Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Collection and Evaluation of Genetic Variation of Perilla Accessions in the Jeju Island

Plant Breeding and Biotechnology 2016;4(1):87-98.
Published online: February 28, 2016

1Division of Bio-Resource Sciences, College of Agriculture and Life Sciences, Kangwon National University, Chuncheon 24341, Korea

2Bioherb Research Institute, Kangwon National University, Chuncheon 24341, Korea

*Corresponding author: Ju Kyong Lee, jukyonglee@kangwon.ac.kr, Tel: +82-33-250-6415, Fax: +82-33-259-5558
• Received: September 21, 2015   • Revised: October 30, 2015   • Accepted: October 30, 2015

Copyright © 2016 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 231 Views
  • 0 Download
  • 4 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • FISH Karyotype Comparison between Wild and CultivatedPerillaSpecies Using 5S and 45S rDNA Probes
    Eliazar Alumbro Peniton, Nomar Espinosa Waminal, Tae-Ho Kim, Hyun Hee Kim
    Plant Breeding and Biotechnology.2019; 7(3): 237.     CrossRef
  • Identification of quantitative trait loci associated with flowering time in perilla using genotyping-by-sequencing
    Yun-Joo Kang, Bo-Mi Lee, Moon Nam, Ki-Won Oh, Myoung-Hee Lee, Tae-Ho Kim, Sung-Hwan Jo, Jeong-Hee Lee
    Molecular Biology Reports.2019; 46(4): 4397.     CrossRef
  • Detection of QTLs in an Interspecific Cross between Perilla citriodora × P. hirtella Mapping Population
    Myoung Hee Lee, Ki Won Oh, Myung Sik Kim, Sung Up Kim, Jung In Kim, Eun Young Oh, Suk Bok Pae, Un Sang Yeo, Tae-Ho Kim, Jeong Hee Lee, Chan Sik Jung, Do Yeon Kwak, Yong Chul Kim
    Korean Journal of Breeding Science.2018; 50(1): 13.     CrossRef
  • Characterization of Perilla frutescens (Linn.) Britt based on morphological, biochemical and STMS markers
    S.K. Singh, P.C. Kole, A.K. Misra, Somnath Roy, Lalit Arya, Manjusha Verma, R. Bhardwaj, P. Suneja, Med Ram Verma, K.V. Bhat, Rakesh Singh
    Industrial Crops and Products.2017; 109: 773.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Collection and Evaluation of Genetic Variation of Perilla Accessions in the Jeju Island
Plant Breed. Biotech.. 2016;4(1):87-98.   Published online February 28, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Collection and Evaluation of Genetic Variation of Perilla Accessions in the Jeju Island
Plant Breed. Biotech.. 2016;4(1):87-98.   Published online February 28, 2016
Close

Figure

  • 0
  • 1
  • 2
Collection and Evaluation of Genetic Variation of Perilla Accessions in the Jeju Island
Image Image Image
Fig. 1 Routes of the field survey and collection sites for Perilla crop and their weedy types in Jeju Island. ○: accession of cultivated type of var. frutescens; ●: accession of weedy type of var. frutescens; ★: accession of weedy type of var. crispa.
Fig. 2 Scatter diagram of 85 Perilla crop in Jeju Island based on principal component I (PC1) and II (PC2). ■: cultivated type of var. frutescens; ●: weedy type of var. frutescens; ▲: weedy type of var. crispa.
Fig. 3 Unweighted pair group method with arithmetic mean (UPGMA) dendrogram based on the simple sequence repeat marker. ○: accession of cultivated var. frutescens, ●: accession of weedy var. frutescens, ■: accession of weedy var. crispa.
Collection and Evaluation of Genetic Variation of Perilla Accessions in the Jeju Island

Collection sites of Perilla samples in Jeju-do, Republic of Korea.

