Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis

Plant Breeding and Biotechnology 2017;5(3):243-251.
Published online: September 1, 2017

1Department of Plant Science, Plant Genomics and Breeding Institute, and Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea

2Phyzen Genomics Institute, Seongnam 13558, Korea

3Il Song ERT. Co. LTD, Yongin 16950, Korea

*Corresponding author: Sang-Choon Lee, sclee0923@snu.ac.kr, Tel: +82-2-880-4557, Fax: +82-2-873-2056, Tae-Jin Yang, tjyang@snu.ac.kr, Tel: +82-2-880-4547, Fax: +82-2-873-2056
• Received: August 19, 2017   • Revised: August 19, 2017   • Accepted: August 19, 2017

Copyright © 2017 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 171 Views
  • 0 Download
  • 5 Crossref
prev
  • Rhus chinensis is a shrub widely distributed in Asia. It has been used for traditional medicine and ecological restoration. Here, we report the complete chloroplast genome sequence of two R. chinensis genotypes collected from China and Korea. The assembled chloroplast genome of Chinese R. chinensis is 149,094 bp long, consisting of a large single copy (97,246 bp), a small single copy (18,644 bp) and a pair of inverted repeats (16,602 bp). Gene annotation revealed 77 protein coding genes, 30 tRNA genes, and 4 rRNA genes. A phylogenomic analysis of the chloroplast genomes with 11 known complete chloroplast genomes clarified the relationship of R. chinensis with the other plant species in the Sapindales order. A comparative chloroplast genome analysis identified 170 SNPs and 85 InDels at intra-species level of R. chinensis between Chinese and Korean collections. Based on the sequence diversity between Korea and Chinese R. chinensis plants, we developed three DNA markers useful for genetic diversity and authentication system. The chloroplast genome information obtained in this study will contribute to enriching genetic resources and conservation of endemic Rhus species.
Rhus chinensis is a deciduous shrub belonging to the family Anacardiaceae and distributed widely in Asia including India, Vietnam, China, Korea, and Japan (Min and Barfod 2008). It contains various pharmacologically active constituents and insect-induced galls, which have been used for medicinal purposes (Min and Barfod 2008; Djakpo and Yao 2010). In addition, R. chinensis is used as revegetation plant for ecological restoration owing to its cold tolerance and easy multiplication by both seed and clonal propagation (Nam et al. 2004; Lim and Oh 2015). The diverse utilization of this shrub led to international seed trading which in turn resulted in contamination and destruction of endemic population of R. chinensis. Although the generic and infrageneric delimitation of Rhus species remains controversial, very limited genetic resources are available for R. chinensis (Young 1978; Miller et al. 2001; Yi et al. 2004; Ma et al. 2013; Lee et al. 2016). In this study, we have characterized the complete chloroplast genome of Chinese R. chinensis and compared with Korean R. chinensis chloroplast genome for estimating genetic diversity and developing marker for authentication.
Chloroplast DNA has a characteristic of exhibiting variations at intra-species level and thus chloroplast DNA has widely been used for classification among populations. Chloroplast genomes are uni-parentally inherited and contain rare recombination and mutation events (Cheng et al. 2005; Dong et al. 2012). These features make chloroplast genomes good candidate for studying evolution at inter- or intra-species level. For instance, intra-species researches had been conducted using chloroplast DNA in various plant species including Panax ginseng, Pedicularis chamissonis, Primula cuneifolia, Tellima grandiflora, and Tiarella trifoliata (Soltis et al. 1991; Soltis et al. 1992; Fujii et al. 1995; Sewell et al. 1996; Fujii et al. 1997; Kim et al. 2015a; Joh et al. 2017). Chloroplast genome was also applied to taxonomic studies of Rhus and marker development to classify species (Miller et al. 2001; Lee et al. 2004; Yi et al. 2004; Yi et al. 2007). However, high resolution markers have not been developed for distinguishing Rhus species at both inter- and intra-species level.
