panicle type and growth performance of F1 hybrid combinations, KR0695H, and KR0696H. (A) Panicle length and morphologies of KR0695H and KR0696H; (B) Growth performance of KR0695H and KR0696H at Hai Hau field in Vietnam.
Breeding Hybrid Rice with Genes Resistant to Diseases and Insects Using Marker-Assisted Selection and Evaluation of Biological Assay

List of 240 genetic resources and hybrid rice combinations used in this study.

Entry No. Designation Cross/Origin Remark Source
1 9019 China Restorer 811001
2 Basmati 370 India Aromatic rice 811005
3 Chiherang Cambodia Local variety 811007
4 Cigeulis Cambodia Local variety 811009
5 Ciliwung Cambodia Local variety 811011
6 FFZ1 China Local variety 811017
7 Giza178 Egypt Local variety 811019
8 HHZ12-SAL2-Y3-Y1 China Breeding line 811025
9 HHZ12-SAL8-Y1-Y2 China Breeding line 811027
10 IR05N412 IR72875-94-3-3-2/IR73707-45-3-2-3 Breeding line, IRRI 811029
11 IR05N412 IR72875-94-3-3-2/IR73707-45-3-2-3 Breeding line, IRRI 811030
12 IR06A145 IR02A127/JANAKI Breeding line, IRRI 811031
13 IR09N538 IRRI 132/PR 30138-35-2//IR04N114 Breeding line, IRRI 811033
14 IR10A267 IR02A483/IRBB 60-1 Breeding line, IRRI 811035
15 IR10N305-1 IRRI Breeding line, IRRI 811037
16 IR78581-12-3-2-2-1 IRRI Breeding line, IRRI 811041
17 IR98070-kB13-1-2-2-1-1-1 IR72903-131-1-2-3R/IR72998-78-1-3-2 R Restorer 811047
18 IR98070-kB14-1-2-3-1-4-1 IR72903-131-1-2-3R/IR72998-78-1-3-2 R Restorer 811051
19 IR98102-kB9-1-1-1-1-1-1 IR65622-151-2-2-2R/IR73885-1-4-3-2-1-10R Restorer 811055
20 IR98102-kB9-1-1-3-1-1-B2-1 IR65622-151-2-2-2R/IR73885-1-4-3-2-1-10R Restorer 811059
21 IR98229-9-2-1-k1-1-6-1-1 IR08A138/IR72998-93-3-3-2R Restorer 811060
22 IR98229-24-1-1-k1-1-1-1-1 IR08A138/IR72998-93-3-3-2R Restorer 811062
23 IR98241-24-2-1-k1-1-1-1 IR06N172/IR86612-38-2-2-1-1-1-1-1 Breeding line, IRRI 811068
24 IR101872-46-1-K1-1-2-1 MingHui63/IR86590-22-2-2-1-3-1-1-1 Breeding line, IRRI 811078
25 L24 China Local variety 811084
26 NSIC 238 Philippines Local variety 811094
27 KR3R MY3R(SSLR-12, Myanma Col. 2012) Local variety 811096
28 OM52 Vietnam Local variety 811098
29 TLR353 Vietnam Local variety 811102
30 TLR363 Vietnam Local variety 811104
31 Vietnam collection 1 Vietnam Local variety 811106
32 WEED TOLERANT RICE 1-1 IRRI Breeding line, IRRI 811108
33 Zhong419 China Local variety 811110
34 6527 Unknown Local variety 811113
35 Com. Collection 3 Com Col. (Cambodia Col. 2015) Local variety 811114
36 HHZ1-Y4-Y1 HUANG-HUA-ZHAN*2/YUE-XIANG-ZHAN Breeding line, China 811120
37 HUA564 China Breeding line 811122
38 IR02A127 IR00A107/IR62243-41-1-3-3 Breeding line, IRRI 811124
39 IR05N359 IR72158-11-5-2-3/Ir72903-121-2-1-2 Breeding line, IRRI 811126
40 IR06A181 IR71718-59-1-2-3/IR72 Breeding line, IRRI 811128
41 IR08N136 IR72967-12-2-3/PR 31090-33-2-1 Breeding line, IRRI 811130