Accession no. Collection date Source of material (village, town, or city) Type Code no.z)
PF11-106 2011/10/24 Seongeup-ri, Pyoseon-myeon, Seogwipo Weedy var. frutescens 7
PF11-107 2011/10/24 Doryeon-1 dong, Jeju Weedy var. frutescens 8
PF11-108 2011/10/24 Doryeon-1 dong, Jeju Weedy var. frutescens 9
PF11-109 2011/10/25 Bongseong-ri, Aewol-eup, Jeju Weedy var. frutescens 10
PF11-110 2011/10/25 Bongseong-ri, Aewol-eup, Jeju Weedy var. frutescens 11
PF11-111 2011/10/25 Bongseong-ri, Aewol-eup, Jeju Weedy var. frutescens 12
PF11-112 2011/10/26 Seonhul-ri, Jocheon-eup, Jeju Weedy var. frutescens 13
PF11-113 2011/10/26 Seonhul-ri, Jocheon-eup, Jeju Weedy var. frutescens
PF11-114 2011/10/26 Bongseong-ri, Aewol-eup, Jeju Weedy var. crispa 82
PF11-115 2011/10/26 Bongseong-ri, Aewol-eup, Jeju Cultivated var. frutescens 1
PF12-019 2012/10/31 Samyang-dong, Jeju Weedy var. frutescens 14
PF12-020 2012/10/31 Samyang-dong, Jeju Weedy var. frutescens
PF12-021 2012/10/31 Samyang-dong, Jeju Weedy var. frutescens 15
PF12-022 2012/10/31 Jochen-ri, Jochen-eup, Jeju Weedy var. frutescens 16
PF12-023 2012/10/31 Jochen-ri, Jochen-eup, Jeju Weedy var. frutescens 17
PF12-024 2012/10/31 Jochen-ri, Jochen-eup, Jeju Weedy var. frutescens 18
PF12-025 2012/10/31 Woljeong-ri, Gujwa-eup, Jeju Weedy var. frutescens 19
PF12-026 2012/10/31 Sehwa-ri, Gujwa-eup, Jeju Weedy var. frutescens 20
PF12-027 2012/10/31 Sehwa-ri, Gujwa-eup, Jeju Weedy var. frutescens 21
PF12-028 2012/10/31 Sehwa-ri, Gujwa-eup, Jeju Weedy var. frutescens 22
PF12-029 2012/10/31 Sehwa-ri, Gujwa-eup, Jeju Weedy var. frutescens 23
PF12-030 2012/10/31 Sehwa-ri, Gujwa-eup, Jeju Weedy var. frutescens 24
PF12-031 2012/10/31 Sehwa-ri, Gujwa-eup, Jeju Weedy var. frutescens 25
PF12-032 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens 26
PF12-033 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens 27
PF12-034 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens 28
PF12-035 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens
PF12-036 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens 29
PF12-037 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens 30
PF12-038 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens 31
PF12-039 2012/10/31 Sangdo-ri, Gujwa-eup, Jeju Weedy var. frutescens 32
PF12-040 2012/10/31 Songdang-ri, Gujwa-eup, Jeju Weedy var. frutescens
PF12-041 2012/10/31 Songdang-ri, Gujwa-eup, Jeju Weedy var. frutescens 33
PF12-042 2012/10/31 Songdang-ri, Gujwa-eup, Jeju Weedy var. frutescens 34
PF12-043 2012/10/31 Susan-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 35
PF12-044 2012/11/01 Siheung-ri, Seongsan-eup, Seogwipo Weedy var. frutescens
PF12-045 2012/11/01 Siheung-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 36
PF12-046 2012/11/01 Siheung-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 37
PF12-047 2012/11/01 Siheung-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 38
PF12-048 2012/11/01 Sinyang-ri, Seongsan-eup, Seogwipo Weedy var. crispa 83
PF12-049 2012/11/01 Nansan-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 39
PF12-050 2012/11/01 Nansan-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 40
PF12-051 2012/11/01 Nansan-ri, Seongsan-eup, Seogwipo Weedy var. frutescens
PF12-052 2012/11/01 Samdal-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 41
PF12-053 2012/11/01 Samdal-ri, Seongsan-eup, Seogwipo Weedy var. frutescens 42
PF12-054 2012/11/01 Seongeup-ri, Pyoseon-myeon, Seogwipo Weedy var. frutescens
PF12-055 2012/11/01 Hacheon-ri, Pyoseon-myeon, Seogwipo Weedy var. frutescens 43