In this study, we assembled the complete chloroplast genome of two R. chinensis genotypes from China and Korea. In addition, we have conducted a comparative phylogenomic analysis of Chinese and Korean R. chinensis along with 11 species belonged in the Sapindales order. We also developed polymorphic DNA markers derived from chloroplast genomes to practically apply for authentication and genetic diversity among R. chinensis collections.
Plant materials and genome sequencing
Seeds of wild Chinese R. chinensis were obtained from Shandong and Henan provinces in China. We also collected seven R. chinensis samples in Korea (Table 1): two samples from demilitarized zone (DMZ) between South and North Korea and five samples from other locations in South Korea. We sequenced plants collected from Yang-gu province in Korea and Shandong and Henan provinces in China as representatives of the collections of Korea and China. The genomic DNAs were extracted from the leaf tissues or seeds of collected plants using a modified cetyltrimethylammonium bromide (CTAB) method (Allen et al. 2006) and quantified using Nanodrop ND-1000 (Nanodrop Technologies, Inc., Wilmington, DE, USA). Paired-end (PE) sequencing was conducted using Illumina MiSeq platform by LabGenomics (www.labgenomics.co.kr, Seongnam, Korea).
Chloroplast genome assembly
Raw PE reads were trimmed and de novo assembled using the method as described by Kim et al. (2015a, 2015b). From initial assembly, contigs representing chloroplast genome sequences were extracted, ordered, and merged to generate a single contig sequence using the reference chloroplast genome Acer buergerianum ssp. ningpoense (KF753631, Yang et al. 2014). The assembled sequence was manually corrected and gap-filled by a series of PE read mapping. The assembled chloroplast genome was annotated using GeSeq (https://chlorobox.mpimp-golm.mpg.de/geseq-app.html) and manually curated using the Artemis annotation tool (Rutherford et al. 2000).
Phylogenetic analysis
Phylogenetic analysis was carried out using multiple sequence alignments of 13 complete chloroplast genome sequences (Acer burgerianum ssp. ningpoense, KF753631; Acer davidii, NC_030331; Acer miaotaiense, NC_030343; Azadirachta indica, NC_023792; Boswellia sacra, KT934315; Citrus aurantiifolia, KJ865401; Citrus sinensis, DQ864733; Dipteronia sinensis, NC_029338; R. chinensis (China), MF351625; R. chinensis (Korea), NC_033535; Sapindus mukorossi, KM454982; Spondias bahiensis, KU756561; Spondias tuberosa, KU756562) that belong to the Sapindales order. Phylogenetic tree was constructed using MEGA6.0 (Tamura et al. 2013) with the parameters of neighbor-joining method and 1000 bootstrap replicates.
Comparison of intra-species level and development of molecular marker
Sequence variations were identified by mVISTA program (http://genome.lbl.gov/vista/mvista/submit.shtml) and the polymorphic sites were arranged by MAFFT program (http://mafft.cbrc.jp/alignment/software). The two types of molecular markers, InDel and SNP, were developed based on the polymorphic sites in chloroplast genomes of two R. chinensis. The primers were designed using Primer-blast tool in NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). PCR reactions were performed in 25 μL final volume which is composed of 20 ng of template DNA, 1× Taq buffer, 2.5 mM dNTP, 10 pmol of each primer, and 2 unit/μL Taq DNA polymerase (Vivagen, Korea). PCR conditions were as follows: 5 minutes at 95°C, 35 cycles of 30 seconds at 95°C, 30 seconds at 56°C, and 30 seconds at 72°C, and 5 minutes at 72°C as final extension. PCR amplicons were inspected using 3% agarose gel including Inclone™ Safe Gel stain. Then they were visualized under UV trans-illuminator and a gel documentation system.
PCR reaction for high resolution melting (HRM) analysis against SNP target was performed in a 20 μL final volume which consists of 20 ng of template DNA, 1× Taq buffer, 2.5 mM dNTP, 10 pmol of each primer, 2 unit/μL Taq DNA polymerase (Vivagen, Korea), and fluorescent dye SYTO 9 (Roche Diagnostics). PCR conditions were as follows: 5 minutes at 95°C, 45 cycles of 30 seconds at 95°C, 30 seconds at 56°C, and 30 seconds at 72°C, and 5 minutes at 72°C as final extension. Then, HRM analysis was conducted using LightCycler 480 (Roche Applied Science). HRM conditions were as follows: 1 minute at 95°C, 1 minute at 40°C, 5 seconds at 70°C, and the temperature increased up to 90°C, then decreased to 40°C as fluorescence acquisition.
