Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Overexpression of S-Adenosylmethionine Synthetase Gene from Pyropia tenera Enhances Tolerance to Abiotic Stress

Plant Breeding and Biotechnology 2017;5(4):304-313.
Published online: December 1, 2017

Department of Genetic Resources Research, National Marine Biodiversity Institute of Korea, Seocheon 33662, KoreaJFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

*Corresponding author: Jong Won Han, jwhan@mabik.re.kr, Tel: +82-41-950-0760, Fax: +82-41-950-0765
• Received: November 1, 2017   • Revised: November 9, 2017   • Accepted: November 10, 2017

Copyright © 2017 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 6 Views
  • 0 Download
  • 1 Crossref
prev next
  • Pyropia tenera is an intertidal red alga of commercial significance owing to its popularity as a health-promoting seafood product. This alga grows in marine environments and is frequently exposed to high salinity and osmotic stress, which impact its growth. Therefore, the enhancement of stress tolerance in P. tenera is critical. In the present work, we aimed to elucidate the mechanisms underlying abiotic stress tolerance in this species; specifically, we identified the P. tenera S-adenosylmethionine synthetase-encoding gene (PtSAMS) and characterized its biological function. This gene, which is known to play a role in stress tolerance in other plants, was cloned and overexpressed in Escherichia coli under high-salinity conditions. The PtSAMS gene was found to encode a 385-amino-acid protein with a molecular weight of 41.8 kDa. In silico sequence alignment and phylogenetic analysis of the PtSAMS amino acid sequence showed that the encoded protein comprises three conserved domains and two motifs that are highly conserved in other plants. Growth assay results indicated that PtSAMS-overexpressing E. coli cells exhibit enhanced tolerance to salt stress. The results suggest that PtSAMS expression is induced by a combination of ion toxicity and osmotic stress resulting from exposure to high salinity in marine environments, and that this gene is expressed at housekeeping levels owing to growth in such conditions. The findings suggest that PtSAMS could be used as a potentially valuable bioresource with utility in the genetic engineering of salt stress-tolerant crop plants.
Algae have been consumed as edible seaweed in Asia for thousands of years. Pyropia (Rhodophyta) have been cultivated since the 17th century in Korea, Japan, and China and represent commercially valuable seafood. Pyropia, which is highly popular owing to its delicious taste, contains high levels of protein and is rich in essential amino acids and vitamins (Blouin et al. 2011). The market for Pyropia is worth about 7 trillion, and its exports have experienced recent growth. It expected that the Pyropia market size would continue to increase as a result of its recognition as a health-beneficial food product.
The environment in which seaweed is cultivated is exposed to harsh marine conditions. Aquaculture productivity is affected by temperature, rainfall, laver disease, and other factors. Therefore, the identification of rapidly growing or disease-resistant seaweed species is critical.
Salinity is one of the major abiotic factors that limit crop growth and productivity. Salt stress results in excessive ion toxicity, oxidative stress, and physiological drought, consequently causing disruption of cell organelles and their metabolism, eliciting nutrient imbalance in the plant, and reducing its osmotic potential (Tester and Bacic 2005). These effects lead to arrest of growth and development of the plant, thereby limits its survival.
S-Adenosylmethionine synthetase (SAMS) catalyzes the conversion of adenosine 5′-triphosphate (ATP) and methionine into S-adenosylmethionine (SAM) (Pajares and Markham 2011). SAM plays a central role in diverse biological processes, such as by serving as a methyl donor during transmethylation in plants, and acting as a common precursor in the biosynthesis of polyamines and ethylene (Kumar et al. 1997; Roeder et al. 2009). The SAMS-encoding gene has been cloned from various species such as bacteria, yeasts, humans, animals, and plants. In plants, SAMS has been reported to play a role in developmental process and the stress response (Pulla et al. 2009). In Arabidopsis thaliana, the SAMS gene plays a role in seed germination, as shown in a previous study of MTO3 mutants that showed delayed germination and high level concentration of methionine phenotype Knockdown of the SAMS gene resulted in delayed flowering time and dwarf phenotype in rice (Boerjan et al. 1994; Li et al. 2011). Expression of SAMS is induced under low temperature in Arabidopsis, rice, and maize (Cui et al. 2005; Amme et al. 2006; Yang et al. 2006; Uvackova et al. 2012). Pisum sativum SAMS1 is expressed during pea development (Gómez-Gómez and Carrasco 1998). Overexpression of the stress-inducible gene GsSAMS2 enhances salt tolerance in transgenic Medicago sativa (Hua et al. 2012). Suaeda salsa inhabits saline or alkaline soil such as coastal salt-flats. Recently, overexpression of S. salsa SAMS was shown to increase salt tolerance in transgenic tobacco (Qi et al. 2010). Although Porphyra yezoensis SAMS (PySAMS) has been cloned (Yi et al. 2009), its function is still unknown.
