Abstract
Tomato (Solanum lycopersicum L.) is an economically important crop worldwide. In addition, tomato serves as an excellent model system for plant genetics and biology, including fruit biology, abiotic stress tolerance, and plant-microbe interactions. Development and practical use of molecular markers have been actively pursued in molecular breeding programs for tomato, especially for disease resistance to allow selection of a single resistance gene and combination of multiple resistance genes. Due to insufficient genetic variation in cultivated tomatoes, various wild relatives of tomato have been investigated and utilized as disease resistance sources. In order to pursue the resistance provided by these wild relatives in developing new tomato varieties, molecular markers have been developed and intensively utilized in tomato breeding programs. In this review, we summarize the currently available molecular markers that confer resistance against major tomato diseases, including Tomato yellow leaf curl virus (TYLCV), Tomato spotted wilt virus (TSWV), Tomato mosaic virus (ToMV), verticillium wilt, fusarium wilt, late blight caused by Phytophthora infestans, leaf mold caused by Cladosporium fulvum, root-knot caused by Meloidogyne spp., bacterial spot caused by Xanthomonas spp., and bacterial speck caused by Pseudomonas syringae. The provided marker information is expected to contribute to development of marker-assisted selection for disease resistance and to exploration of novel genetic sources for a tomato breeding program.
-
Key words: Disease resistance, Marker-assisted breeding, SNP, Gene-based marker, Tomato breeding
INTRODUCTION
Tomato (
Solanum lycopersicum L.) is an economically important crop worldwide, and it has been estimated that 5 million hectares of tomatoes are grown annually worldwide, producing more than 160 million tons of tomatoes (Food and Agriculture Organization 2013). Tomato also serves as an excellent academic model system for plant genetics and biology, especially for studying fruit biology, abiotic stress tolerance, and plant-microbe interactions. Development and practical use of molecular markers have been actively pursued in molecular breeding programs for tomato (
Martin et al. 1993;
Tanksley et al. 1995). Marker-assisted selection (MAS) and marker-assisted breeding (MAB) has been widely and successfully deployed in tomato breeding programs, especially for disease resistance, which allows selection of a single resistance gene and combination of multiple resistance genes (
Foolad and Sharma 2005;
Arens et al. 2010).
Various technological advancements have accelerated the investigation of the whole genome and genetic loci of interest. Single nucleotide polymorphisms (SNPs) are among the most common types of genetic variation and have been widely utilized in genomics for genome mapping, phylogenetic analysis, association studies, and tagging genes of interest (
Jehan and Lakhanpaul 2006;
Caicedo et al. 2007). Numerous verified SNPs have been successfully used to develop tomato cultivars for public and commercial use (Yang
et al. 2004;
Labate and Baldo 2005). Practical DNA markers can be applied in multiple types of breeding programs such as cultivar identification, parental line selection, and selection of progenies in segregating populations (
Yeam et al. 2005;
Lagudah et al. 2009). The release of the tomato genome sequence has expedited characterization of SNPs, allowing SNPs to be the most effective and useful genetic markers in modern tomato breeding programs (
Tomato genome consortium 2012). Use of gene-based markers, which have increased due to the emergence of high-quality genome sequence information, is clearly advantageous for increasing the accuracy of MAS compared with utilization of markers generated based on DNA polymorphisms located adjacent to the gene of interest (
Salgotra et al. 2014).
Despite decades of intensive efforts in disease resistance tomato breeding programs, a large number of diseases still threaten tomato production industries. Major diseases that challenge tomato production include
Tomato yellow leaf curl virus (TYLCV),
Tomato spotted wilt virus (TSWV),
Tomato mosaic virus (ToMV), verticillium wilt caused by
Verticillium spp., fusarium wilt caused by
Fusarium oxysporum, late blight caused by
Phytophthora infestans, leaf mold caused by
Cladosporium fulvum, root-knot caused by
Meloidogyne spp., bacterial spot caused by
Xanthomonas spp., and bacterial speck caused by
Pseudomonas syringae. Due to the intensive breeding efforts aimed at improving economically valuable traits, cultivated tomatoes have little variation in their gene pool. Hence, various wild relatives, including
S. pimpinellifolium,
S. pennellii,
S. habrochaites,
S. peruvianum, and
S. chilense, have been investigated for use as disease resistance sources (
Peirce 1971;
Stevens et al. 1991;
Zamir et al. 1994;
Diwan et al. 1999). To pursue the resistance provided by these wild relatives in developing new tomato varieties, molecular markers have been developed and utilized in tomato breeding programs. In this review, we summarize the currently available molecular markers that confer resistance against each of the indicated diseases.
Tomato yellow leaf curl virus (TYLCV), which is transmitted by the whitefly (
Bemisia tabaci), is one of the most serious threats to tomato production worldwide. In Korea, TYLCV incidence was first reported in Tong- Young, Gyoengsangnamdo in 2008 and has spread rapidly throughout the country (
Lee et al. 2010). TYLCV, which is a member of the genus Begomovirus within the family Geminiviridae, is a DNA virus with a genome of approximately 2.7–2.8 kb (
Cohen and Harpaz 1964;
Delatte et al. 2005). Several sources of TYLCV disease resistance have been identified among wild tomato species. Two major resistance loci on chromosome 6 were originated from
S. chilense: Ty1 from “LA1969” and
Ty3 from “LA1932” and “LA2779” (
Zamir et al. 1994;
Agrama and Scott 2006;
Ji et al. 2007). Recently, a gene responsible for
Ty1 resistance was identified as a DFDGD-class RNA-dependent RNA polymerase and was demonstrated to be allelic with
Ty3 resistance (
Verlaan et al. 2013).
Ty2 resistance originated from
S. habrochaites “B6013” and was recently mapped to a 300-kb interval on chromosome 11 (
Hanson et al. 2000;
Ji et al. 2009a;
Yang et al. 2014).
Ty4 was identified on chromosome 3 as an additional resistance locus in
Ty3-carrying
S. chilense “LA1932” and “LA2779” (
Ji et al. 2009b). A recessive resistance locus located on chromosome 4, termed
ty5, was identified in
S. peruvianum (
Friedmann et al. 1998;
Anbinder et al. 2009). Recently, a gene responsible for
ty5 resistance has been identified as a
Pelo gene, which is the messenger RNA surveillance factor Pelota implicated in the ribosome recycling phase of protein synthesis (
Lapidot et al. 2015). Furthermore,
Ty6 on chromosome 10 appears to be a recessive resistance gene and has been additionally identified in
Ty3-carrying
S. chilense “LA2779” (
Scott et al. 2015).
DNA markers for these TYLCV resistance genes are listed in
Table 1. Since
Ty1 and
Ty3 were independently identified from different tomato accessions, different DNA markers that were closely linked to
Ty1 or
Ty3 were used in tomato breeding programs. However, it was recently confirmed that these two are in allelic relationship at a single locus (
Verlaan et al. 2013;
Caro et al. 2015). Resistance spectra and levels conferred by
Ty1 and
Ty3 are currently under investigation. In the case of
Ty2 resistance, a sequence characterized amplified regions (SCAR) marker, T0302, was used reliably for the selection. However, it was recently mapped to a 300-kb interval on chromosome 11, gene identification that would allow development of gene-based marker is in progress (
Wolters et al. 2015). A gene-based derived-cleaved amplified polymorphic sequences (dCAPS) marker for
ty5 (
Table 1) was developed based on the information given by
Lapidot et al. (2015).