Complete chloroplast genome and intra-species polymorphism between Korean and Chinese R. chinensis
The assembled chloroplast genome of Chinese R. chinensis is a circular molecule of 149,094 bp long and has typical quadripartite structure consisting of a large single copy (LSC) region of 97,246 bp small single copy (SSC) region of 18,644 bp and a pair of inverted repeats (IRa and IRb) of 16,602 bp (Fig. 1, Table 2). A total of 111 genes, including 77 protein coding genes, 30 tRNA genes, and 4 rRNA genes were annotated (Table 3) and the GC content of the chloroplast genome was 37.86%.
Comparison of the chloroplast genome of Korean and Chinese R. chinensis revealed a total length 83 bp differences. Chinese R. chinensis is 364 bp longer than Korean R. chinensis in LSC region, but 139 bp and 3 bp shorter in IR and SSC regions, respectively. We identified 170 SNPs and 85 InDels between two R. chinensis chloroplast genome sequences derived from Chinese and Korean collections (NC_033535, Lee et al. 2016). More intra-species polymorphic sites were found at intergenic regions than genic regions: 99 SNPs and 78 InDels were found at intergenic regions; 71 SNPs and 7 InDels were identified from genic regions.
Phylogenomic analysis of R. chinensis based on chloroplast genome
Phylogenomic analysis was conducted using two complete chloroplast genomes R. chinensis and 11 complete chloroplast genome sequences in the Sapindales order. This results showed, as expected, that R. chinensis was grouped with Spondias species in the Anacardiaceae family (Fig. 2). In addition, a group including R. chinensis showed a close sister relationship with species belonging to the Burseraceae and Sapindaceae family in the Sapindales order.
Molecular markers to discriminate Korean and Chinese collections of R. chinensis species
Three intra-species polymorphic markers were designed from polymorphic regions (Table 4). The PCR amplicons showed 288/249 bp and 221/196 bp difference (Chinese/Korean) for two InDel markers, rh_InDel_02 and rh_InDel_03 markers, respectively. The rh_InDel_02 and rh_InDel_03 showed InDel polymorphism between Korean R. chinensis (Yang-gu) and Chinese collection as expected (Fig. 3a, b). However other six Korean collections were identical with Chinese collections (Fig. 3c, d). One SNP marker (rh_hrm_11) distinguished Chinese collection from all the Korean collections based on HRM analysis although the size of PCR amplicons are same (Fig. 4).
Intra-species diversity of R. chinensis
R. chinensis is known as a valuable medicinal plants with remedial components (Min and Barfod 2008; Djakpo and Yao 2010). In addition, R. chinensis is used for ecological restoration (Nam et al. 2004; Lim and Oh 2015). Due to its wide utility, it is necessary to explore this plant for genetic diversity and marker development to prevent false trading (Khairallh and Salama 2009). Here, we generated the complete chloroplast genome of two R. chinensis plants collected from Korea and China. Comparative analysis of chloroplast genome of R. chinensis revealed 255 intraspecies polymorphic sites, 170 SNPs and 85 InDels. The abundant genetic diversity would be found in the wild collections of R. chinensis and could be applied to phylogenetic analysis and development of molecular markers for verifying genetic diversity of R. chinensis.
Discrimination of R. chinensis collections with three molecular markers
Two InDel markers were unique for one Korean collection of R. chinensis (Yang-gu) from the others (Fig. 3a, b). The Yang-gu collection is derived from the DMZ region between South Korea and North Korea. The eco-system was well maintained in DMZ regions for longer than 60 recent years with less artificial interruption. Two InDel markers revealed unique genotype of Yang-gu collection among the eight collections, suggesting the Yang-gu collection are relatively isolated in the DMZ region from others. However, it is required to expand our study by evaluating more population for solid conclusion. Meanwhile, the SNP markers could efficiently divide the melting patterns for Chinese R. chinensis from Korean R. chinensis through HRM analysis (Fig. 4).