Here, we reported the cloning and characterization of the SAMS (PtSAMS) gene in Pyropia tenera. In order to elucidate the function of PtSAMS, we additionally examined the expression of PtSAMS in E. coli under stress conditions. Functional analysis in E. coli suggested that PtSAMS plays a role in the tolerance to stress.
Plant materials
The P. tenera strain used in this study was received from the Seaweed Research Center, National Research & Development Institute. P. tenera was cultured at 10°C in a growth chamber with bubbling under 50 μmol·m2s1 and a photoperiod of 12 hour light and 12 hour dark. The culture media used was Provasoli’s enrichment solution (PES); the media were changed every week (Kakinuma et al. 2016).
RNA extraction, reverse transcription, and isolation of PtSAMS gene
The PtSAMS sequence was obtained by performing a search of the NCBI (National Center of Biotechnology Information) database, based on the sequence of Porphyra yezoensis S-adenosylmethionine synthetase (SAMS) gene. Total RNA was extracted from P. tenera with Hybrid-R (GeneAll, Seoul, Korea) according to the manufacturer’s guide. The first-strand cDNA was synthesized using amfiRivert cDNA Synthesis Platinum Master Mix (GenDEPOT, Texas, US). The full-length PtSAMS gene was isolated through RT-PCR using the PtSAMS-F (5′-CACCATGGCAGCCATGAAG-3′) and PtSAMS-R (5′-ACGACGCTCTAGAGCTCAC-3′) primers based on the P. yezoenesis sequence (GenBank accession: FJ404748) (Table 1).
Cloning of PtSAMS gene into the pET28(b) expression vector and recombinant protein expression
PtSAMS was amplified by PCR using the PtSAMS-NdeI-F (5′-CCCCATATGGCAGCCATGAAGA-3′) and PtSAMS-XhoI-R (5′-TCACTCGAGGAGCTCAAGC-3′) primers with flanking restriction sites of NdeI and XhoI, respectively (Table 1). The PCR product was digested with NdeI and XhoI restriction endonucleases and cloned into pET28(b). The pET28(b)-PtSAMS plasmid was transformed into the E. coli strain BL21(DE3). The pET28(b) empty vector was used as a control in spot assay and liquid growth assay of stress treatment (Yadav et al. 2012).
Sequence analysis
PtSAMS and protein sequences of other SAMS of different species were searched in the NCBI database. Amino acid alignments were conducted using the ClustalW algorithm implemented in BioEdit (Thompson et al. 1994). The phylogenetic tree of the SAMS protein was constructed using the Geneious software 9.0.4. using a neighbor-joining (NJ) method with bootstrap set at 10,000 replicates.
Southern blot analysis
Genomic DNA was isolated from P. tenera using the DNeasy Plant Maxi-prep Kit (Qiagen, Hilden, Germany). Genomic DNA (5 μg) was digested with BamHI and KpnI, separated on 0.7% agarose gel, and transferred to Hybond-N+ membrane. The membrane was treated by UV crosslinking to fix the genomic DNA. Probe DNA was prepared by PCR for a specific region of PtSAMS. The gene-specific primers used were PtSAMS-303-F (5′-CCAGTCCCCTGAGATTGCTG-3′) and PtSAMS-955-R (5′-CTGAAATCGGCTCGGCAATG-3′) (Table 1). Probe labeling with dioxigenin (DIG), hybridization, and detection were carried out using the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche, Basel, Switzerland) according to the manufacturer’s instructions.
Quantitative RT-PCR analysis
cDNA from P. tenera was used as a template for qRT-PCR using PtSAMS gene-specific primers PtSAMS-303-F and PtSAMS-955-R. Real time qPCR was performed using the Takara PCR system with a SYBER GREEN KIT (Takara, Shiga, Japan). PCR conditions were as follows: 94°C for 2 minutes, 40 cycles at 94°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds, and a final extension at 72°C for 10 minutes. The experiments were repeated three times independently. The PtGAPDH gene was used as an internal control under the same conditions. Primer sequences were as follows: PyGAPDH-2771-F (5′-CGCC GAGTACATTGTCGAGT-3′) and PyGAPDH-3002-R (5′-GTACTTCTCGTGCAGCACCT-3′) (Lee et al. 2015) (Table 1).
Spot culture assay for analysis of the effects of stress treatment