TSWV is a negative RNA virus belonging to the genus
Tospovirus within the family
Bunyaviridae. TSWV is effectively transmitted by thrips, and disease symptoms include bronzing, curling, necrotic spots and streaks, and stunting of stems and leaves (
German et al. 1992). The wide host range of TSWV covers several hundred species in both monocotyledons and dicotyledons worldwide (
Pappu et al. 2009).
Tomato chlorotic spot virus (TCSV) and
groundnut ringspot virus (GRSV), which are closely related to TSWV, also cause damage in the tomato production (
Brommonschenkel et al. 2000).
Sources that are resistant to
Tospoviruses have been found in diverse cultivars of
S. lycopersicum (
Saidi 2008). Some resistance genes for TSWV have also been identified in
S. habrochaites (previously
L. hirsutum “PI127826” and “LA1353”) and in
S. habrochaites var.
glabratum (“PI134417” and “LA1223”). To date, eight TSWV resistance genes (
Sw1a,
Sw1b,
sw2,
sw3,
sw4,
Sw-5,
Sw-6, and
Sw-7) have been reported (
Finlay 1953;
Price et al. 2007;
Saidi and Warade 2008). Among these TSWV resistance genes,
Sw-5 is the one that has been intensively studied and has been actively utilized in developing TSWV-resistant tomato varieties.
Sw-5 resistance was characterized in
S. peruvianum on chromosome 9 (
Van Zijl et al. 1985;
Stevens et al. 1991) and is known to confer a broad resistance against Tospoviruses, including TSWV, TCSV, and GRSV (
Boiteux and Giordano 1993). The
Sw-5 protein consists of a coiled-coil (CC) domain, a nucleotide-binding adapter (NB), and a leucine-rich repeat (LRR) domain (
Spassova et al. 2001). Gene-based markers for
Sw-5 are listed in
Table 2. Markers for
Sw-5 can be chosen and applied to the breeding programs, depending on the detection method of the user’s choice.
ToMV, which belongs to the genus
Tobamovirus within the family
Virgaviridae, has a positive sense RNA genome. Two resistance genes,
Tm-1 and
Tm-2, that confer resistance against ToMV have been introgressed to cultivated tomatoes. The
Tm-1 gene, which displays semi-dominant inheritance, was originally identified from
S. habrochites “PI126445” (
Pelham 1966;
Watanabe et al. 1987). Tm-1 protein does not share any functional domain with previously known resistance (R) proteins but physically binds to and functionally inhibits the replication proteins of ToMV (
Ishibashi et al. 2007). The
Tm-2 resistance gene was characterized in
S. peruvianum and found to confer a higher level of resistance compared to that conferred by
Tm-1. The
Tm-2 and the
Tm-22 resistance genes are considered to be allelic (
Pelham 1966;
Young and Tanksley 1989), and the
Tm-22 resistance gene is more durable than the
Tm-2 resistance gene (
Fraser 1990). Consequently,
Tm-22 is both practically and economically important and thus is employed as a ToMV resistance source in tomato breeding programs. Both
Tm-2 and
Tm-22 encode a member of the coiled-coil/nucleotide binding-ARC/LRR protein class of plant resistance (
R) genes (
Lanfermeijer et al. 2003). The
Tm-22 and
Tm-2 open reading frames only differ by seven nucleotides, resulting in four amino acid differences at the protein level. Two of these differences are located in the nucleotide-binding site, and two are located in the LRR domain (
Lanfermeijer et al. 2005). ToMV allele-specific DNA markers derived from these above mentioned gene sequences are listed in
Table 3.
Tomato verticillium wilt, which is also called vascular wilt disease, is a soil-born fungal disease caused by
Verticillium dahliae and
V. alboatrum, which are also responsible for the vascular wilt disease in over 200 dicotyledonous species (
Fradin and Thomma 2006). A single dominant gene on chromosome 9,
Ve, was reported to confer effective resistance against
V. alboatrum race 1 (
Schaible et al. 1951;
Diwan et al. 1999). The
Ve locus contains two closely linked, inversely oriented genes,
Ve1 and
Ve2, and the resistance spectrums of these resistance genes have been determined (
Kawchuk et al. 2001;
Fradin et al. 2009).
Ve1 resistance is conferred by the extracellular LRR receptor-like protein class of disease resistance proteins (
Kawchuk et al. 2001), which appear critical for switching on effector-triggered immunity in the host plant. Various allele-specific molecular markers for
Ve1 and
Ve2 have been reported (
Table 4; Acciarri
et al. 2007; Kuklev
et al. 2009;
Jung et al. 2015). Among the DNA variations between the
Ve1 resistance allele and the
ve1 susceptibility allele, a single-bp deletion, TCA/T-A at nucleotide position 1,220, results in a premature stop codon in the
ve1 susceptibility allele, which is subsequently linked with loss of function and disease resistance (
Kawchuk et al. 2001;
Jung et al. 2015). Therefore, the gene-based CAPS marker derived from the single-bp deletion listed in
Table 4 can be considered as a functional marker for the
Ve1 resistance locus.
The fungus
Fusarium oxysporum causes devastating wilt diseases in many important crops, and specifically,
F. oxysporum f. sp. Lycopersici (
Fol) causes fusarium wilt of tomato. Three races of
Fol, race 1, 2, and 3, have been identified (
Bohn and Tucker 1939;
Grattidge and O’Brien 1982). Resistance against
Fol has been characterized in multiple wild species of tomato. The
I gene was identified in the wild tomato
S. pimpinellifolium accession “PI79532” and confers resistance against
Fol race 1 (
Bohn and Tucker 1939). The
I-2 gene, which confers resistance to
Fol race 2, was identified in an
S. lycopersicum ×
S. pimpinellifolium hybrid “PI126915”, and this gene encodes a coiled coil, nucleotide-binding (CC-NB)-LRR resistance protein (
Stall and Walter 1965;
Simons et al. 1998).
I-3 resistance to
Fol race 3 was identified in
S. pennellii “LA716” (
Scott and Jones 1989) and encodes an S-receptor-like kinase (SRLK) protein (
Lim et al. 2008;
Catanzariti et al. 2015). Furthermore, the
I-7 resistance gene, which confers resistance to
Fol race 1, 2, and 3, was identified in
S. pennellii “PI414773” and encodes typical extracellular LRR receptor-like protein (LRR-RLP) (
Lim et al. 2006;
Gonzalez-Cendales et al. 2015). DNA markers for these resistance genes are listed in
Table 5, and most of these markers are gene-based markers.