PF12-056 2012/11/01 Hacheon-ri, Pyoseon-myeon, Seogwipo Weedy var. frutescens 44
PF12-057 2012/11/01 Hacheon-ri, Pyoseon-myeon, Seogwipo Weedy var. frutescens 45
PF12-058 2012/11/01 Pyoseon-ri, Pyoseon-myeon, Seogwipo Weedy var. frutescens 46
PF12-059 2012/11/01 Sehwa-ri, Pyoseon-myeon, Seogwipo Weedy var. frutescens 47
PF12-060 2012/11/01 Singeung-ri, Namwon-eup, Seogwipo Weedy var. frutescens
PF12-061 2012/11/01 Singeung-ri, Namwon-eup, Seogwipo Weedy var. frutescens 48
PF12-062 2012/11/01 Singeung-ri, Namwon-eup, Seogwipo Weedy var. frutescens 49
PF12-063 2012/11/01 Hannam-ri, Namwon-eup, Seogwipo Weedy var. frutescens 50
PF12-064 2012/11/01 Wimi-ri, Namwon-eup, Seogwipo Weedy var. frutescens 51
PF12-065 2012/11/01 Wimi-ri, Namwon-eup, Seogwipo Weedy var. frutescens 52
PF12-066 2012/11/01 Harye-ri, Namwon-eup, Seogwipo Weedy var. frutescens 53
PF12-067 2012/11/01 Harye-ri, Namwon-eup, Seogwipo Weedy var. frutescens
PF12-068 2012/11/01 Harye-ri, Namwon-eup, Seogwipo Weedy var. frutescens 54
PF12-069 2012/11/01 Hwasun-ri, Andeok-myeon, Seogwipo Weedy var. frutescens 55
PF12-070 2012/11/01 Sangye-dong, Seogwipo Cultivated var. frutescens 2
PF12-071 2012/11/02 Seohong-dong, Seogwipo Cultivated var. frutescens 3
PF12-072 2012/11/02 Seohong-dong, Seogwipo Weedy var. frutescens 56
PF12-073 2012/11/02 Seohong-dong, Seogwipo Weedy var. frutescens 57
PF12-074 2012/11/02 Seohong-dong, Seogwipo Weedy var. frutescens 58
PF12-075 2012/11/02 Seohong-dong, Seogwipo Weedy var. frutescens 59
PF12-076 2012/11/02 Deoksu-ri, Andeok-myeon, Seogwipo Weedy var. frutescens 60
PF12-077 2012/11/02 Deoksu-ri, Andeok-myeon, Seogwipo Weedy var. frutescens 61
PF12-078 2012/11/02 Deoksu-ri, Andeok-myeon, Seogwipo Weedy var. frutescens 62
PF12-079 2012/11/02 Yeongrak-ri, Daejeong-eup, Seogwipo Weedy var. frutescens 63
PF12-080 2012/11/02 Gosan-ri, Hangyeong-myeon, Jesu Cultivated var. frutescens 4
PF12-081 2012/11/02 Dumo-ri, Hangyeong-myeon, Jesu Weedy var. frutescens 64
PF12-082 2012/11/02 Wollyeong-ri, Hanllim-eup, Jesu Weedy var. frutescens 65
PF12-083 2012/11/02 Geumneung-ri, Hanllim-eup, Jesu Weedy var. frutescens 66
PF12-084 2012/11/02 Gwideok-ri, Hanllim-eup, Jesu Weedy var. frutescens 67
PF12-085 2012/11/02 Gwideok-ri, Hanllim-eup, Jesu Weedy var. frutescens 68
PF12-086 2012/11/02 Bongseong-ri, Aewol-eup, Jesu Weedy var. frutescens 69
PF12-087 2012/11/02 Gwakji-ri, Aewol-eup, Jesu Weedy var. frutescens 70
PF12-088 2012/11/02 Sangga-ri, Aewol-eup, Jesu Weedy var. frutescens 71
PF12-089 2012/11/02 Haga-ri, Aewol-eup, Jesu Weedy var. frutescens 72
PF12-090 2012/11/02 Susan-ri, Aewol-eup, Jesu Weedy var. frutescens 73
PF12-091 2012/11/02 Eomjang-ro, Aewol-eup, Jesu Cultivated var. frutescens 5
PF12-092 2012/11/02 Jangjeon-ri, Aewol-eup, Jesu Weedy var. frutescens 74
PF12-093 2012/11/02 Jangjeon-ri, Aewol-eup, Jesu Weedy var. frutescens 75
PF12-094 2012/11/02 Jangjeon-ri, Aewol-eup, Jesu Weedy var. frutescens 76
PF12-095 2012/11/02 Jangjeon-ri, Aewol-eup, Jesu Weedy var. frutescens 77
PF12-096 2012/11/02 Jangjeon-ri, Aewol-eup, Jesu Weedy var. frutescens 78
PF12-097 2012/11/02 Hagwi-ri, Aewol-eup, Jesu Cultivated var. frutescens 6
PF12-098 2012/11/02 Hagwi-ri, Aewol-eup, Jesu Weedy var. frutescens 79
PF12-099 2012/11/03 Gyorae-ri, Jocheon-eup, Jesu Weedy var. crispa 84
PF12-100 2012/11/03 Gyorae-ri, Jocheon-eup, Jesu Weedy var. crispa 85
PF12-101 2012/11/03 Gyorae-ri, Jocheon-eup, Jesu Weedy var. frutescens 80
PF12-102 2012/11/03 Waheul-ri, Jocheon-eup, Jesu Weedy var. frutescens 81