pET28(b)-PtSAMS/BL21(DE3) cells were grown in LB medium to OD600 = 0.6, and 0.1 mM IPTG was added (Yadav et al. 2012). The inducted cells were grown for 5 hours at 37°C. The cultured cells were dil0uted to an OD600 of 0.6, and then to 103, 104, and 105. Ten micro liters from each dilution was spotted on to an LB-only plate, or an LB plate supplemented with 400 mM NaCl and 400 mM KCl. The experiments were repeated three times independently.
Liquid culture assay under stress treatment
Growth rate analysis was tested in LB liquid medium or in LB medium supplemented with NaCl and KCl. Then, 400 μL of pET28(b)-PtSMAS recombinant or vector alone in E. coli BL21 cells were inoculated into 10 mL of LB liquid medium for overnight culture. The next day, the cultured cells were diluted to an OD600 of 0.6 and 0.1 mM IPTG was added for induction. Cells were grown for 5 hours at 37°C and then were diluted to OD600 of 0.6. Next, 500 μL of cells were inoculated into 50 mL of LB medium containing 400 mM NaCl, and 400 mM KCl, or LB medium only, and cultured at 37°C. Cells were harvested every 1 hour, until 12 hours, and OD600 values were measured.
Isolation and characterization of PtSAMS
To isolate the PtSAMS, we designed primer sets based on the P. yezoensis sequence (Accession number: FJ404748) in the NCBI GenBank sequence database (Table 1). The PtSAMS gene was cloned from the cDNA library by PCR and sequenced (data not shown). Sequence analysis showed that the complete open reading frame of PtSAMS is 1,155 bp in length, and is composed of one exon. The predicted PtSAMS protein comprises 385 amino acid residues with a calculated molecular weight of 41.8 kDa and isoelectric point (PI) of 5.60.
Sequence analysis and phylogenetic analysis of PtSAMS
To further characterize the PtSAMS protein, we performed a conserved domain (CD) analysis through the GenomeNet Database Resources (http://www.genome.jp/tools/motif/). The predicted PtSAMS protein consisted of three S-adenosylmethionine synthetase N-terminal, central, and C-terminal domains. Furthermore, the predicted PtSAMS sequence contained two substrate-binding sites, as well as a site for ATP binding in the central domain and for Met binding in the C-terminal domain (Fig. 1a). The BioEdit software was used for comparison of the amino acid sequence of PtSAMS with SAMS from other representative Rhodophyta, Phaeophyta, and Chlorophyta (Fig. 1a). The results showed that PtSAMS shared higher homology with SAMS from plant species such as Galdieria sulphuraria (76%), Ectocarpus siliculosus (70%), Chlamydomonas reinhardtii (69%), and A. thaliana (66%). To investigate the evolutionary relationship of PtSAMS protein among SAMS proteins of other species, a phylogenetic tree was constructed using Geneious 9.0.4 software on the basis of the multiple amino acid sequences (Fig. 1b). GenBank accession numbers of the protein sequences are shown in Table 2. Phylogenetic tree analysis revealed that the PtSAMS of Bangiophyceae was grouped with red algae, showing the highest degree of clustering with Rhodophyta, Galdieria sulphuraria, and then with SAMS of diatoms and Phaeophyta, followed by Chlorophyta. Table 3 shows pairwise comparison of the amino acid sequences between PtSMAS and other species. The SAMS sequence was found to be highly conserved among all the different species.
Southern blot and expression analysis of PtSAMS at different phases of the life cycle
To determine the copy number of SAMS in the P. tenera genome, genomic DNA of P. tenera was digested with restriction endonucleases BamHI and KpnI; then, Southern blot analysis was performed. After transferring to a membrane, the separated genomic DNA was hybridized to DIG-labeled PtSAMS gene-specific probe. Southern blot analysis result clearly showed that the PtSAMS gene was present as a single copy in P. tenera (Fig. 2). To examine the expression levels of PtSAMS transcripts at different life cycles, qPCR analysis was performed (Fig. 3). Total RNA was isolated from the conchocelis and thallus of P. tenera. The relative mRNA expression level in the thallus was higher than that in conchocelis by approximately three folds.
Expression analysis of recombinant PtSAMS protein in E. coli by SDS-PAGE
The complete ORF of the PtSAMS gene was cloned into a pET28(b) vector and expressed in the E. coli strain BL21(DE3). The empty pET28(b) vector was used as a control in this experiment. Expression of the recombinant PtSAMS protein was induced by adding 0.1 mM IPTG after 1 hour; this reached a maximum at 7 hours (Fig. 4a). To confirm the production of His tag-fused PtSAMS, western blot analysis was carried out using anti-His (Fig. 4b). The theoretical molecular weight of the recombinant PtSAMS was about 44.0 kDa.
Growth of PtSAMS-expressing E. coli under abiotic stress