42 IR10K153 HR 24580-15-1/IR03K105 Breeding line, IRRI 811132
43 IR11A303 IR04A427/IR72875-94-3-3-2 Breeding line, IRRI 811134
44 IR11A334 IR04A427/IRRI 115 Breeding line, IRRI 811136
45 Japonica 1 Philippines Local variety 811138
46 SACG4 IRRI Local variety 811150
47 SAGC-02 IRRI Local variety 811152
48 ZH1 China Local variety 811156
49 HHZ11-Y10-DT3-Y3 China Breeding line 811158
50 HHZ5-DT1-DT1 China Breeding line 811160
51 HHZ5-SAL12-DT3-Y2 China Breeding line 811162
52 HHZ5-SAL8-DT2-SAL1 China Breeding line 811164
53 HHZ8-SAL14-SAL1-SUB1 China Breeding line 811166
54 HHZ8-SAL6-SAL3-SAL1 China Breeding line 811168
55 HHZ8-SAL6-SAL3-Y1 China Breeding line 811170
56 HHZ8-SAL6-SAL3-Y2 HUANG-HUA-ZHAN*2/PHALGUNA Breeding line 811172
57 IR06M150 MEM BERANO/PADI ABANG GOGO Breeding line, IRRI 811174
58 IR72 (IR72) IR19661-9-2-3-3/IR15795-199-3-3//IR9129-209-2-2-2-1 Advanced variety, IRRI 811178
59 Teqing China Local variety 811180
60 TME80518 TME 80518 Local variety 811182
61 KR2R MR2R(Myanma Col. 2012) Restorer 811184
62 A 69-1 IRRI Breeding line 811186
63 BR 28-SalTol Bangladesh Breeding line 811188
64 Chulsa Cambodia Local variety 811190
65 IR04A395 IRRI Breeding line 811192
66 IR07A234 NSIC RC 138/IRRI 123 Breeding line 811194
67 IR10A 227 IR01A154/IR72870-19-2-2-3//Irri 123 Breeding line 811196
68 IR65482-4-136 IRRI Breeding line 811198
69 AN 424627 IRRI Local variety 811200
70 BR 26 Bangladesh Local variety 811202
71 Daerip H-R11-2-1-1-1 78/Daelipbyeo F1 Breeding line 811204
72 IR64 Sub1 IRRI Breeding line 811206
73 IR68897H-B24-B-1-1-2 IRRI Breeding line 811208
74 IR09A228 PR29232-B-17-2-1-1/IR 64 Breeding line, 811210
75 J.P.5-IR946-2-2-2/IR1635-1F IRRI Breeding line 811212
76 IR97727-82-1-2-2 IRRI Breeding line 811214
77 IR98073-3-1-1-K1-1 IR72903-131-1-2-3R/IR85485-106-B-B-1-1-1-1 Breeding line 811216
78 IR98107-kB3-1-1-2-1-1 IR71604-4-1-4-4-4-2-2-2R/IR65622-151-2-2-2R Breeding line 811218
79 IR98108-kB13-1-2-3-1-2-1 IRRI Breeding line 811220
80 IR98161-2-1-1-k2-2-2 IR86409-3-1-1-1-1-1/IRBB66 Breeding line 811222
81 IR98194-9-2-1-k1-1-1 IRRI Breeding line 811224
82 IR101861-7-1-K1-1-1 MingHui63/IR03A550 Breeding line 811226
83 IRRI 102 IR4215-301-2-2-6/BG90-2//IR19661-131-1-2 Advanced variety, IRRI 811234
84 Jasponica Bulk Aroma4-1 Philippines Breeding line 811236
85 Jasponica Bulk Aroma5-1 Philippines Breeding line 811238
86 KCD1 IRRI Local variety 811240
87 MY1H-R23-3-1-1-1-1 MY 1 A/R Breeding line 811242
88 MY1H-R23-3-2-1-1-1 MY 1 A/R Breeding line 811244
89 NSIC 222 Philippines Local variety 811246
90 OM100411 Vietnam Local variety 811248
91 OM10375 Vietnam Local variety 811250
92 OM4900 Vietnam Local variety 811252
93 OM7347 Vietnam Local variety 811254
94 OM8108 Vietnam Local variety 811256
95 OMCS 2012 Vietnam Local variety 811258
96 Pearl riceH-R28-3-2-1-1 IRRI Breeding line 811260