Chloroplast genomes are valuable genomic resources for practical application of DNA markers because of the uni-parentally inherited features and conserved structure of the chloroplast genomes (Cheng et al. 2005; Dong et al. 2012, Kim et al. 2015a, 2015b, 2015c; Joh et al. 2017). Here, we report three DNA markers which can be applied for genetic diversity and practical application for authentication of the plant collections of Rhus species.
This work was supported by the Korea Environmental Industry & Technology Institute (Project No.: 2014000130001) and the Bio & Medical Technology Development Program of the NRF funded by the Korean government, MSIP (NRF-2015M3A9A5030733).
Fig. 1
Chloroplast genome map of R. chinensis and intra-species polymorphic DNA markers. (a) Chloroplast genome map of R. chinensis generated using OGDRAW (http://ogdraw.mpimp-golm.mpg.de/). Genes transcribed clockwise and counterclockwise are indicated on the outside and inside of the large circle, respectively. The four parts of the chloroplast genome and GC content are indicated on the inner circle. Red and blue bars in the inner circle indicate intra-species InDels and SNPs identified between Chinese and Korean R. chinensis chloroplast genome sequences. Black arrows represent the target regions for InDel markers and the purple arrow indicates SNP used to differentiate between Chinese and Korean R. chinensis.
pbb-05-243f1.jpg
Fig. 2
Phylogenetic analysis of R. chinensis. The tree was generated with complete chloroplast genome sequences of R. chinensis and species belonging to the Sapindales order by multiple alignment using MAFFT (http://mafft.cbrc.jp/alignment/server/index.html) and a maximum likelihood (ML) analysis using MEGA 6.0 (Tamura et al. 2013). Numbers in the nodes are bootstrap support values (>50%) from 1000 replicates. Chloroplast genome sequences used for this tree are: Acer burgerianum ssp. ningpoense, KF753631; Acer davidii, NC_030331; Acer miaotaiense, NC_030343; Azadirachta indica, NC_023792; Boswellia sacra, KT934315; Citrus aurantiifolia, KJ865401; Citrus sinensis, DQ864733; Dipteronia sinensis, NC_029338; R. chinensis (China), MF351625; R. chinensis (Korea), NC_033535; Sapindus mukorossi, KM454982; Spondias bahiensis, KU756561; Spondias tuberosa, KU756562.
pbb-05-243f2.jpg
Fig. 3
Two InDel-based markers to validate intra-species diversity in R. chinensis. (a) A 39-bp InDel in trnS-GGA-rps4 and (c) its PCR products (Marker rh_InDel_02 in Table 4) for eight R. chinensis plants. (b) 25-bp InDel in ycf1 and (d) its PCR products (Marker rh_InDel_03 in Table 4) for eight R. chinensis plants. R. chinensis collections 1: China (Shandong and Henan), 2: Korea (Yang-gu), 3: Korea (Hwacheon), 4: Korea (Mt. Jiri), 5: Korea (Han-taek Botanical Garden), 6: Korea (Mt. Kariwang), 7, 8: Korea (Gwangreung Botanical Garden), M: 100-bp DNA ladder.
pbb-05-243f3.jpg
Fig. 4
SNP-based marker to validate intra-species diversity in R. chinensis. (a) Alignment of nucleotide sequences to show the SNP (arrow) in ycf1 gene of chloroplast of Korean and Chinese R. chinensis plants. (b) Agarose gel electrophoresis of the PCR products amplified by Marker rh_hrm_11 (Table 4). (c) HRM analysis of the PCR products to detect the SNP. R. chinensis collections 1: China (Shandong and Henan), 2: Korea (Yang-gu), 3: Korea (Hwacheon), 4: Korea (Mt. Jiri), 5: Korea (Han-taek Botanical Garden), 6: Korea (Mt. Kariwang), 7, 8: Korea (Gwangreung Botanical Garden), M: 100-bp DNA ladder.
pbb-05-243f4.jpg
Table 1
Sample collections of R. chinensis used in this study.
Table 1
Accession nos. Countries Collected locations Collected year
1 China Shandong and Henan provinces 2014
2 Korea Yang-gu, Gangwon-do 2014
3 Korea Hwacheon, Gangwon-do 2014
4 Korea Mt.Jiri, Sancheong, Kyungsangnam-do, 2014
5 Korea Han-taek Botanical Garden, Yong-in, Kyungki-do 2015
6 Korea Mt. Kariwang, Jeong-seon, Gangwon-do 2015
7 Korea Gwangreung Botanical Garden, Korea National Arboretum, Po-cheon, Gyeonggi-do 2015
8 Korea Gwangreung Botanical Garden, Korea National Arboretum, Po-cheon, Gyeonggi-do 2015
Table 2
Summary of NGS data and chloroplast genomes of two Rhus chinensis collections.
Table 2
Collected locations Raw data bases (bp) Cp genome coverage (x) Cp length (bp) LSC length (bp) IR length (bp) SSC length (bp)
China 4,199,252,923 162 149,094 97,246 16,602 18,644
Korea (Yang-gu)z) 6,251,344,649 96 149,011 96,882 16,741 18,647