To examine the effect of the overexpression of the PtSAMS protein in E. coli under various abiotic stresses, the recombinant cells were spotted on LB medium supplemented with NaCl and KCl (Fig. 5). The pET28(b)-PtSAMS and pET28(b) cells showed similar growth on LB medium in overnight grown culture (Fig. 5a). The pET28(b)-PtSAMS recombinant cells showed increased number of colonies in NaCl and KCl treatment compared with that in control cells (Fig. 5b and 5c). In addition, the growth rate of recombinant cells was analyzed in LB liquid medium. pET28(b)-PtSAMS recombinant and pET28(b) empty vector control BL21(DE3) cells were inoculated into fresh LB liquid medium and medium supplemented with NaCl and KCl. In LB liquid medium, pET28(b)-PtSAMS recombinant cell and cells harboring the pET28(b) vector alone showed similar growth at various times. In the NaCl- and KCl-treatment treatment, pET28(b)-PtSAMS recombinant cells showed better growth compared with cells harboring the vector alone 6 hours after inoculation (Fig. 6). Therefore, the spot and liquid culture assay indicated a similar pattern between the groups in terms of the abiotic stress response.
Pyropia grows in high intertidal zones where this plant experiences environmental conditions such as desiccation, salinity fluctuations, intense radiation, and high temperatures; additionally, Pyropia is regularly submerged in seawater and exposed to air during high and low tides (Xu et al. 2017). This plant has developed mechanisms to resist salt stress and survive under severe conditions. However, the molecular mechanisms underlying the salt stress tolerance in Rhodophyta are not fully understood. In this study, we attempted to isolate the salt stress gene in seaweed by cloning the S-Adenosyl-l-methionine synthetase (SAMS) gene from P. tenera; this gene was referred to as PtSAMS. S-Adenosyl-L-methionine synthase synthesizes S-adenosyl-L-methionine (AdoMet) from L-methionine and ATP in both prokaryotes and eukaryotes (Boerjan et al. 1994). In silico sequence alignment and phylogenetic analysis of amino acid sequence showed that PtSAMS comprises three conserved domains: the N-terminal domain, central domain, and C-terminal domain (Fig. 1a). Furthermore, PtSAMS contains two motifs, Met-binding and ATP-binding sites, that are highly conserved in other plants. In the phylogenetic tree based on amino acid sequences of different SAMS proteins, PtSAMS was clustered with the SAMS from G. sulphuraria, Rhodophyta (Fig. 1b). Taken together, these results suggest that PtSAMS from P. tenera is a member of the red algae SAMS family. Further, we identified the presence of a single copy of the SAMS gene in the Pyropia genome by DNA gel blot analysis (Fig. 2). To examine PtSAMS expression at various stages of the life cycle, RT-qPCR amplification of DNA from the conchocelis and thallus of P. tenera was performed (Fig. 3). The relative mRNA expression level of PtSAMS in the thallus was higher than in the conchocelis. However, the expression level did not differ under exposure to abiotic stresses in the thallus (data not shown). As Pyropia inhabits sea water, this organism is exposed to environmental stresses such as high salt levels and drought, and is therefore adapted for growth and survival in the marine environment (Xu et al. 2017). It is therefore possible that the expression of the PtSAMS gene is maintained at the level of a housekeeping gene owing to the constant exposure to such growing conditions.
Salinity stress is an important environmental factor that limits plant growth and development. SAM acts as a universal methyl group donor in biological processes during numerous specific trimethylations of protein, lipids, polysaccharides, and nucleic acids (Li et al. 2011). SAM additionally serves as precursor for polyamine biosynthesis (Evans and Malmberg 1989). The plant hormone, ethylene, is synthesized from SAM and participates in various physiological processes such as the stress response (Wang et al. 2002; Wang et al. 2013). SAMS is expressed in various tissues in other plant species (Li et al. 2011): in rice, the SAMS gene regulates ethylene-mediated inhibition of root development and alteration of cell wall structures (Fukuda et al. 2007). SAMS expression is associated with the mechanism underlying tolerance of plants to abiotic stresses; it has been shown that transgenic SAMS-expressing plants show enhanced resistance to abiotic stresses. In tomato, SAMS were differentially expressed after application with salt stress (Espartero et al. 1994). Overexpression of SAMS in M. sativa resulted in enhanced tolerance to cold stress by accelerating polyamine oxidation (Guo et al. 2014). In addition, the levels of three SAMS transcripts were increased transiently following the application of various stresses in Catharanthus roseus; in particular, a high degree of accumulation of SAM2 transcripts was observed (Schroder et al. 1997). Taken together with the results of previous studies, the present findings suggest that the expression of the SAMS gene maybe induced by a combination of ion toxicity and osmotic stress during exposure to salt stress.