Late blight (LB) in tomato is caused by
Phytophthora infestans, which also causes devastating LB in the potato. Although LB resistance in the potato has been extensively studied and more than 60 resistance genes have been characterized and/or located on the genetic map (Rodewald and Trognitz 2013), a few race-specific LB resistance loci have been characterized in the tomato. Two race-specific resistance genes,
Ph1 and
Ph2, from
S. pimpinellifolium were mapped to chromosome 7 and 10, respectively (
Peirce 1971;
Moreau et al. 1998;
Foolad et al. 2008). Another resistance gene from
S. pimpinellifolium “L3708”,
Ph3, which is the most effective LB resistance gene among the known genetic sources, confers incomplete resistance against a wide range of
P. infestans isolates (
Black et al. 1996;
Kim and Mutschler 2006;
Zhang et al. 2013). The
Ph3 gene on chromosome 9 encodes a coiled-coil nucleotide-binding (NBS)-LRR (
Zhang et al. 2014).
Ph4 on chromosome 2 was discovered in
S. habrochaites LA1033 (
Kole et al. 2006), and
Ph5-1 and
Ph5-2, which were discovered from a novel resistance source
S. pimpinellifolium “PSLP153”, are located on chromosome 1 and 10, respectively (
Merk et al. 2012;
Merk and Foolad 2012). DNA markers for the major LB resistance genes,
Ph2 and
Ph3, are listed in
Table 6. In case of
Ph3, a gene-based SCAR marker was developed based on two 11 bp deletions separated by 56 bp that generate a premature stop codon in the
ph3 susceptible genotype. Therefore, the gene-based SCAR marker can be considered as a functional marker for the
Ph3 resistance locus. In addition to these single dominant resistance genes, quantitative trait loci (QTL) that confer resistance to LB have also been identified in
S. habrochaites and
S. penellii (
Brouwer and St Clair 2004;
Smart et al. 2007;
Li et al. 2011; Cai
et al. 2012).
Leaf mold of tomato, which is caused by the fungus
Cladosporium fulvum, is a worldwide problem in greenhouse conditions, particularly in areas with high humidity and moderate temperatures (
Rivas and Thomas 2005). The genes conferring resistance against
C. fulvum, the
Cf genes, have been introduced into commercially grown tomato cultivars (
Rivas and Thomas 2005). Among the multiple
Cf resistance genes that originate from wild species,
Cf-2,
Cf-4,
Cf-4E,
Cf-5, and
Cf-9 genes have been most intensively studied (
Jones et al. 1994;
Dixon et al. 1996;
Thomas et al. 1997;
Dixon et al. 1998;
Takken et al. 1999). The
Cf genes encode membrane-anchored proteins that are largely composed of extracellular LRRs (
Rivas and Thomas 2005). Although the
Cf genes share a high degree of homology, each
Cf gene differs in its specificity for recognizing distinct fungal effectors. The
Cf genes,
Cf-2,
Cf-4,
Cf-4E,
Cf-5, and
Cf-9, trigger a race-specific hypersensitive response (HR) upon plant invasion by
C. fulvum that secrets the avirulence factors
Avr2,
Avr4,
Avr4E,
Avr5, and
Avr9, respectively (
Jones et al. 1994;
Dixon et al. 1996;
Thomas et al. 1997;
Dixon et al. 1998;
Takken et al. 1999). Both
Cf-4 from
S. habrochaites and
Cf-9 from
S. pimpinellifolium are located at the same locus on chromosome 1 in an array of five paralogs (
Parniske et al. 1997).
Cf-2 from
S. pimpinellifolium and
Cf-5 from the landrace of
S. lycopersicum (formerly
L. esculentum var. cerasiforme) are located in a complex locus on chromosome 6 and consist of seven
Cf-2/Cf-5 gene family homologs, which vary in LRR copy number from 25 to 38 (
Dixon et al. 1998). A DNA marker for
Cf-9 resistance gene is listed in
Table 7. Although the genes that encode
Cf-2,
Cf-4,
Cf-4E,
Cf-5, and
Cf-9 have been cloned and characterized decades ago, precise MAS in differentiating each
Cf gene has been plagued by technical difficulties, due to the existence of the gene families and complex chimeric sequences.
RKNs of the genus
Meloidogyne cause major economic damage to crops around the world (Williamson and Hussey 1996). These nematodes penetrate the roots and migrate to the vascular cylinder, resulting in the formation of root-knots, which affect nutrient partitioning and water uptake in the plant (
Roberts and May 1986). A single, dominant gene,
Mi-1, which originated in
S. peruvianum “PI128657”, was introgressed into modern tomato varieties (
Castagnone-Sereno et al. 1994).
Mi-1 encodes a CC-NBS-LRR with a nucleotide-binding site and a LRR region and confers resistance to three of the most damaging species of RKN:
M. incognita,
M. arenaria, and
M. javanica. Moreover, this gene also confers resistance to potato aphid and whitefly (
Milligan et al. 1998;
Rossi et al. 1998;
Vos et al. 1998). The
Mi-1 locus consists of two clusters with three and four copies of
Mi gene homologs (
Seah et al. 2007).
Mi-1.2, but not the other homologs, has been suggested to be a functional resistance gene (
Milligan et al. 1998). Other genetic determinants of RKN resistance that have been identified in
S. peruvianum accessions include major/minor QTLs:
Mi-4 linked with
Mi-1 on chromosome 6,
Mi-3 and
Mi-5 on chromosome 12,
Mi-9 on chromosome 6,
Mi-2 linked to
Mi-8, and
Mi-6 linked to
Mi-7 (
Veremis et al. 2000;
Ammiraju et al. 2003). The practical use of these resistance loci, however, has not yet been investigated thoroughly. Allele specific markers for
Mi-1 resistance are listed in
Table 8.
Bacterial spot of tomato, which is caused by a gram-negative bacterium
Xanthomonas campestris pv.
vesicatoria (
Xcv), is one of the most destructive diseases both in the greenhouse and in the field, particularly in warm and humid environments (
Jones et al. 1998). Recently,
Xcv has been re-classified and divided into four distinct species (
X. euvesicatoria,
X. vesicatoria,
X. gardneri, and
X. perforans), which differ in their distribution, metabolic properties, and effector repertoires (
Potnis et al. 2011). Five races (T1 to T5) of
Xcv are recognized by different host genotypes.
Xcv, which causes bacterial spot disease in both pepper and tomato, has been extensively studied. Effector-triggered immunity conferred by single dominant loci, including
Xv3 and
Xv4 (also known as
RXopJ4), are mechanisms of HR resistance.
Xv3 found in
S. lycopersicum “H7981” and
S. pimpinellifolium (accessions “PI126932” and “PI128216”) triggers HR resistance to T3 strains via recognition of the effector avrXv3 (
Wang et al. 2011). A single locus
Rx-4 on chromosome 11 (accession “PI128216”) also confers HR resistance to T3 strains; however, the degree of resistance is significantly affected by the genetic background (
Robbins et al. 2009). Studies on
Xv3 and
Rx-4 indicated that these two genes are closely linked genes that react to the same bacterial effector or alleles of the same locus (
Wang et al. 2011).