97 Pearl riceH-R52-2-1-1-1 IRRI Breeding line 811262
98 PHB73H-R9-2-1-1-1 IRRI Breeding line 811264
99 Phka Romeat Cambodia Local variety 811266
100 Phka Rumchang Cambodia Local variety 811268
101 Phka Rumchek Cambodia Local variety 811270
102 Phka Rumdeng Cambodia Local variety 811272
103 Phka Rumduol Cambodia Local variety 811274
104 Popoul Cambodia Local variety 811276
105 Rumpe Cambodia Local variety 811278
106 S430 China Local variety 811280
107 San pidao Cambodia Local variety 811283
108 TH82H-R2-1-1-1-1-1 Vietnam Breeding line 811284
109 TLR405 Vietnam - 811286
110 TLR407 Vietnam - 811288
111 WC467-2-1-1-1-2-2-1-1 (Milyang154/Norin PL9//Milyang154)/Milyang154 Breeding line 811290
112 WC467-2-3-2-1-2-1-1-1 (Milyang154/Norin PL9//Milyang154)/Milyang154 Breeding line 811292
113 WC468-2-1-3-1-2-3-1-1 (Milyang154/Norin PL9//Milyang154)/Milyang154 Breeding line 811294
114 WC488-6-1-1-2-1-1-1-1 (Milyang23//Norin PL9/Dular///Milyang23)/Milyang23 Breeding line 811296
115 WC488-6-1-1-2-1-3-1-1 (Milyang23//Norin PL9/Dular///Milyang23)/Milyang23 Breeding line 811298
116 WC495-1-1-1-1-2-3-1-1 (Milyang160//Norin PL9/Dular///Areumbyeo)/Areumbyeo Breeding line 811300
117 WC509-4-1-2-1-2-3-1-1 (Jangsungbyeo/Dular//Jangsungbyeo)/Jangsungbyeo Breeding line 811302
118 WC540-2-1-3-1-1-1-1-1 (Milyang160/CPSLO 17//Areumbyeo)/Areumbyeo Breeding line 811304
119 WC540-2-1-3-1-2-2-1-1 (Milyang160/CPSLO 17//Areumbyeo)/Areumbyeo Breeding line 811308
120 WC540-2-3-3-1-2-3-1-1 (Milyang160/CPSLO 17//Areumbyeo)/Areumbyeo Breeding line 811312
121 WC549-1-1-2-1-1-1-1-1 (Yongmunbyeo/CPSLO 17//Yongmunbyeo)/Yongmunbyeo Breeding line 811314
122 WC570-2-1-3-1-1-1-1-1 (Samgangbyeo//Dular/Samgangbyeo///Samgangbyeo)/Samganbyeo Breeding line 811316
123 WC634-1-1-2-1-2-1-1-1 (Yongjubyeo//N22/Yongjubyeo)/Yongjubyeo Breeding line 811320
124 WC647-1-1-1-1-1-2-1-1 Ilpumbyeo/IR65600-96-1-2-2//Ilpumbyeo)/Ilpumbyeo Breeding line 811324
125 WC962-1-2-1-1-1-1 02428-97-2/Areumbyeo//3*Yeonghaebyeo Breeding line 811328
126 WC964-1-1-2-1-3-1-1-1 Sambaekbyeo/02428-97-1//3*Sambaekbyeo Breeding line 811332
127 WC972-3-3-1-1-1-1 02428/3*Yongmunbyeo Breeding line 811334
128 WC972-4-2-1-3-2-1 02428/3*Yongmunbyeo Breeding line 811340
129 Corn rice China Local variety 811375
130 Restorer 1-1 Unknown Breeding line 811377
131 Restorer 2-1 Unknown Breeding line 811379
132 Restorer 3-1 Unknown Breeding line 811381
133 Indonesia col. 1(2016) Indonesia Col. (Cambodia Col. 2016) Local variety 811383
134 Indonesia col. 2(2016) Indonesia Col. (Cambodia Col. 2016) Local variety 811385
135 HYT 116H-3-1-3-2-1-1 HYT 116 H Breeding line 811391
136 HYT 116H-17-2-1-1-2-1 HYT 116 H Breeding line 811395
137 HYT 116H-31-2-3-1-1-1 HYT 116 H Breeding line 811397
138 HYT 116H-46-1-1-1-1-1 HYT 116 H Breeding line 811401
139 HYT 116H-50-1-1-2-1-1 HYT 116 H Breeding line 811405