E. coli growth assay results showed that pET8(b)-PtSAMS recombinant E. coli cells showed better tolerance to salt stress than cells harboring the control vector (Fig. 5). Similar to our results, previous studies have reported that the expression of stress-induced genes enhances tolerance to various stresses in other plants. Overexpression of Lycoris radiata SAMS recombinant protein was induced effectively under high salinity (NaCl and KCl) compared with that in control samples (Li et al. 2013; Cui et al. 2005). Ma et al. (2003) found that the expression of the SAMS gene from Suaeda salsa is induced under NaCl stress (Ma et al. 2003). Recently, it has been reported that the AvSAMS gene confers aluminum stress tolerance and facilitates epigenetic gene regulation (Ezaki et al. 2016). SAMS is therefore known to play roles in various plant defense systems. The present results indicate that PtSAMS maybe plays an important role in salt tolerance. This gene therefore suggests a potential bioresource for the genetic engineering of abiotic stress tolerance in plants.
This work was supported by a grant from the National Marine Biodiversity Institute Research Program (2017M 01300).
Fig. 1
Amino acid sequence alignment of PtSAMS homologs and phylogenetic tree of SAMS from various species. (a) Comparison of amino acid sequences of Pyropia tenera SAMS with the SAMS of other species: Galdieria sulphuraria (XP_005703068.1), Ectocarpus siliculosus (CBJ30117.1), Chlamydomonas reinhardtii (XP_001696661.1), and Arabidopsis thaliana (NP_171751.1); identical residues are shaded black, and similar residues are shaded gray. The domains are indicated by underlining. Met-binding motifs are indicated by boxes. Dotted boxes indicate ATP-binding sites. (b) Phylogenetic tree analysis using Geneious software using Jukes Cantor, Neighbor Joining tree building method with a 10,000 bootstrap repeat value.
pbb-05-304f1.jpg
Fig. 2
Southern blot analysis of P. tenera genomic DNA: 5 μg of genomic DNA per lane was digested with restriction enzymes and separated by electrophoresis in a 0.7% agarose gel. The DNA was transferred to a nylon membrane and probed with a DIG-labeled PtSAMS cDNA fragment. Molecular size markers are indicated on the left.
pbb-05-304f2.jpg
Fig. 3
Expression pattern analysis of PtSAMS at different life cycle stages in P. tenera: Total RNA was isolated from conchocelis and thallus of P. tenera at various life stages. The mRNA expression level of the conchocelis stage was set to 1. PtGAPDH was used as normalization control. The results are presented as average values with SD using each three times.
pbb-05-304f3.jpg
Fig. 4
SDS-PAGE and western blot analysis of PtSAMS recombinant protein in E. coli BL21(DE3). (a) SDS-PAGE analysis. M: marker, Lane 1: uninduced protein, Lane 2–4: induced protein by 0.1 mM IPTG for 1, 3, 5 (hour), respectively. (b) Analysis of expression of recombinant PtSAMS protein in E. coli BL21(DE3) cells; western blotting analysis of the PtSAMS recombinant proteins with anti-His tag antibodies. Arrows indicate the His-tagged PtSAMS recombinant protein.
pbb-05-304f4.jpg
Fig. 5
Spot assay of pET28(b) and pET28(b)-PtSAMS recombinant protein in E. coli cells with NaCl and KCl treatment; 10 μL from 103 to 105 dilution series were spotted on (a) control (LB-only) plate, or (b) LB plate supplemented with 400 mM NaCl, and (c) 400 mM KCl.
pbb-05-304f5.jpg
Fig. 6
Growth analysis of pET28(b) and pET28(b)-PtSAMS recombinant protein in E. coli cells on liquid medium with NaCl and KCl treatment; (a) LB medium, (b) 400 mM NaCl, and (c) 400 mM KCl. OD600 was recored at 1 hour interval up to 12 hours and mean values are represented in graph.
pbb-05-304f6.jpg
Table 1
Gene specific primers used in the study.
Table 1
Name Sequence (5′-3′) Purpose
PtSAMS-F CACCATGGCAGCCATGAAG For full length of PtSAMS gene
PtSAMS-R ACGACGCTCTAGAGCTCAC For full length of PtSAMS gene
PtSAMS-NdeI-F CCCCATATGGCAGCCATGAAGAz) For protein expression
PtSAMS-XhoI-R TCACTCGAGGAGCTCAAGCz) For protein expression
PtSAMS-303-F CCAGTCCCCTGAGATTGCTG Probe for southern blot analysis
PtSAMS-955-R CTGAAATCGGCTCGGCAATG Probe for southern blot analysis
PtSAMS-406-F GAGGACCTGATGCCCTTGAC RT-qPCR
PtSAMS-591-R CTGCGTGCTGATGACAATCG RT-qPCR
PtGAPDH-2771-F CGCCGAGTACATTGTCGAGT RT-qPCR
PtGAPDH-3002-R GTACTTCTCGTGCAGCACCT RT-qPCR