Xv4 (
RXopJ4) on chromosome 3 is a dominant resistance locus that originated from
S. pennellii “LA716”, and
Xv4 recognizes the
Xcv effector XopJ4 of T4 strains (
Astua-Monge et al. 2000).
Rx-1 (chromosome 1),
Rx-2 (chromosome 1), and
Rx-3 (chromosome 5) that are responsible for HR-inducing resistance against
Xcv T1 strains were identified in
S. lycopersicum (accession “H7998”;
Scott and Jones 1989); however, only
Rx-3 appears to be effective in conferring field resistance.
Bs4 on chromosome 5, which encodes a NB-LRR protein, recognizes the
Xcv effector AvrBs4 (
Schornack et al. 2004). A number of DNA markers for each
Xcv resistance gene are summarized in
Table 9. QTL that contribute
Xcv resistance have been identified in
S. lycopersicum “PI114490” (
Hutton et al. 2010). In addition, the
Bs2 resistance gene identified in a pepper species is very effective against bacterial spot in transgenic tomato plants (
Tai et al. 1999).
Bacterial speck disease in tomato is caused by
Pseudomonas syringae pv.
tomato. The resistance gene,
Pto, which is a member of a small gene family encoding cytoplasmic serine/threonine protein kinases, is the first disease resistance gene characterized in plants (
Martin et al. 1993). The molecular mechanisms of
Pto resistance have been intensively studied. Indeed, the Pto kinase recognizes and physically interacts with the bacterial effectors AvrPto and AvrPtoB (
Tang et al. 1996;
Shan et al. 2000;
Kim et al. 2002).
Prf, an NBS–LRR gene located within a cluster of five
Pto homologs, is also required for resistance to
P. syringae pv.
tomato (
Salmeron et al. 1996). Among the five
Pto homologs that are tightly clustered and exhibit different functions,
PtoE is the gene responsible for conferring resistance to bacterial speck in tomato (
Kim et al. 2002;
Abramovitch et al. 2006). A gene-based CAPS marker for Pto resistance is summarized in
Table 10. A recent study revealed that several QTLs in
S. habrochites “LA1777” are involved in bacterial speck resistance;
bsRr1-1 on chromosome 1,
bsRr1-2 on chromosome 2,
bsRr1-12a and
bsRr1-12b on chromosome 12 (
Thapa et al. 2015).
CONCLUSIONS
Due to the economic and academic importance of tomato, the genetics and molecular mechanisms of disease resistance to a variety of diseases have been intensively investigated, and the results have contributed to MAS in tomato breeding programs. In addition, extensive use of wild relatives of tomato rather than cultivated tomatoes as resistance sources required the use of molecular markers in order to track the resistance provided by these wild relatives and transfer such resistance to developing new tomato varieties. In this review, we summarized the currently available molecular markers that confer resistance to the major tomato diseases, including TYLCV, TSWV, ToMV, verticillium wilt, fusarium wilt, late blight, leaf mold, root-knot disease, bacterial spot, and bacterial speck. The provided marker information is expected to contribute to advancing MAS for disease resistance and to exploration of novel genetic sources for tomato breeding programs.
ACKNOWLEDGEMENTS
This work was supported by the Golden Seed Project (Center for Horticultural Seed Development, 213003-04-3-SBG10) funded by the Ministry of Agriculture, Food and Rural Affairs.
Table 1DNA markers for selecting resistant tomatoes against TYLCV.
Table 1
|
Resistant locus (chromosome) |
Marker information |
References |
|
Ty1/3 (ch 6) |
F: ATGAAGACAAAAACTGCTTC
R: TCAGGGTTTCACTTCTATGAAT (SspI, BglII, or TaqI) |
CAPS (gene-based) |
, Jung et al. 2015
|
|
Ty1 (ch 6) |
TAA TCC GTC GTT ACC TCT CCT
CGGATGACTTCAATAGCAATGA3′ (TaqI) |
CAPS (closely linked) |
, Hoogstraten et al. 2005
|
|
Ty3 (ch 6) |
P6-25
F: GGTAGTGGAAATGATGCTGCTC
R: GCTCTGCCTATTGTCCCATATATAACC |
SCAR (closely linked) |
, Ji et al. 2007
|
|
Ty2 (ch 11) |
T0302
F: TGG CTC ATC CTG AAG CTG ATA GCG C
R: AGT GTA CAT CCT TGC CAT TGA CT |
SCAR |
, Yang et al. 2014
|
|
Ty4 (ch 3) |
C2_At4g17300 (AflI)
F: ATTTAACCGTGTCTGGGCAACTCAATGG
R: GCTCACTTTGCAAATCACATCCCCATTTCACC
C2_At5g60160 (NlaIII)
F: TTCTCGCGGCCTTTTCTCCTC
R: TCGTGATCGCAAACATATACTCGC |
CAPS |
, Ji et al. 2009
|
|
ty5 (ch 4) |
F: TTCAAGTCCTTCTTCAAC
R: ATAGATTTAAACAACAATTATAGAGATAAAAAAGTTACCTGT (RsaI) |
dCAPS (gene-based) |
, Lapidot et al. 2015; In this study |
Table 2DNA markers for a TSWV resistance gene Sw5 on chromosome 9.
Table 2
|
Resistant locus |
Marker information |
References |
|
Sw5
|
Sw5-2
F: AATTAGGTTCTTGAAGCCCATCT
R: TTCCGCATCAGCCAATAGTGT |
SCAR (gene-based) |
Dianese et al. 2010 |
Sw5b
F: CGGAACCTGTAACTTGACTG
R: GAGCTCTCATCCATTTTCCG |
SCAR (gene-based) |
, Shi et al. 2011
|
Sw5b-SNP1
F: GAGAGAGTTATTACAAGAT
R: TTTCTCCTCAACATGTCGGC |
SNP |
, Shi et al. 2011
|
Sw5b-SNP2
F: GGTATGGGATGACTTAAGGC
R: ACCCACTTCTTCAAGTCGAG |
SNP |
, Shi et al. 2011
|
Sw5b-SNP
F: TTATTGTTTCTCGCTTTGATGTTCG
R: GAACCTGTAACTTGACTGAAAATATC |
HRM* (gene-based) |
, Lee et al. In press
|
Table 3DNA markers for selecting ToMV resistance genes, Tm1 and Tm22.
Table 3
|
Resistant locus |
Marker information |
References |
|
Tm1
|
CCACTGTATGATTTCTGCTAGTGAA
AGCTTTAACAAATATAAGAATAAAGAC
GCAAGCTAAGGTTTACATATATGCC |
SCAR (gene-based) |
, Ishibashi et al. 2007
|
|
Tm22
|
F: GAGTTCTTCCGTTCAAATCCTAAGCTTGAGAAG
R: CTACTACACTCACGTTGCTGTGATGCAC |
CAPS (gene-based) |
, Lanfermeijer et al. 2003
Lanfermeijer et al. 2005
|
SCN131000 (AccI)
F: AGCGTCACTCCATACTTGGAATAA
R: AGCGTCACTCAAAATGTACCCAAA |
CAPS (linked marker) |
, Sobir et al. 2000
|
Table 4DNA markers for selecting verticilium wilt resistance gene Ve on chromosome 9.