z)reported by Lee et al. (2016).

Table 3
Genes annotated in R. chinensis chloroplast genome.
Table 3
Gene types Gene names
Photosystem I psaA, B, C, I, J
Photosystem II psbA, B, C, D, E, F, H, I, J, K, L, M, N, T, Z
Cytochrome b/f complex petA, B, D, G, N, L
ATP synthase atpA, B, E, F, H, I
NADH dehydrogenase ndhA, B, C, D, E, F, G, H, I, J, K
RubisCO large subunit rbcL
RNA polymerase rpoA, B, C1, C2
Ribosomal proteins (SSU) rps2, 3, 4, 7, 8, 11, 12, 14, 15, 16, 18
Ribosomal proteins (LSU) rpl2, 14, 16, 20, 23, 32, 33, 36
clpP, matK clpP, matK
Other genes ccsA, cemA, accD
Hypothetical chloroplast reading frames ycf1, 2, 3, 4, 15
Transfer RNAs trnfM-CAU, A-UGC, C-GCA, D-GUC, E-UUC, F-GAA, G-GCC,UCC, H-GUC, I-CAU,GAU, K-UUU, L-CAA,CAU,UAG,UAA, M-CAU, N-GUU, P-UGG, Q-UUG, R-UCU, ACG, S-UGA,GCU,GGA, T-GGU, V-GAC,UAC, W-CCA, Y-GUA
Ribosomal RNAs rrn4.5, 5, 16, 23
Table 4
Molecular markers developed in this study.
Table 4
Type Marker Name Target Region Primer Sequence Variation Product Size (bp)
InDel rh_InDel_02 trnS-GGA-rps4 F AGTGGTTCAAGGCGTAGCAT 39 bp 288/249
R ATTTGATCCGGCGATTTGGA
rh_InDel_03 ycf1 F TGATTCGCTCGATTTCGCCA 25 bp 221/196
R TCTGTCCTTCAATATCACGGAAC
SNP rh_hrm_11 ycf1 F CATGTGTGCATCTCTGGGTT G/T 191
R CTTCCTTTGGTCCAATTCTCGAT
  • Allen GC, Flores-Vergara MA, Krasynanski S, Kumar S, Thompson WF. 2006. A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat Protoc. 1: 2320-2325.
  • Cheng Y, de Vicente MC, Meng H, Guo W, Tao N, Deng X. 2005. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera. Tree Physiol. 25: 661-672.
  • Djakpo O, Yao W. 2010. Rhus chinensis and Galla Chinensis--folklore to modern evidence: review. Phytother Res. 24: 1739-1747.
  • Dong W, Liu J, Yu J, Wang L, Zhou S. 2012. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS One. 7: e35071
  • Fujii N, Ueda K, Watano Y, Shimizu T. 1995. Intraspecific sequence variation in chloroplast DNA of Primula cuneifolia Ledeb. (Primulaceae). J Phytogeogr Taxon. 43: 15-24.
  • Fujii N, Ueda K, Watano Y, Shimizu T. 1997. Intraspecific sequence variation of chloroplast DNA in Pedicularis chamissonis Steven (Scrophulariaceae) and geographic structuring of the Japanese “Alpine” plants. Journal of Plant Research. 110: 195-207.
  • Joh HJ, Kim NH, Jayakodi M, Jang WJ, Park JY, Kim YC, et al. 2017. Authentication of golden-berry P. ginseng cultivar ‘Gumpoong’ from a landrace ‘Hwangsook’ based on pooling method using chloroplast-derived markers. Plant Breed Biotech. 5: 16-24.
  • Khairallh ARAT, Salama B. 2009. Genetic variation among sumac (Rhus Coriaria L.) samples collected from three locations in Jordan as revealed by AFLP markers. Advances in Environmental Biology. 3: 107-112.
  • Kim K, Lee SC, Lee J, Lee HO, Joh HJ, Kim NH, et al. 2015a. Comprehensive survey of genetic diversity in chloroplast genomes and 45S nrDNAs within Panax ginseng species. PLoS One. 10: e0117159
  • Kim K, Lee SC, Lee J, Yu Y, Yang K, Choi BS, et al. 2015b. Complete chloroplast and ribosomal sequences for 30 accessions elucidate evolution of Oryza AA genome species. Sci Rep. 5: 15655