z)This mark indicated the accessions used for morphological and simple sequence repeat analysis.

Characters used in the morphological analysis of Perilla crop.

Abbreviationz) Character When/How measured Category
QN1 Days from seeding to flowering At flowering stage Day
QN2 Plant height At flowering stage cm
QN3 Number of internodes At flowering stage Number
QN4 Length of the largest inflorescence After harvest cm
QL1 Seed color After harvest White-1, gray-2, brown-3, dark brown-4
QL2 Seed hardness After harvest Soft-1, hard-2
QL3 Color of leaf surface At flowering stage Green-1, green/purple-2, purple-3, deep purple-4
QL4 Color of reverse side of leaf At flowering stage Green-1, green/purple-2, purple-3, deep purple-4
QL5 Color of stem At flowering stage Green-1, green/purple-2, purple-3
QL6 Degree of pubescence At flowering stage Slightly purbescent-1, purbescent-2, heavily purbescent-3
QL7 Color of flower At flowering stage White-1, white/purple-2, purple-3
QL8 Shape of leaf At flowering stage Wrinkle-1, none wrinkle-2
QL9 Seed size After harvest Large (>2 mm)-1, small (<2 mm)-2

z)QN: quantitative, QL: qualitative.

Morphological characterization of cultivated and weedy types of Perilla crop in Jeju Island of Korea.

Morphological characterz) Var. frutescens Var. crispa


Cultivated type Weedy type Weedy type
QN1 (days from seeding to flowering) 137.8±6.7 (126.0–143.0) 134.6±2.7 (129.0–143.0) 137.8±3.3 (133.0–140.0)
QN2 (plant height) 151.7±14.2 (136.0–177.0) 163.1±15.6 (119.0–195.5) 159.3±8.3 (148.0–168.0)
QN3 (number of internodes) 15.8±1.3 (14.0–18.0) 17.1±1.3 (13.0–20.0) 16.3±1.0 (15.0–17.0)
QN4 (length of the largest inflorescence) 5.7±0.5 (5.0–6.0) 9.3±2.1 (5.0–15.5) 7.3±1.3 (6.0–9.0)

QL1 (seed color) White (2), brown (4) Gray (1), brown (1), dark brown (73) Gray (2), dark brown (2)
QL2 (seed hardness) Soft (1), hard (5) Hard (75) Hard (4)
QL3 (color of surface leaf) Green (6) Green (73), pale purple (2) Green (2), purple (1), deep purple (1)
QL4 (color of reverse leaf) Green (6) Green (69), pale purple (6) Purple (1), deep purple (3)
QL5 (color of stem) Green (6) Green (60), pale purple (15), Pale purple (2), purple (2)
QL6 (degree of pubescence) Pubescent (6) Slightly pubescent (16), pubescent (55), havily pubescent (4) Slightly pubescent (4)
QL7 (flower color) White (6) White (68), purple (7) Purple (4)
QL8 (leaf shape) None wrinkle (6) None wrinkle (75) None wrinkle (3), wrinkle (1)
QL9 (sseed size) Large (6) Small (75) Small (4)

Values are presented as mean±standard deviation (range) or number only.

z)QN: quantitative, QL: qualitative.

Characteristics of the 17 simple sequence repeat loci including repeat motif, allele size range, allele numbers and gene diversity among 85 accessions of cultivated and weedy types of Perilla crop in Jeju Island.