140 HYT 119H-18-2-2-2-1-1 HYT 119 H Breeding line 811407
141 HYT 119H-18-3-2-2-2-2 HYT 119 H Breeding line 811411
142 HYT 119H-21-1-3-2-2-1 HYT 119 H Breeding line 811414
143 HYT 123H-13-3-3-1-2-1 HYT 123H Breeding line 811416
144 HYT 124H-3-3-1-1-2-1 HYT 124H Breeding line 811420
145 HYT 128H-8-2-2-2-2-1 HYT 128H Breeding line 811426
146 HYT 128H-11-2-1-1-2-1 HYT 128H Breeding line 811428
147 HYT 130H-3-2-3-1-1-1 HYT 130H Breeding line 811432
148 CASH 1H-1-2-3-1-1-1 CASH 1H Breeding line 811434
149 CASH 1H-4-3-2-1-1-1 CASH 1H Breeding line 811440
150 CASH 1H-34-2-2-2-1-1 CASH 1H Breeding line 811444
151 Hipa Jatim 1H-5-2-2-3-2-1 Hipa Jatim 1 H Breeding line 811446
152 IR68897H-94 B-1-3-3-1-1 IR68897H Breeding line 811448
153 IR101922-BK-KB-2-2-1 Maybelle/PSBRC80 Breeding line 811452
154 IR101922-BK-KB-6-1-1 Maybelle/PSBRC80 Breeding line 811456
155 IR101923-BK-KB-1-2-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811458
156 IR101923-BK-KB-3-2-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811460
157 IR101923-BK-KB-4-2-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811462
158 IR101923-BK-KB-4-3-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811464
159 IR101923-BK-KB-7-1-1 IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1 Breeding line 811466
160 IR101924-BK-KB-2-3-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811468
161 IR101924-BK-KB-7-2-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811470
162 IR101924-BK-KB-10-2-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811472
163 IR101924-BK-KB-11-3-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811474
164 IR101924-BK-KB-14-1-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811476
165 IR101924-BK-KB-14-2-1 IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1 Breeding line 811478
166 IR101933-BK-KB-2-1-1 IR86505-6-4-3-1-1-1-1-1/MingHui63 Breeding line 811480
167 IR101937-BK-KB-3-2-1 IR86505-6-4-3-1-1-1-1-1/IR86612-26-1-1-1-1-2-1-1 Breeding line 811482
168 IR101937-BK-KB-9-3-1 IR86505-6-4-3-1-1-1-1-1/IR86612-26-1-1-1-1-2-1-1 Breeding line 811484
169 KR0301-B-12-1-1-1 OM 052/NSIC RC 238 Breeding line 811485
170 KR0302-B-5-2-2-1 OM 052/Minghui 63 Breeding line 811490
171 KR0302-B-5-3-1-1 OM 052/Minghui 63 Breeding line 811492
172 KR0302-B-14-2-1-1 OM 052/Minghui 63 Breeding line 811496
173 KR0302-B-17-1-3-1 OM 052/Minghui 63 Breeding line 811498
174 KR0302-B-10-2-1-1 OM 052/Minghui 63 Breeding line 811500
175 KR0302-B-10-2-2-1 OM 052/Minghui 63 Breeding line 811502
176 KR0302-B-13-1-1-1 OM 052/Minghui 63 Breeding line 811506
177 GR19-1-8-2-2-1 2A/3m164 Breeding line 811510
178 GR20-1-3-1-1-1 2A/3m170 Breeding line 811512
179 PHB 73H-1-2-3-1-2-1 PHB 73 Breeding line 811514
180 PHB 73H-18-2-2-3-1-1 PHB 73 Breeding line 811522
181 Matibay H-5-3-1-1-1-1 Matibay Breeding line 811526