  • Kim KH, Kim YS, Kim MR, Lee HY, Lee KH, Kim JH, et al. 2015c. Development of primer sets for the detection of Polygonum multiflorum, Cynanchum wilfordii and C. auriculatum. Journal of Food Hygiene and Safety. 30: 289-294.
  • Lee YS, Kim IS, Kim JK, Park JY, Joh HJ, Park HS, et al. 2016. The complete chloroplast genome sequence of Rhus chinensis Mill (Anacardiaceae). Mitochondrial DNA Part B. 1: 696-697.
  • Lee WK, Kim MJ, Heo K. 2004. Phylogeny of Korean Rhus spp. based on ITS and rbcL sequences. Korean Journal of Medicinal Crop Science. 12: 60-66.
  • Lim CY, Oh CH. 2015. Growth and spatial distribution characteristics of Rhus javanica populations sowed on cut-slopes. J Korean Env Res Tech. 18: 39-49.
  • Ma WL, Wu M, Wu Y, Ren ZM, Zhong Y. 2013. Cloning and characterisation of a phenylalanine ammonia-lyase gene from Rhus chinensis. Plant Cell Rep. 32: 1179-1190.
  • Miller AJ, Young DA, Wen J. 2001. Phylogeny and biogeography of Rhus (Anacardiaceae) based on ITS sequences data. Int J Plant Sci. 162: 1401-1407.
  • Min T, Barfod A. 2008. Anacardiaceae. (http://www.efloras.org/florataxon.aspx?flora_id=2&taxon_id=10038): Wu ZY, Raven PH, Hong DY. Flora of China. 11: Science Press and Missouri Botanical Garden Press; Beijing, China and St. Louis, Missouri, (MO), USA
  • Nam SJ, Yeo WJ, Choi JH, Kim NC. 2004. Development of revegetation method using forest topsoils for ecological restoration of the slopes (I). J of Korean Env Res & Reveg Tech. 7: 110-119.
  • Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, et al. 2000. Artemis: sequence visualization and annotation. Bioinformatics. 16: 944-945.
  • Sewell MM, Parks CR, Chase MW. 1996. Intraspecific chloroplast DNA variation and biogeography of North American Liriodendron L. (Magnoliaceae). Evolution. 50: 1147-1154.
  • Soltis D, Soltis P, Kuzoff R, Tucker T. 1992. Geographic structuring of chloroplast DNA genotypes in Tiarella trifoliata (Saxifragaceae). Plant Systematics and Evolution. 181: 203-216.
  • Soltis DE, Mayer MS, Soltis PS, Edgerton M. 1991. Chloroplast-DNA variation in Tellima grandiflora (Saxifragaceae). American Journal of Botany. 78: 1379-1390.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 30: 2725-2729.
  • Yang JB, Li DZ, Li HT. 2014. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs. Mol Ecol Resour. 14: 1024-1031.
  • Yi T, Miller AJ, Wen J. 2004. Phylogenetic and bio-geographic diversification of Rhus (Anacardiaceae) in the Northern Hemisphere. Mol Phylogenet Evol. 33: 861-879.
  • Yi T, Miller AJ, Wen J. 2007. Phylogeny of Rhus (Anacardiaceae) based on sequences of nuclear Nia-i3 intron and chloroplast trnC-trnD. Systematic Botany. 32: 379-391.
  • Young DA. 1978. Re-evaluation of the section of Rhus L. subgenus Lobadium (Raf.) T. and G. (Anacardiaceae). Brittonia. 30: 411-415.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis
Plant Breed. Biotech.. 2017;5(3):243-251.   Published online September 1, 2017
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis
Plant Breed. Biotech.. 2017;5(3):243-251.   Published online September 1, 2017
Close