Table 4
|
Resistant locus |
Marker information |
References |
|
Ve
|
F: CCATGAACAGATGTGACTTGTGTG
VeR1:AAGTTTCTTATTTTTCCTTCTCC
veR2:CTCTTAGGATTTTTGACGTGATA |
SCAR (linked marker, 0.6 cM) |
Kawchuk et al. 1998 |
F: CGAACTTGAC TACATTGACC CTG
R: CAGTCTTGAAAGGTTGCTCAGCC (XbaI) |
CAPS (gene-based) |
, Jung et al. 2015
|
Table 5DNA markers for selecting resistant tomatoes against Fusarium wilt.
Table 5
|
Resistant locus (chromosome) |
Marker information |
References |
|
I1 (ch 11) |
At2
F: CGAATCTGTATATTACATCCGTCGT
R: GGTGAATACCGATCATAGTCGAG |
SCAR |
, Arens et al. 2010
|
|
I2 (ch 11) |
Z1063
F: ATTTGAAAGCGTGGTATTGC
R: CTTAAACTCACCATTAAATC |
SCAR |
, Arens et al. 2010
|
|
I3 (ch 7) |
P7-43DF1/R1
F: GGTAAAGAGATGCGATGATTATGTGGAG
R: GTCTTTACCACAGGAACTTTATCACC |
SCAR |
, Barillas et al. 2008
|
|
I7 (ch 8) |
Solyc08g077740 (AgeI)
F: AAGAAGTTCCCTTCTTCCCTTA
R: GGAATAACCAAGGGGGTGTT |
CAPS (gene-based) |
, Gonzalez-Cendales et al. 2015
|
Table 6DNA markers for selecting late blight resistance genes Ph2 and Ph3.
Table 6
|
Resistant locus (chromosome) |
Marker information |
References |
|
Ph2 (ch 10) |
dTG63 (HinfI)
F: CTACTCTTTCTATGCAATTTGAATTG
R: AATAATTTTCAACCATAGAATGATT |
CAPS |
, Panthee et al. 2012
|
|
Ph3 (ch 9) |
F: TCG ATC GTA TGT AGA CGA TG
R: AGG CAA ATC TTG AAG AAG CA (MspI) |
CAPS (gene-based) |
, Jung et al. 2015
|
F: CTACTCGTGCAAGAAGGTAC
R: TCCACATCACCTGCCAGTTG |
SCAR (gene-based) |
, Jung et al. 2015
|
Table 7DNA markers for selecting leaf mold resistance gene Cf-9 on chromosome 1.
Table 7
|
Resistant locus |
Marker information |
References |
|
Cf-9
|
F: TGGGAATTTACCCGAAAGAA
R: CCCAATCATTCAGTGCGTTA |
SCAR (gene-based) |
Truong et al. 2011 |
Table 8Allele specific markers at the root-knot nematodes resistance locus Mi-1.
Table 8
|
Resistant alleles |
Marker information |
References |
|
Mi 1 (Rex)
|
F: AACCGTGGACTTTGCTTTGACT
R: TAAGAACAGGGACTCAGAGGATGA (TaqI) |
CAPS (closely linked) |
, Hoogstraten et al. 2005
|
|
Mi-J
|
F: CTACGGAGGATGCAAATAGAA
R: AATCATTATTGTCACACTTCCCC (NtIII) |
CAPS (gene-based) |
, Hoogstraten et al. 2005
|
|
Mi-1.2
|
F: TGG AAA AAT GTT GAA TTT CTT TTG
R: GCA TAC TAT ATG GCT TGT TTA CCC |
SCAR (gene-based) |
, Seah et al. 2007
|
Table 9DNA markers for selecting bacterial spot disease resistant tomatoes.
Table 9
|
Resistant locus (chromosome) |
Marker information |
References |
|
Rx-3 (ch 5) |
Rx3-L1 (BsrBI)
F: CTCCGAGCGAAGAGTCTAGAGTC
R: GAAGGCAAAAGGAAAAGGAGAAGGATGG |
CAPS |
, Yang et al. 2005
|
|
Rx-4 (ch 11) |
pcc12 (6 bp InDel)
F: TCCACATCAAATGCGTTTCT
R: TTCCAATCCTTTCCATTTCG |
InDel (0.07 cM) |
, Pei et al. 2012
|
|
Xv3 (ch 11) |
cLEC-24-C3 (restriction enzyme not indicated)
F: CAGACTGGAGAGTCAAAGGT
R: CCTTGCTGATAATCTGCAAGTTGTTAA |
CAPS |
, Wang et al. 2011
|
SL10027
F: GATCCAGTTTCCCTCTTACCG
R: CCATTAGAGCCAAGACGCTC |
ASPE*
|
, Wang et al. 2011
|
|
Bs4 (ch 5) |
Bs4-A02/B02 (MspI)
F: CTACCATCATCTCTTCAGTACCAACTC
R: GAAATTGGAGGAACCGAGCTCCAG |
CAPS (gene-based) |
, Schornack et al. 2004
|
Bs4-A03/B03 (RsaI)
F: GGGTTGGAGTCCGAAGAGCAGG
R: GACTAACCAACGCAAGTTATTGGACAGG |
CAPS (gene-based) |
, Schornack et al. 2004
|
|
Xv4=RXopJ4 (ch 3) |
J350 (HinfI)
F: CTGCTGGAATTGTAATTATTCACG
R: TTGAGCATAAACAGTCCAAAACAT |
CAPS |
Sharlach et al. 2013 |
|
QTL (ch 11) |
F: CCTCCAAATCCCAAAACTCT
R: TGTTTCATCCACTATCACGA |
SSR |
, Hutton et al. 2010
|
Table 10DNA markers for selecting resistant tomatoes against bacterial speck disease.
References
- Abramovitch RB, Anderson JC, Martin GB. 2006. Bacterial elicitation and evasion of plant innate immunity. Nat Rev Mol Cell Biol. 7: 601-611.
- Agrama HA, Scott JW. 2006. Quantitative trait loci for Tomato yellow leaf curl virus and Tomato mottle virus resistance in tomato. J Am Hortic Sci. 131: 267-272.
- Ammiraju JS, Veremis JC, Huang X, Roberts PA, Kaloshian I. 2003. The heat-stable root-knot nematode resistance gene Mi-9 from Lycopersicon peruvianum is localized on the short arm of chromosome 6. Theor Appl Genet. 106: 478-84.
- Anbinder I, Reuveni M, Azari R, Paran I, Nahon S, Shlomo H, Chen L, Lapidot M, Levin I. 2009. Molecular dissection of Tomato leaf curl virus resistance in tomato line TY172 derived from Solanum peruvianum. Theor Appl Genet. 119: 519-530.