182 ABp H-20-2-1-1-1-1 Arize Bigante plusH Breeding line 811532
183 ABp H-29-2-1-1-2-1 Arize Bigante plusH Breeding line 811538
184 ABp H-33-2-3-2-1-1 Arize Bigante plusH Breeding line 811540
185 Hipa Jatim 2H-1-3-3-1-2-1 Hipa Jatim 2 H Breeding line 811542
186 HYT 106H-17-2-1-2-1-1 HYT 106H Breeding line 811544
187 HYT 106H-17-2-2-3-2-1 HYT 106H Breeding line 811548
188 HYT 106H-17-2-3-1-2-1 HYT 106H Breeding line 811551
189 HYT 106H-17-3-1-1-1-1 HYT 106H Breeding line 811559
190 HYT 106H-17-3-2-3-2-1 HYT 106H Breeding line 811563
191 HYT 108H-10-2-3-1-3-1 HYT 108H Breeding line 811565
192 Jasponica-4-1-1-2-2-1 SH 9 Breeding line 811569
193 Jasponica-12-1-1-2-3-1 SH 9 Breeding line 811575
194 Jasponica-14-3-1-1-1-1 SH 9 Breeding line 811577
195 Jasponica-15-1-1-1-1-1 SH 9 Breeding line 811583
196 Jasponica-26-1-1-1-3-1 SH 9 Breeding line 811585
197 Jasponica-29-3-1-1-2-1 SH 9 Breeding line 811587
198 Jasponica-40-3-1-1-2-1 SH 9 Breeding line 811599
199 IR24 IRRI Advanced variety 811601
200 IRBB1 IRRI Bacterial Blight 811603
201 IRBB3 IRRI Bacterial Blight 811605
202 IRBB7 IRRI Bacterial Blight 811607
203 IRBB13 IRRI Bacterial Blight 811609
204 IRBB55 IRRI Bacterial Blight 811611
205 IRBB59 IRRI Bacterial Blight 811613
206 Dasan Korea Local variety 810801
207 Hanareum Korea Local variety 810802
208 KR0203H Korea Hybrid rice F1 810803
209 KR0695H Korea Hybrid rice F1 810804
210 KR0696H Korea Hybrid rice F1 810805
211 KR1454H Korea Hybrid rice F1 810806
212 KR1455H Korea Hybrid rice F1 810807
213 KR1354H Korea Hybrid rice F1 810808
214 KR1497H Korea Hybrid rice F1 810809
215 KR1444H Korea Hybrid rice F1 810810
216 KR1487H Korea Hybrid rice F1 810811
217 KR1994H Korea Hybrid rice F1 810812
218 KR2116H Korea Hybrid rice F1 810813
219 KR2117H Korea Hybrid rice F1 810814
220 KR 1B Korea Maintainer 812501
221 KR 1A Korea CGMS 812503
222 KR 2B Korea Maintainer 812526
223 KR 2A Korea CGMS 812528
224 KR 211B Korea Maintainer 812551
225 KR 211A Korea CGMS 812553
226 MingHui 63 China Local variety, Restorer 812571
227 IR75589-31-27-8-33S-5-1 IRRI Breeding line, TGMS 812608
228 IR102100-KB5S2-1-4-1-1-1-1 IRRI Breeding line, TGMS 812618
229 OM052 Vietnam Local variety, Restorer 812636
230 IR102100-KB14-2S2-1-22-2-1-2 IRRI Breeding line, TGMS 812718
231 IR98070-kB14-1-2-3-1-1 IRRI Breeding line 812736
232 IR98229-2-2-1-K1-1-1 IRRI Breeding line 812756
233 IR98229-9-2-1-K1-1-1 IRRI Breeding line 812771
234 IR98229-9-2-1-K1-1-3 IRRI Breeding line 812776
235 IR101861-7-1-K1-1-1 IRRI Breeding line 812786
236 IR98241-24-2-1-k1-1-1 IRRI Breeding line 812806
237 IR98102-kB9-1-1-3-1-1-1 IRRI Breeding line 812821
238 IR102100-KB12S1-1-25-1-1-1-1 IRRI Breeding line, TGMS 812823
239 IR98102-kB21-1-3-1-3-1 IRRI Breeding line 812836
240 IR102452-KB3-1-2-2-1-1 IRRI Breeding line 812851