Figure

  • 0
  • 1
  • 2
  • 3
The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis
Image Image Image Image
Fig. 1 Chloroplast genome map of R. chinensis and intra-species polymorphic DNA markers. (a) Chloroplast genome map of R. chinensis generated using OGDRAW (http://ogdraw.mpimp-golm.mpg.de/). Genes transcribed clockwise and counterclockwise are indicated on the outside and inside of the large circle, respectively. The four parts of the chloroplast genome and GC content are indicated on the inner circle. Red and blue bars in the inner circle indicate intra-species InDels and SNPs identified between Chinese and Korean R. chinensis chloroplast genome sequences. Black arrows represent the target regions for InDel markers and the purple arrow indicates SNP used to differentiate between Chinese and Korean R. chinensis.
Fig. 2 Phylogenetic analysis of R. chinensis. The tree was generated with complete chloroplast genome sequences of R. chinensis and species belonging to the Sapindales order by multiple alignment using MAFFT (http://mafft.cbrc.jp/alignment/server/index.html) and a maximum likelihood (ML) analysis using MEGA 6.0 (Tamura et al. 2013). Numbers in the nodes are bootstrap support values (>50%) from 1000 replicates. Chloroplast genome sequences used for this tree are: Acer burgerianum ssp. ningpoense, KF753631; Acer davidii, NC_030331; Acer miaotaiense, NC_030343; Azadirachta indica, NC_023792; Boswellia sacra, KT934315; Citrus aurantiifolia, KJ865401; Citrus sinensis, DQ864733; Dipteronia sinensis, NC_029338; R. chinensis (China), MF351625; R. chinensis (Korea), NC_033535; Sapindus mukorossi, KM454982; Spondias bahiensis, KU756561; Spondias tuberosa, KU756562.
Fig. 3 Two InDel-based markers to validate intra-species diversity in R. chinensis. (a) A 39-bp InDel in trnS-GGA-rps4 and (c) its PCR products (Marker rh_InDel_02 in Table 4) for eight R. chinensis plants. (b) 25-bp InDel in ycf1 and (d) its PCR products (Marker rh_InDel_03 in Table 4) for eight R. chinensis plants. R. chinensis collections 1: China (Shandong and Henan), 2: Korea (Yang-gu), 3: Korea (Hwacheon), 4: Korea (Mt. Jiri), 5: Korea (Han-taek Botanical Garden), 6: Korea (Mt. Kariwang), 7, 8: Korea (Gwangreung Botanical Garden), M: 100-bp DNA ladder.
Fig. 4 SNP-based marker to validate intra-species diversity in R. chinensis. (a) Alignment of nucleotide sequences to show the SNP (arrow) in ycf1 gene of chloroplast of Korean and Chinese R. chinensis plants. (b) Agarose gel electrophoresis of the PCR products amplified by Marker rh_hrm_11 (Table 4). (c) HRM analysis of the PCR products to detect the SNP. R. chinensis collections 1: China (Shandong and Henan), 2: Korea (Yang-gu), 3: Korea (Hwacheon), 4: Korea (Mt. Jiri), 5: Korea (Han-taek Botanical Garden), 6: Korea (Mt. Kariwang), 7, 8: Korea (Gwangreung Botanical Garden), M: 100-bp DNA ladder.
The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis

Sample collections of R. chinensis used in this study.