z)Bold letters indicate restriction enzyme sites.

Table 2
GenBank and NCBI reference sequence accession numbers of SAMS sequences.
Table 2
Species Amino acid sequence length NCBI reference sequence
Rhodophyta Pyropia yezoensis 384 ACJ98094.1
Galdieria sulphuraria 393 XP_005703068.1
Phaeophyta Ectocarpus siliculosus 397 CBJ30117.1
Undaria pinnatifida 397 AEK80411.1
Chlorophyta Ostreococcus tauri 386 XP_003083240.1
Chlamydomonas reinhardtii 390 XP_001696661.1
Arabidopsis thaliana 393 NP_171751.1
Oryza sativa 396 AAT94053.1
Diatoms Thalassiosira pseudonana 450 XP_002288884.1
Fistulifera solaris 384 GAX17078.1
Bacterial Escherichia coli 384 AAA24164.1
Table 3
Amino acid sequence identity matrix comparison of PtSMAS with SAMS of other species.
Table 3
PtSAMS GsSAMS CrSAMS EsSAMS AtSAMS
PtSAMS 100% 76.84% 70% 69.6% 66.75%
GsSAMS 100% 69.77% 68.91% 67.59%
CrSAMS 100% 65.92% 81.14%
EsSAMS 100% 64.25%
AtSAMS 100%
  • Amme S, Matros A, Schlesier B, Mock HP. 2006. Proteome analysis of cold stress response in Arabidopsis thaliana using DIGE-technology. J Exp Bot. 57: 1537-1546.
  • Blouin NA, Brodie JA, Grossman AC, Xu P, Brawley SH. 2011. Porphyra: a marine crop shaped by stress. Trends Plant Sci. 16: 29-37.
  • Boerjan W, Bauw G, Van Montagu M, Inze D. 1994. Distinct phenotypes generated by overexpression and suppression of S-adenosyl-L-methionine synthetase reveal developmental patterns of gene silencing in tobacco. Plant Cell. 6: 1401-1414.
  • Cui S, Huang F, Wang J, Ma X, Cheng Y, Liu J. 2005. A proteomic analysis of cold stress responses in rice seedlings. Proteomics. 5: 3162-3172.
  • Espartero J, Pintor-Toro JA, Pardo JM. 1994. Differential accumulation of S-adenosylmethionine synthetase transcripts in response to salt stress. Plant Mol Biol. 25: 217-227.
  • Evans JM, Malmberg RL. 1989. Do polyamines have roles in plant develoiment? Annu Rev Plant Physiol Plant Mol Biol. 40: 235-269.
  • Ezaki B, Higashi A, Nanba N, Nishiuchi T. 2016. An S-adenosyl methionine synthetase (SAMS) gene from Andropogon virginicus L. confers aluminum stress tolerance and facilitates epigenetic gene regulation in Arabidopsis thaliana. Front Plant Sci. 7: 1627
  • Fukuda T, Saito A, Wasaki J, Shinano T, Osaki M. 2007. Metabolic alterations proposed by proteome in rice roots grown under low P and high Al concentration under low pH. Plant Sci. 172: 1157-1165.
  • Gómez-Gómez L, Carrasco P. 1998. Differential expression of the S-adenosyl-L-methionine synthase genes during pea development. Plant Physiol. 117: 397-405.
  • Guo Z, Tan J, Zhuo C, Wang C, Xiang B, Wang Z. 2014. Abscisic acid, H2O2 and nitric oxide interactions mediated cold-induced S-adenosylmethionine synthetase in Medicago sativa subsp. falcata that confers cold tolerance through up-regulating polyamine oxidation. Plant Biotechnol J. 12: 601-612.
  • Hua Y, Zhang BX, Cai H, Li Y, Bai X, Ji W, Wang ZY, Zhu YM. 2012. Stress-inducible expression of GsSAMS2 enhances salt tolerance in transgenic Medicago sativa. African Journal of Biotechnology. 11: 4030-4038.
  • Kakinuma M, Nakamoto C, Kishi K, Coury DA, Amano H. 2017. Isolation and functional characterization of an ammonium transporter gene, PyAMT1, related to nitrogen assimilation in the marine macroalga Pyropia yezoensis (Rhodophyta). Mar Environ Res. 128: 76-87.
  • Kumar A, Taylor M, Altabella T, Tiburcio AF. 1997. Recent advances in polyamine research. Trends Plant Sci. 2: 124-130.
  • Lee MK, Kim IH, Choi YH, Choi JW, Kim YM, Nam TJ. 2015. The proliferative effects of Pyropia yezoensis peptide on IEC-6 cells are mediated through the epidermal growth factor receptor signaling pathway. Int J Mol Med. 35: 909-914.
  • Li W, Han Y, Tao F, Chong K. 2011. Knockdown of SAMS genes encoding S-adenosyl-l-methionine synthetases causes methylation alterations of DNAs and histones and leads to late flowering in rice. J Plant Physiol. 168: 1837-1843.
  • Li XD, Xia B, Wang R, Xu S, Jiang YM, Yu FB, Peng F. 2013. Molecular cloning and characterization of S-adenosylmethionine synthetase gene from Lycoris radiata. Mol Biol Rep. 40: 1255-1263.
  • Ma X, Wang Z, Qi Y, Zhao Y, Zhang H. 2003. Isolation of s-adenosylmethionine synthetase gene from Suaeda salsa and its differential expression under NaCl stress. Acta Botanica Sinica. 45: 1359-1365.
  • Pajares MA, Markham GD. 2011. Methionine adenosyl-transferase (s-adenosylmethionine synthetase). Adv Enzymol Relat Areas Mol Biol. 78: 449-521.
  • Pulla RK, Kim YJ, Parvin S, Shim JS, Lee JH, Kim YJ, In JG, Senthil KS, Yang DC. 2009. Isolation of S-adenosyl-L-methionine synthetase gene from Panax ginseng C.A. meyer and analysis of its response to abiotic stresses. Physiol. Mol. Biol. Plants. 15: 267-275.
  • Qi YC, Wang FF, Zhang H, Liu WQ. 2010. Overexpression of suadea salsa S-adenosylmethionine synthetase gene promotes salt tolerance in transgenic tobacco. Acta Physiologiae Plantarum. 32: 263-269.