Gene-specific PCR primers and their primer sequences used for analysis of related genes.

Target Gene Marker name Type Primer sequence (5′→3′) Exspected size (bp) Reference
Genes related to hybrid S5 S5-Indel Fw CCTACGTTTGACTGCCTGCCTG 281/417 Sundaram et al. 2010
Rv CTACACGCGGCTTCGGGAAAGC
Indica-specific SNP Fw GACAGCAGCATCAACGACTTCC 527
Rv TCGTCAGTGGGCAAGCAGTAGCTG
Japonica-specific SNP Fw ACCCTGATATTCTGAGTTACAAGGCATTA 325
Rv GCTCTTGATGTCCGGTGATACC
Rf3 DRRM-RF3-5 Fw GATGGCACAGCTTCAGAACA 120/134 Suresh et al. 2012
Rv CTAATTCTGGGCGAGCAAAG
DRRM-RF3-10 Fw TCACCTCTTCCTGCTTCGAC 180/195
Rv CTCCACCAGTGCAGGTTTTT
Rf4 DRCG-RF4-14 Fw GCAATGCTTGTATTCAGCAAA 845/885 Tang et al. 2014
Rv TCCAGCTGTAAATCCGTCAA
M19280 Fw ATCTGTCCAGACACCATTTTC 147/141
Rv TCCACTGATGAGTGCATTG
Blast Pita YL155/87 Fw AGCAGGTTATAAGCTAGGCC 1042 Jia et al. 2002, 2004
Rv CTACCAACAAGTTCATCAAA
YL183/87 Fw AGCAGGTTATAAGCTAGCTAT
Rv CTACCAACAAGTTCATCAAA
Pib NSb Fw ATCAACTCTGCCACAAAATCC 629 Kwon et al. 2008
Rv CCCATATCACCACTTGTTCCCC
Pi5 JJ817 Fw GATATGGTTGAAAAGCTAATCTCA 1450 Kwon et al. 2008
Rv ATCATTGTCCTTCATATTCAGAGT
Pii JJ113 Fw GGATGATGTGATCTGCAGAG 484 Jeon 2002
Rv CTCTTGGTGATCTTTGTTAC
Bacterial blight (BB) Xa3 BB3-Sus Fw CGGAGCGACACAGCTATCAT 743 Hu et al. 2013
Rv CGTGAGGTTCCCTATGGCGATT
BB3-Re Fw CCACAATGCCATGTCAGGTGGCATCCCTGCA 255 Hu et al. 2013
Rv AGGTGTTGGAGGATTGGCAT
Xa4 RM224 Fw ATCGATCGATCTTCACGAGG 150/120 McCouch et al. 2002
Rv TGCTATAAAAGGCATTCGGG
Xa5 RM122 Fw GCACTGCAACCATCAATGAATC 236/232 Chen et al. 1997
Rv CCTAGGAGAAACTAGCCGTCCA
Xa7 M5 Fw CGATCTTACTGGCTCTGCAACTCTGT 294/1170 Porter et al. 2013
Rv GCATGTCTGTGTCGATTCGTCCGTACGA
Xa13 Xa13prom Fw GGCCATGGCTCAGTGTTTAT 1000/520 Zhang et al. 1996; Singh et al. 2011
Rv GAGCTCCAGCTCTCCAAATG
Xa21 pTA248 Fw AGACGCGGAAGGGTGGTTCCCGGA 1000/750 Huang et al. 1997
Rv AGACGCGGTAATCGAAAGATGAAA
BPH Bph18(t) Bph18(t) SNP23 CGATGGATTACCCTATCACCT CAA HRM Developed in this study
SNP24 AACCCTCTGCACACCATCGG
Tungro virus tsv1 RM6152 Fw GAATTCACCGCTCTCCAGTC 206 Lee et al. 2010
Rv AGGAGGATCTCCTCCAGGAG