SSR loci Primer sequence Repeat motif Allele size range (bp) No. of alleles MAFz) GD PIC
KWPE-5 F - ATCTCCAAGCTTATGAATGC
R - CTGGTAGTGAGCCTGTTCAT
[(ATG)6(GA)5] 222–250 11 0.306 0.781 0.750
KWPE-19 F - CAACCCTTCACGATCACTAT
R - AAATAACGGCCGATTCTAC
(ACG)7 226–249 12 0.612 0.597 0.575
KWPE-25 F - ACATTTAAGAGAGAGAGCAAG
R - ACGAACGGGCTTCAATCTT
[(GT)8(GA)14] 212–240 9 0.306 0.803 0.777
KWPE-26 F - GAGGCAATGCTGGTACTTC
R - GAACGGGCTTCAATCTTC
[(AG)6(AG)7(GA)13] 240–280 7 0.318 0.766 0.728
KWPE-29 F - AAGACAAGGAGGAAGATGC
R - ATAGGTGTTCGCTCTCCTGTG
(GAA)5 217–236 10 0.224 0.839 0.819
KWPE-32 F - AGAACAACATTGTAGCTCGG
R - ACGACCAACCAGTAGATGAT
(CCT)4 220–228 4 0.729 0.442 0.414
KWPE-39 F - AGAACAACATTGTAGCTCGG
R - GACGAACCAGCAAACGAC
(CCT)4 198–230 5 0.765 0.396 0.374
KWPE-48 F - CACCCCATCTTTTTGGAT
R - AGCAGGATGGTGGTGGTC
(GA)9 214–220 5 0.471 0.659 0.600
KWPE-53 F - ACTCACCAGAAGAGAAGAAG
A R - GCCACTGACCTGTTAATATCTG
(CT)16 187–215 14 0.200 0.891 0.880
KWPE-56 F - AAGCAGTGGACTGATTGTTT
R - ACAAAATCCAATTACTTTCTGC
(TG)9 92–98 5 0.694 0.479 0.441
KWPE-57 F - ATCACATCTCTCTCTTTCTGGA
R - CCAGTCACTCCATCATCTCTA
(CT)16 150–210 17 0.176 0.890 0.880
KWPE-58 F - AGAGAGTTACCTGCGATTTTC
R - CTTCAATATTCGGCCATCTT
(TG)9-(GA)13 161–190 10 0.271 0.833 0.813
GBPFM-70 F - CCCTCCAAATCAATATTCCA
R - TAGCTGCCATACGAACATGA
(ATTTG)3, (AC)5 230–240 3 0.647 0.465 0.367
GBPFM-75 F - CATAGTTCATGGCTTCCACC
R - CCTGAGCACAGAAACAGATCA
(CT)12 148–260 7 0.435 0.709 0.666
GBPFM-91 F - CCACTCAAATCCGCTTCTAA
R - AATGTTGGTTGCGTTTCATT
(AG)9 223–235 4 0.765 0.375 0.327
GBPFM-111 F - ATCATGGATGAATCGCACTT
R - CATTCTCCAAATGTTACTCTATTT
(ACACA)8 160–195 5 0.729 0.444 0.418
GBPFM-203 F - GTTTTGTTGCAGCTCGATTT
R - TGGGTTTGGAAAGTATTGATG
[(GA)5TAA(AG)26] 147–225 21 0.388 0.817 0.806
Average 8.8 0.473 0.658 0.626

z)MAF: major allele frequency, GD: genetic diversity, PIC: polymorphic information content.

Estimates of genetic diversity and allele number of 17 SSR loci among cultivated and weedy types of Perilla crop in Jeju Island.

SSRz) locus Number of alleles/Genetic diversity

Cultivated var. frutescens (n=6) Weedy var. frutescens (n=75) Weedy var. crispa (n=4)
KWPE5 3/0.500 10/0.762 3/0.625
KWPE19 3/0.611 11/0.609 1/0.000
KWPE25 1/0.000 9/0.821 3/0.625
KWPE26 3/0.500 6/0.767 3/0.625
KWPE29 2/0.444 10/0.820 2/0.375
KWPE32 2/0.444 4/0.325 3/0.625
KWPE39 1/0.000 5/0.438 1/0.000
KWPE48 2/0.278 5/0.674 2/0.375
KWPE53 4/0.722 14/0.879 3/0.625
KWPE56 2/0.278 5/0.497 2/0.375
KWPE57 2/0.444 17/0.898 3/0.625
KWPE58 2/0.444 10/0.843 3/0.625
GBPFM70 1/0.000 3/0.410 2/0.375
GBPFM75 3/0.611 7/0.686 3/0.625
GBPFM91 1/0.000 4/0.391 2/0.375
GBPFM111 1/0.000 5/0.420 3/0.625
GBPFM203 4/0.611 20/0.790 2/0.375
Average 2.1/0.346 8.5/0.649 2.4/0.463

z)SSR: simple sequence repeat.

Table 1 Collection sites of Perilla samples in Jeju-do, Republic of Korea.

This mark indicated the accessions used for morphological and simple sequence repeat analysis.

Table 2 Characters used in the morphological analysis of Perilla crop.

QN: quantitative, QL: qualitative.

Table 3 Morphological characterization of cultivated and weedy types of Perilla crop in Jeju Island of Korea.

Values are presented as mean±standard deviation (range) or number only.

QN: quantitative, QL: qualitative.

Table 4 Characteristics of the 17 simple sequence repeat loci including repeat motif, allele size range, allele numbers and gene diversity among 85 accessions of cultivated and weedy types of Perilla crop in Jeju Island.

MAF: major allele frequency, GD: genetic diversity, PIC: polymorphic information content.

Table 5 Estimates of genetic diversity and allele number of 17 SSR loci among cultivated and weedy types of Perilla crop in Jeju Island.

SSR: simple sequence repeat.