  • Roeder S, Dreschler K, Wirtz M, Cristescu SM, van Harren FJ, Hell R, Piechulla B. 2009. SAM levels, gene expression of SAM synthetase, methionine synthase and ACC oxidase, and ethylene emission from N. suaveolens flowers. Plant Mol Biol. 70: 535-546.
  • Schroder G, Eichel J, Breinig S, Schroder J. 1997. Three differentially expressed S-adenosylmethionine synthetases from Catharanthus roseus: molecular and functional characterization. Plant Mol Biol. 33: 211-222.
  • Tester M, Bacic A. 2005. Abiotic stress tolerance in grasses. From model plants to crop plants. Plant Physiol. 137: 791-793.
  • Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680.
  • Uvackova L, Takac T, Boehm N, Obert B, Samaj J. 2012. Proteomic and biochemical analysis of maize anthers after cold pretreatment and induction of androgenesis reveals an important role of anti-oxidative enzymes. J Proteomics. 75: 1886-1894.
  • Wang F, Cui X, Sun Y, Dong CH. 2013. Ethylene signaling and regulation in plant growth and stress responses. Plant Cell Rep. 32: 1099-1109.
  • Wang KL, Li H, Ecker JR. 2002. Ethylene biosynthesis and signaling networks. Plant Cell. 14: Suppl. S131-151.
  • Xu K, Xu Y, Ji D, Chen T, Chen C, Xie C. 2017. Cells tile a flat plane by controlling geometries during morphogenesis of Pyropia thalli. PeerJ. 5: e3314
  • Yadav NS, Rashmi D, Singh D, Agarwal PK, Jha B. 2012. A novel salt-inducible gene SbSI-1 from Salicornia brachiata confers salt and desiccation tolerance in E coli. Mol Biol Rep. 39: 1943-1948.
  • Yang PF, Li XJ, Liang Y, Jing YX, Shen SH, Kuang TY. 2006. Proteomic analysis of the response of Liangyoupeijiu (super high-yield hybrid rice) seedlings to cold stress. J Integr Plant Biol. 48: 945-951.
  • Yi LF, Wang P, Zhou X, Liu C. 2009. cDNA cloning and bioinformatic analysis of SAMS gene from Porphyra yezoensis. China Biotechnology. 29: 43-49.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Overexpression of S-Adenosylmethionine Synthetase Gene from Pyropia tenera Enhances Tolerance to Abiotic Stress
Plant Breed. Biotech.. 2017;5(4):304-313.   Published online December 1, 2017
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Overexpression of S-Adenosylmethionine Synthetase Gene from Pyropia tenera Enhances Tolerance to Abiotic Stress
Plant Breed. Biotech.. 2017;5(4):304-313.   Published online December 1, 2017
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
Overexpression of S-Adenosylmethionine Synthetase Gene from Pyropia tenera Enhances Tolerance to Abiotic Stress
Image Image Image Image Image Image
Fig. 1 Amino acid sequence alignment of PtSAMS homologs and phylogenetic tree of SAMS from various species. (a) Comparison of amino acid sequences of Pyropia tenera SAMS with the SAMS of other species: Galdieria sulphuraria (XP_005703068.1), Ectocarpus siliculosus (CBJ30117.1), Chlamydomonas reinhardtii (XP_001696661.1), and Arabidopsis thaliana (NP_171751.1); identical residues are shaded black, and similar residues are shaded gray. The domains are indicated by underlining. Met-binding motifs are indicated by boxes. Dotted boxes indicate ATP-binding sites. (b) Phylogenetic tree analysis using Geneious software using Jukes Cantor, Neighbor Joining tree building method with a 10,000 bootstrap repeat value.
Fig. 2 Southern blot analysis of P. tenera genomic DNA: 5 μg of genomic DNA per lane was digested with restriction enzymes and separated by electrophoresis in a 0.7% agarose gel. The DNA was transferred to a nylon membrane and probed with a DIG-labeled PtSAMS cDNA fragment. Molecular size markers are indicated on the left.
Fig. 3 Expression pattern analysis of PtSAMS at different life cycle stages in P. tenera: Total RNA was isolated from conchocelis and thallus of P. tenera at various life stages. The mRNA expression level of the conchocelis stage was set to 1. PtGAPDH was used as normalization control. The results are presented as average values with SD using each three times.
Fig. 4 SDS-PAGE and western blot analysis of PtSAMS recombinant protein in E. coli BL21(DE3). (a) SDS-PAGE analysis. M: marker, Lane 1: uninduced protein, Lane 2–4: induced protein by 0.1 mM IPTG for 1, 3, 5 (hour), respectively. (b) Analysis of expression of recombinant PtSAMS protein in E. coli BL21(DE3) cells; western blotting analysis of the PtSAMS recombinant proteins with anti-His tag antibodies. Arrows indicate the His-tagged PtSAMS recombinant protein.
Fig. 5 Spot assay of pET28(b) and pET28(b)-PtSAMS recombinant protein in E. coli cells with NaCl and KCl treatment; 10 μL from 10−3 to 10−5 dilution series were spotted on (a) control (LB-only) plate, or (b) LB plate supplemented with 400 mM NaCl, and (c) 400 mM KCl.
Fig. 6 Growth analysis of pET28(b) and pET28(b)-PtSAMS recombinant protein in E. coli cells on liquid medium with NaCl and KCl treatment; (a) LB medium, (b) 400 mM NaCl, and (c) 400 mM KCl. OD600 was recored at 1 hour interval up to 12 hours and mean values are represented in graph.
Overexpression of S-Adenosylmethionine Synthetase Gene from Pyropia tenera Enhances Tolerance to Abiotic Stress