- Arens P, Mansilla C, Deinum D, Cavellini L, Moretti A, Rolland S, van der Schoot H, Calvache D, Ponz F, Collonnier C, Mathis R, Smilde D, Caranta C, Vosman B. 2010. Development and evaluation of robust molecular markers linked to disease resistance in tomato for distinctness, uniformity and stability testing. Theor Appl Genet. 120: 655-664.
- Astua-Monge G, Minsavage GV, Stall RE, Vallejos CE, Davis MJ, Jones JB. 2000. Xv4-vrxv4: a new gene-for-gene interaction identified between Xanthomonas campestris pv. vesicatoria race T3 and wild tomato relative Lycoper-sicon pennellii. Mol Plant Microbe Interact. 13: 1346-1355.
- Barbary A, Djian-Caporalino C, Palloix A, Castagnone-Sereno P. 2015. Host genetic resistance to root-knot nematodes, Meloidogyne spp., in Solanaceae: from genes to the field. Pest Manag Sci.
- Barillas AC, Mejia L, Sanchez-Perez A, Maxwwell DP. 2008. CAPS and SCAR markers for detection of I-3 gene introgression for resistance to Fusarium oxysporum f. sp. lycopersici race 3. Rep Tomato Genet Coop. 11-17.
- Black LL, Wang TC, Hanson PM, Chen JT. 1996. Late blight resistance in four wild tomato accessions: effectiveness in diverse locations and inheritance of resistance. Phytopathology. 86: S24.
- Bohn G, Tucker C. 1939. Immunity to Fusarium wilt in the tomato. Science. 89: 603-604.
- Boiteux L, Giordano LdB. 1993. Genetic basis of resistance against two Tospovirus species in tomato (Lycopersicon esculentum). Euphytica. 71: 151-154.
- Brommonschenkel SH, Frary A, Frary A, Tanksley SD. 2000. The broad-spectrum tospovirus resistance gene Sw-5 of tomato is a homolog of the root-knot nematode resistance gene Mi. Mol Plant-Microbe Interact. 13: 1130-1138.
- Brouwer DJ, St Clair DA. 2004. Fine mapping of three quantitative trait loci for late blight resistance in tomato using near isogenic lines (NILs) and sub NILs. Theor Appl Genet. 108: 628-638.
- Cai G, Restrepo S, Myers K, Zuluaga P, Danies G, Smart C, Fry W. 2013. Gene profiling in partially resistant and susceptible near-isogenic tomatoes in response to late blight in the field. Mol Plant Pathol. 14: 171-184.
- Caicedo AL, Williamson SH, Hernandez RD. 2007. Genome- wide patterns of nucleotide polymorphism in domesticated rice. Plos Genet. 3: 1745-1756.
- Caro M, Verlaan MG, Julián O, Finkers R, Wolters AM, Hutton SF, Scott JW, Kormelink R, Visser RG, Díez MJ, Pérez-de-Castro A, Bai Y. 2015. Assessing the genetic variation of Ty-1 and Ty-3 alleles conferring resistance to tomato yellow leaf curl virus in a broad tomato germplasm. Mol Breed. 35: 132
- Castagnone-Sereno P, Wajnberg E, Bongiovanni M, Leroy F, Dalmasso A. 1994. Genetic variation in Meloidogyne incognita virulence against the tomato Mi resistance gene: evidence from isofemale line selection studies. Theor Appl Genet. 88: 749-753.
- Catanzariti AM, Lim GT, Jones DA. 2015. The tomato I-3 gene: a novel gene for resistance to Fusarium wilt disease. New Phytol. 207: 106-118.
- Cohen S, Harpaz I. 1964. Periodic, rather than continual acquisition of a new tomato virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius). Entomol Exp Appl. 7: 155-166.
- Delatte H, Martin DP, Naze F, Golbach RW, Reynaud B, eterschmitt M, Lett JM. 2005. South West Indian Ocean islands tomato begomovirus populations represent a new major monopartite begomovirus group. J Gen Virol. 86: 1533-1542.
- Diwan N, Fluhr R, Eshed Y, Zamir D, Tanksley SD. 1999. Mapping of Ve in tomato: a gene conferring resistance to the broadspectrum pathogen, Verticillium dahliae race 1. Theor Appl Genet. 98: 315-319.
- Dixon MS, Jones DA, Keddie JS, Thomas CM, Harrison K, Jones JDG. 1996. The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins. Cell. 84: 451-459.
- Dixon MS, Hatzixanthis K, Jones DA, Harrison K, Jones JDG. 1998. The tomato Cf-5 disease resistance gene and six homologs show pronounced allelic variation in leucine-rich repeat copy number. Plant Cell. 10: 1915-1925.
- Finlay K. 1953. Inheritance of spotted wilt resistance in the tomato II. Five genes controlling spotted wilt resistance in four tomato types. Aust J Biol Sci. 6: 153-163.
- Foolad MR, Merk HL, Ashrafi H. 2008. Genetics, genomics and breeding of late blight and early blight resistance in tomato. Crit Rev Plant Sci. 27: 75-107.
- Foolad MR, Panthee DR. 2012. Marker-assisted selection in tomato breeding. Crit Rev Plant Sci. 31: 93-123.
- Foolad MR, Sharma A. 2005. Molecular markers as selection tools in tomato breeding. Acta Hort. 695: 225-240.
- Fradin EF, Thomma BPHJ. 2006. Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol Plant Pathol. 7: 71-86.
- Fradin EF, Zhang Z, Juarez Ayala JC, Castroverde CD, Nazar RN, Robb J, Liu CM, Thomma BP. 2009. Genetic dissection of Verticillium wilt resistance mediated by tomato Ve1. Plant Physiol. 150: 320-332.
- Fraser RSS. 1990. The genetics of resistance to plant viruses. Annu Rev Phytopathol. 28: 179-200.
- Friedmann M, Lapidot M, Cohen S, Pilowsky M. 1998. A novel source of resistance to Tomato yellow leaf curl virus exhibiting a symptomless reaction to viral infection. J Am Soc Hortic Sci. 123: 1004-1007.
- Gonzalez-Cendales Y, Catanzariti AM, Baker B, Mcgrath DJ, Jones DA. 2015. Identification of I-7 expands the repertoire of genes for resistance to Fusarium wilt in tomato to three resistance gene classes. Mol Plant Pathol.
- German TL, Ullman DE, Moyer JW. 1992. Tospoviruses: diagnosis, molecular biology, phylogeny, and vector relationships. Annu Rev Phytopathol. 30: 315-348.
- Grattidge R, O’Brien RG. 1982. Occurrence of a third race of Fusarium wilt of tomatoes in Queensland. Plant Dis. 66: 165-166.
- Hanson PM, Bernacchi D, Green S, Tanksley SD, Muniyappa V, Padmaja VM, Padmaja AS, Chen H, Kuo G, Fang D, Chen J. 2000. Mapping a Wild Tomato Introgression Associated with Tomato Yellow Leaf Curl Virus Resistance in a Cultivated Tomato Line. J Amer Soc Hort Sci. 125: 15-20.