List of control varieties used for identification of resistance genes.

Gene Resistant controls Susceptible controls
Xa3 IRBB3 IR24
Xa4 IRBB4 IR24
xa5 IRBB5 IR24
Xa7 IRBB7 IR24
xa13 IRBB13 IR24
Xa21 IRBB21 IR24
Pib IRBL-b LTH
Pita IRBL-ta(K1), IRBL-ta(CT2), IRBL-ta2(Pi) LTH
Pi5, Pii Pi3, Pi5(t), Pii LTH
Bph18(t) Anmi, Anda IR24, Ilpum
tsv1 Utri merah, N22 Nipponbare, TN1

List of eleven hybrid rice breeding lines and their cross combinations used for evaluating agronomic traits and screening disease/insect resistance in the Red River Delta in Vietnam.

F1 entry Cross combination Remark
KR0203H KR2A/Minghui 63 CGMS
KR0695H KR1A/OM052 CGMS
KR0696H KR2A/OM052 CGMS
KR1454H KR1A/MY2R (= KR2R) CGMS
KR1455H KR2A/MY2R (= KR2R) CGMS
KR1354H KR2A/IR98070-KB14-1-2-3-1-1 CGMS
KR1497H IR75589-31-27-8-33S/IR98229-9-2-1-k1-1 TGMS
KR1444H IR75589-31-27-8-33S/IR102452-KB3-1-2-2-1-1 TGMS
KR1487H HYT 108 S8-1-25-2/IR98102-kB9-1-1-3-1-1 TGMS
KR1994H IR75589-31-27-8-33S/Minghui 63 TGMS
KR2116H IR102100-KB12S2-1-19-1/IR98102-kB21-1-3-1-3-1 TGMS

Identification patterns of disease and insect resistant genes in eleven hybrid rice combinations.

Entry Bacterial Blight No. of R genes Blast No. of R genes Bph 18(t) tsv1 Total of R genes


Xa3S Xa3R Xa4 xa5 Xa7 xa13 Xa21 Pi-ta Pib Pii Pi5
KR0203H + +/− 0 + + + + 3 +/− 3
KR0695H 0 + + + + 3 +/− 3
KR0696H + 0 + + + + + 4 +/− 4
KR1454H + + 1 + + + + 3 4
KR1455H + + 1 + + + + 3 4
KR1354H + + +/− 1 + + + + 3 +/− 4
KR1497H + + 1 + + + + + 4 5
KR1444H + 0 + + + + + 4 4
KR1487H + +/− 0 + + + 2 2
KR1994H +/− 0 + + + + 4 4
KR2116H + + +/− +/− 1 + + + + + 4 + 6

To get the whole information of 240 genetic resources and hybrid rice combinations, please see Supplementary Table S1.

Relative levels of resistance on hybrid rice combinations and control varieties upon inoculation separately by disease and insect in the Red River Delta region in Vietnam.