Gene specific primers used in the study.

Name Sequence (5′-3′) Purpose
PtSAMS-F CACCATGGCAGCCATGAAG For full length of PtSAMS gene
PtSAMS-R ACGACGCTCTAGAGCTCAC For full length of PtSAMS gene
PtSAMS-NdeI-F CCCCATATGGCAGCCATGAAGAz) For protein expression
PtSAMS-XhoI-R TCACTCGAGGAGCTCAAGCz) For protein expression
PtSAMS-303-F CCAGTCCCCTGAGATTGCTG Probe for southern blot analysis
PtSAMS-955-R CTGAAATCGGCTCGGCAATG Probe for southern blot analysis
PtSAMS-406-F GAGGACCTGATGCCCTTGAC RT-qPCR
PtSAMS-591-R CTGCGTGCTGATGACAATCG RT-qPCR
PtGAPDH-2771-F CGCCGAGTACATTGTCGAGT RT-qPCR
PtGAPDH-3002-R GTACTTCTCGTGCAGCACCT RT-qPCR

z)Bold letters indicate restriction enzyme sites.

GenBank and NCBI reference sequence accession numbers of SAMS sequences.

Species Amino acid sequence length NCBI reference sequence
Rhodophyta Pyropia yezoensis 384 ACJ98094.1
Galdieria sulphuraria 393 XP_005703068.1
Phaeophyta Ectocarpus siliculosus 397 CBJ30117.1
Undaria pinnatifida 397 AEK80411.1
Chlorophyta Ostreococcus tauri 386 XP_003083240.1
Chlamydomonas reinhardtii 390 XP_001696661.1
Arabidopsis thaliana 393 NP_171751.1
Oryza sativa 396 AAT94053.1
Diatoms Thalassiosira pseudonana 450 XP_002288884.1
Fistulifera solaris 384 GAX17078.1
Bacterial Escherichia coli 384 AAA24164.1

Amino acid sequence identity matrix comparison of PtSMAS with SAMS of other species.

PtSAMS GsSAMS CrSAMS EsSAMS AtSAMS
PtSAMS 100% 76.84% 70% 69.6% 66.75%
GsSAMS 100% 69.77% 68.91% 67.59%
CrSAMS 100% 65.92% 81.14%
EsSAMS 100% 64.25%
AtSAMS 100%
Table 1 Gene specific primers used in the study.

Bold letters indicate restriction enzyme sites.

Table 2 GenBank and NCBI reference sequence accession numbers of SAMS sequences.
Table 3 Amino acid sequence identity matrix comparison of PtSMAS with SAMS of other species.