- Hoogstraten Jacobus, Gerardus Joannes, Braun Carl J III. 2005. Methods for coupling resistance alleles in tomato. US patent 20050278804.
- Hutton SF, Scott JW, Yang W, Sim SC, Francis DM, Jones JB. 2010. Identification of QTL associated with resistance to bacterial spot race T4 in tomato. Theor Appl Genet. 121: 1275-1287.
- Ishibashi K, Masuda K, Naito S, Meshi T, Ishikawa M. 2007. An inhibitor of viral RNA replication is encoded by a plant resistance gene. Proc Natl Acad Sci USA. 104: 13833-13838.
- Jehan T, Lakhanpaul S. 2006. Single nucleotide polymorphism (SNP)-Methods and applications in plant genetics: A review. Indian J Biotech. 5: 435-459.
- Ji Y, Schuster DJ, Scott JW. 2007. Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Mol Breed. 20: 271-284.
- Ji Y, Scott JW, Schuster DJ. 2009a. Toward fine mapping of the Tomato yellow leaf curl virus resistance gene Ty-2 on chromosome 11 of tomato. HortScience. 44: 614-618.
- Ji Y, Scott JW, Schuster DJ, Maxwell DP. 2009b. Molecular mapping of Ty-4, a new Tomato yellow leaf curl virus resistance locus on chromosome 3 of tomato. J Amer Soc Hort Sci. 134: 281-288.
- Jones JB, Stall RE, Bouzar H. 1998. Diversity among xanthomonads pathogenic on pepper and tomato. Annu Rev Phytopathol. 36: 41-58.
- Jones DA, Thomas CM, Hammond-Kosack KE, Balint-Kurti PJ, Jones JDG. 1994. Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science. 266: 789-793.
- Jung J, Kim HJ, Lee JM, Oh CS, Lee HJ, Yeam I. 2015. Gene-based molecular marker system for multiple disease resistances in tomato against Tomato yellow leaf curl virus, late blight, and verticillium wilt. Euphytica. 205: 599-613.
- Kawchuk LM, Hachey J, Lynch DR, Kulcsar F, van Rooijen G, Waterer DR, Robertson A, Kokko E, Byers R, Howard RJ, Fischer R, Prufer D. 2001. Tomato Ve disease resistance genes encode cell surface-like receptors. Proc Natl Acad Sci USA. 98: 6511-6515.
- Kim MJ, Mutschler MA. 2006. Characterization of late blight resistance derived from Solanum pimpinellifolium L3708 against multiple isolates of the pathogen Phytophthora infestans. J Amer Soc Hort Sci. 131: 637-645.
- Kim YJ, Lin NC, Martin GB. 2002. Two distinct Pseudomonas effector proteins interact with the Pto kinase and activate plant immunity. Cell. 109: 589-598.
- Kole C, Ashrafi H, Lin G, Foolad M. 2006. Identification and molecular mapping of a new R gene, Ph-4, conferring resistance to late blight in tomato. In: Solanaceae Conference; University of Wisconsin, Madison. Abstract 449.
- Labate JA, Baldo AM. 2005. Tomato SNP discovery by EST mining and resequencing. Mol Breed. 16: 343-349.
- Lagudah ES, Krattinger SG, Herrera-Foesse S, Singh RP, Huerta-Espino J, Spielmeyer W, Brown-Guedira G, Selter LL, Keller B. 2009. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet. 119: 889-898.
- Lanfermeijer FC, Dijkhuis J, Sturre MJ, de Haan P, Hille J. 2003. Cloning and characterization of the durable tomato mosaic virus resistance gene Tm-2(2) from Lycopersicon esculentum. Plant Mol Biol. 52: 1037-1049.
- Lanfermeijer FC, Warmink J, Hille J. 2005. The products of the broken Tm-2 and the durable Tm-2(2) resistance genes from tomato differ in four amino acids. J Exp Bot. 56: 2925-2933.
- Lapidot M, Karniel U, Gelbart D, Fogel D, Evenor D, Kutsher Y, Makhbash Z, Nahon S, Shlomo H, Chen L, Reuveni M, Levin I. 2015. A novel route controlling Begomovirus resistance by the messenger RNA surveillance factor Pelota. PLoS Genet. 11: e1005538
- Lee H, Song W, Kwak HR, Kim J, Park J, Auh CK, Kim DH, Lee K, Lee S, Choi HS. 2010. Phylogenetic analysis and inflow route of Tomato yellow leaf curl virus (TYLCV) and Bemisia tabaci in Korea. Mol Cells. 30: 467-476.
- Lee HJ, Kim BY, Bae C, Kang WH, Kang BC, Yeam I, Oh CS. Development of a single-nucleotide polymorphism marker in the Sw-5b gene conferring disease resistance to Tomato spotted wilt virus in tomato. Kor J Hort Sci Technol. In press.
- Li J, Liu L, Bai Y, Finkers R, Wang F, Du Y, Yang Y, Xie B, Visser RGF, van Heusden AW. 2011. Identification and mapping of quantitative resistance to late blight (Phytophthora infestans) in Solanum habrochaites LA1777. Euphytica. 179: 427-437.
- Lim GTT, Wang GP, Hemming MN, Basuki S, McGrath DJ, Carroll BJ, Jones DA. 2006. Mapping the I-3 gene for resistance to Fusarium wilt in tomato: application of an I-3 marker in tomato improvement and progress towards the cloning of I-3. Australas Plant Pathol. 35: 671-680.
- Lim GTT, Wang GP, Hemming MN, McGrath DJ, Jones DA. 2008. High resolution genetic and physical mapping of the I-3 region of tomato chromosome 7 reveals almost continuous microsynteny with grape chromosome 12 but interspersed microsynteny with duplications on Arabidopsis chromosomes 1, 2–3. Theor Appl Genet. 118: 57-75.
- Martin GB, Brommonschenkel SH, Chunwongse J, Frary A, Ganal MW, Spivey R, Wu T, Earle ED, Tanksley SD. 1993. Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science. 262: 1432-1436.
- Merk HL, Ashrafi H, Foolad MR. 2012. Selective genotyping to identify late blight resistance genes in an accession of the tomato wild species Solanum pimpinellifolium. Euphytica. 187: 63-75.
- Merk HL, Foolad MR. 2012. Parent-offspring correlation estimate of heritability for late blight resistance conferred by an accession of the tomato wild species Solanum pimpinellifolium. Plant Breeding. 131: 203-210.
- Milligan SB, Bodeau J, Yaghoobi J, Kaloshian I, Zabel P, Williamson VM. 1998. The root knot nematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell. 10: 1307-1319.
- Minsavage GV, Dahlbeck D, Whalen MC, Kearney B, Bonas U, Staskawicz BJ, Stall RE. 1990. Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv vesicatoria-pepper interactions. Mol Plant-Microbe Interact. 3: 41-47.
- Minsavage GV, Jones JB, Stall RE. 1996. Cloning and sequencing of an avirulence gene (avrXv3) isolated from Xanthomonas campestris pv. vesicatoria tomato race 3. (Abstr). Phytopathology. 86: S15.