Accession nos. Countries Collected locations Collected year
1 China Shandong and Henan provinces 2014
2 Korea Yang-gu, Gangwon-do 2014
3 Korea Hwacheon, Gangwon-do 2014
4 Korea Mt.Jiri, Sancheong, Kyungsangnam-do, 2014
5 Korea Han-taek Botanical Garden, Yong-in, Kyungki-do 2015
6 Korea Mt. Kariwang, Jeong-seon, Gangwon-do 2015
7 Korea Gwangreung Botanical Garden, Korea National Arboretum, Po-cheon, Gyeonggi-do 2015
8 Korea Gwangreung Botanical Garden, Korea National Arboretum, Po-cheon, Gyeonggi-do 2015

Summary of NGS data and chloroplast genomes of two Rhus chinensis collections.

Collected locations Raw data bases (bp) Cp genome coverage (x) Cp length (bp) LSC length (bp) IR length (bp) SSC length (bp)
China 4,199,252,923 162 149,094 97,246 16,602 18,644
Korea (Yang-gu)z) 6,251,344,649 96 149,011 96,882 16,741 18,647

z)reported by Lee et al. (2016).

Genes annotated in R. chinensis chloroplast genome.

Gene types Gene names
Photosystem I psaA, B, C, I, J
Photosystem II psbA, B, C, D, E, F, H, I, J, K, L, M, N, T, Z
Cytochrome b/f complex petA, B, D, G, N, L
ATP synthase atpA, B, E, F, H, I
NADH dehydrogenase ndhA, B, C, D, E, F, G, H, I, J, K
RubisCO large subunit rbcL
RNA polymerase rpoA, B, C1, C2
Ribosomal proteins (SSU) rps2, 3, 4, 7, 8, 11, 12, 14, 15, 16, 18
Ribosomal proteins (LSU) rpl2, 14, 16, 20, 23, 32, 33, 36
clpP, matK clpP, matK
Other genes ccsA, cemA, accD
Hypothetical chloroplast reading frames ycf1, 2, 3, 4, 15
Transfer RNAs trnfM-CAU, A-UGC, C-GCA, D-GUC, E-UUC, F-GAA, G-GCC,UCC, H-GUC, I-CAU,GAU, K-UUU, L-CAA,CAU,UAG,UAA, M-CAU, N-GUU, P-UGG, Q-UUG, R-UCU, ACG, S-UGA,GCU,GGA, T-GGU, V-GAC,UAC, W-CCA, Y-GUA
Ribosomal RNAs rrn4.5, 5, 16, 23

Molecular markers developed in this study.

Type Marker Name Target Region Primer Sequence Variation Product Size (bp)
InDel rh_InDel_02 trnS-GGA-rps4 F AGTGGTTCAAGGCGTAGCAT 39 bp 288/249
R ATTTGATCCGGCGATTTGGA
rh_InDel_03 ycf1 F TGATTCGCTCGATTTCGCCA 25 bp 221/196
R TCTGTCCTTCAATATCACGGAAC
SNP rh_hrm_11 ycf1 F CATGTGTGCATCTCTGGGTT G/T 191
R CTTCCTTTGGTCCAATTCTCGAT
Table 1 Sample collections of R. chinensis used in this study.
Table 2 Summary of NGS data and chloroplast genomes of two Rhus chinensis collections.

reported by Lee et al. (2016).

Table 3 Genes annotated in R. chinensis chloroplast genome.
Table 4 Molecular markers developed in this study.