Entryz) Brown Planthopper Blast Bacterial Blight



6 DARy) 8 DAR 28 DAI 35 DAIy) 42 DAI





Score Reaction Score Reaction Score Reaction Score Reaction Score Reaction
KR0203H 6.0 MSx) 8.0 S 0.0 HR 1.0 HR 5.0 MS
KR0695H 7.0 S 9.0 HS 0.0 HR 0.0 HR 1.0 HR
KR0696H 6.0 MS 9.0 HS 0.0 HR 0.0 HR 3.0 R
KR1454H 5.0 MS 8.0 S 0.0 HR 0.0 HR 3.0 R
KR1455H 6.0 MS 8.0 S 0.0 HR 0.0 HR 3.0 R
KR1354H 7.0 S 8.0 S 1.0 HR 1.0 HR 3.0 R
KR1497H 4.0 MR 8.0 S 0.0 HR 0.0 HR 1.0 HR
KR1444H 7.0 S 9.0 HS 0.0 HR 0.0 HR 3.0 R
KR1487H 4.0 MR 9.0 HS 1.5 HR 2.0 HR 3.0 R
KR1994H 3.0 R 6.0 MS 4.0 MR 5.0 MS 0.0 HR
KR2116H 5.0 MS 9.0 HS 0.0 HR 1.0 HR 1.0 HR
BTP 33 1.0 R 1.0 R - - - - - -
TN 1 9.0 HS 9.0 HS - - - - - -
OM 1490 - - - - 9.0 HS 9.0 HS 5.0 MS

z)All of hybrid rice breeding lines, KR0203H to KR2116H, were in generation of F1.

y)DAR: Days after release, DAI: Day after inoculation.

x)HR: Highly resistance, R: Resistance, MR: Medium resistance, MS: Medium susceptible, S: Susceptible, HS: Highly susceptible.

Agronomic traits and yields of F1 hybrid combinations with disease/insect resistantance genes introduced by MAS and control varieties.

Entry HD (mm.dd) GP (day) PH (cm) PL (cm) PET (%) PRG (%) GW (g) Yield (tonne/ha)
KR0203H 5.18 121 114.5 29.4 64.8 78.1 27.0 10.1
KR0695H 5.15 119 122.6 27.5 74.0 65.2 26.5 11.8
KR0696H 5.15 119 122.9 27.9 75.3 71.8 27.0 11.1
KR1454H 5.19 123 118.2 27.4 71.7 68.4 26.0 9.7
KR1455H 5.18 122 114.4 27.4 72.6 73.8 26.4 9.6
KR1354H 5.19 126 113.6 31.1 71.5 69.9 26.4 10.7
KR1497H 5.15 119 111.6 28.3 76.2 88.5 26.2 10.0
KR2116H 5.15 122 113.8 29.0 83.6 68.5 26.1 10.3
IIA838 5.12 113 118.3 28.1 79.3 90.4 30.3 14.6
BC15 5.16 115 112.8 28.1 69.8 74.3 22.1 9.1

HD: Heading date, GP: Growing period, PH: Plant height, PL: Panicle length, PET: Percent effective tillers, PRG: Percent ripened grain, GW: 1000-grain weight.

Table 1 List of 240 genetic resources and hybrid rice combinations used in this study.
Table 2 Gene-specific PCR primers and their primer sequences used for analysis of related genes.
Table 3 List of control varieties used for identification of resistance genes.
Table 4 List of eleven hybrid rice breeding lines and their cross combinations used for evaluating agronomic traits and screening disease/insect resistance in the Red River Delta in Vietnam.
Table 5 Identification patterns of disease and insect resistant genes in eleven hybrid rice combinations.

To get the whole information of 240 genetic resources and hybrid rice combinations, please see Supplementary Table S1.

Table 6 Relative levels of resistance on hybrid rice combinations and control varieties upon inoculation separately by disease and insect in the Red River Delta region in Vietnam.

All of hybrid rice breeding lines, KR0203H to KR2116H, were in generation of F1.

DAR: Days after release, DAI: Day after inoculation.

HR: Highly resistance, R: Resistance, MR: Medium resistance, MS: Medium susceptible, S: Susceptible, HS: Highly susceptible.

Table 7 Agronomic traits and yields of F1 hybrid combinations with disease/insect resistantance genes introduced by MAS and control varieties.

HD: Heading date, GP: Growing period, PH: Plant height, PL: Panicle length, PET: Percent effective tillers, PRG: Percent ripened grain, GW: 1000-grain weight.