- Moreau P, Thoquet P, Olivier J, Laterrot H, Grimsley N. 1998. Genetic mapping of Ph-2, a single locus controlling partial resistance to Phytophthora infestans in tomato. Mol Plant-Microbe Interact. 11: 259-269.
- Panthee DR, Foolad MR. 2012. A reexamination of molecular markers for use in marker-assisted breeding in tomato. Euphytica. 184: 165-179.
- Pappu HR, Jones RAC, Jain RK. 2009. Global status of tospovirus epidemics in diverse cropping systems: successes achieved and challenges ahead. Virus Res. 141: 219-236.
- Parniske M, Hammond-Kosack KE, Golstein C, Thomas CM, Jones DA, Harrison K, Wulff BB, Jones JD. 1997. Novel disease resistance specificities result from sequence exchange between tandemly repeated genes at the Cf-4/9 locus of tomato. Cell. 91: 821-832.
- Pei C, Wang H, Zhang J, Wang Y, Francis DM, Yang W. 2012. Fine mapping and analysis of a candidate gene in tomato accession PI128216 conferring hypersensitive resistance to bacterial spot race T3. Theor Appl Genet. 124: 533-542.
- Peirce LC. 1971. Linkage tests with Ph conditioning resistance to race 0, Phytophthora infestans. Tomato Genet Coop Rep. 21: 30.
- Pelham J. 1966. Resistance in tomato to Tobacco mosaic virus. Euphytica. 15: 258-267.
- Potnis N, Krasileva K, Chow V, Almeida NF, Patil PB, Ryan RP, Sharlach M, Behlau F, Dow JM, Momol M, White FF, Preston JF, Vinatzer BA, Koebnik R, Setubal JC, Norman DJ, Staskawicz BJ, Jones JB. 2011. Comparative genomics reveals diversity among xanthomonads infecting tomato and pepper. BMC Genomics. 12: 146
- Price DL, Memmott FD, Scott JW, Olson SM, Stevens MR. 2007. Identification of molecular markers linked to a new Tomato spotted wilt virus resistance source in tomato. Tomato Genet Coop. 57: 35-36.
- Rivas S, Thomas CM. 2005. Molecular interactions between tomato and the leaf mold pathogen Cladosporium fulvum. Ann Rev Phytopathol. 43: 395-436.
- Robbins MD, Darrigues A, Sim SC, Masud MA, Francis DM. 2009. Characterization of hypersensitive resistance to bacterial spot race T3 (Xanthomonas perforans) from tomato accession PI 128216. Phytopathology. 99: 1037-1044.
- Roberts PA, May D. 1986. Meloidogyne incognita resistance characteristics in tomato genotypes developed for processing. J Nematol. 18: 353-358.
- Rossi M, Goggin FL, Milligan SB, Kaloshian I, Ullman DE, Williamson VM. 1998. The nematode resistance gene Mi of tomato confers resistance against the potato aphid. Proc Natl Acad Sci USA. 95: 9750-9754.
- Saidi M, Warade SD. 2008. Tomato breeding for resistance to Tomato spotted wilt virus (TSWV): an overview of conventional and molecular approaches. Czech J Genet Plant Breed. 44: 83-92.
- Salgotra RK, Gupta BB, Stewart CN Jr. 2014. From genomics to functional markers in the era of next-generation sequencing. Biotechnol Lett. 36: 417-426.
- Salmeron JM, Oldroyd JED, Rommens CMT, Scofield SR, Kim HS, Lavelle DT, Dahlbeck D, Staskawicz BJ. 1996. Tomato Prf is a member of the leucine-rich repeat class of plant disease resistance genes and lies embedded within the Pto kinase gene cluster. Cell. 86: 123-133.
- Schaible L, Cannon OS, Waddoups B. 1951. Inheritance of resistance to Verticillium wilt in a tomato cross. Phytopathol. 41: 986-990.
- Schornack S, Ballvora A, Gürlebeck D, Peart J, Baulcombe D, Ganal M, Baker B, Bonas U, Lahaye T. 2004. The tomato resistance protein Bs4 is a predicted non-nuclear TIR-NB-LRR protein that mediates defense responses to severely truncated derivatives of AvrBs4 and overexpressed AvrBs3. Plant J. 37: 46-60.
- Scott JW, Jones JB. 1989. Inheritance of resistance to foliar bacterial spot of tomato incited by Xanthomonas campestris pv. vesicatoria. J Am Soc Hortic Sci. 114: 111-114.
- Scott JW, Jones JB, Somodi GC. 1995. Screening tomato accessions for resistance to Xanthomonas campestris pv. vesicatoria, race T3. HortScience. 30: 579-581.
- Scott JW, Jones JP. 1989. Monogenic resistance in tomato to Fusarium oxysporum f. sp. lycopersici race 3. Euphytica. 40: 49-53.
- Scott JW, Hutton SF, Freeman JH. 2015. Fla. 8638B and Fla. 8624 Tomato Breeding Lines with Begomovirus Resistance Genes ty-5 Plus Ty-6 and Ty-6, respectively. HortScience. 50: 1405-1407.
- Seah S, Williamson VM, Garcia BE, Mejía L, Salus MS, Martin CT, Maxwell DP. 2007. Evaluation of a co-dominant SCAR marker for detection of the Mi-1 locus for resistance to root-knot nematode in tomato germplasm. Tomato Genet Coop. 57: 37-40.
- Shan L, Thara VK, Martin GB, Zhou JM, Tang X. 2000. The Pseudomonas AvrPto protein is differentially recognized by tomato and tobacco and is localized to the plant plasma membrane. Plant Cell. 12: 2323-2338.
- Shi A, Vierling R, Grazzini R, Chen P, Caton H, Panthee D. 2011. Identification of molecular markers for Sw-5 gene of Tomato spotted wilt virus resistance. Amer J Biotechnol Mol Sci. 1: 8-16.
- Simons G, Groenendijk J, Wijbrandi J, Reijans M, Groenen J, Diergaarde P, Van der Lee T, Bleeker M, Onstenk J, de Both M, Haring M, Mes J, Cornelissen B, Zabeau M, Vos P. 1998. Dissection of the Fusarium I2 gene cluster in tomato reveals six homologs and one active gene copy. Plant Cell. 10: 1055-1068.
- Smart CD, Tanksley SD, Mayton H, Fry WE. 2007. Resistance to Phytophthora infestans in Lycopersicon pennellii. Plant Dis. 91: 1045-1049.
- Sobir , Ohmori T, Murata M, Motoyoshi F. 2000. Molecular characterization of the SCAR markers tightly linked to the Tm-2 locus of the genus Lycopersicon. Theor Appl Genetics. 101: 64-69.
- Spassova MI, Prins TW, Folkertsma RT, Klein-Lankhorst RM, Hille J, Goldbach RW, Prins M. 2001. The tomato gene Sw5 is a member of the coiled coil, nucleotide binding, leucine-rich repeat class of plant resistance genes and confers resistance to TSWV in tobacco. Mol Breeding. 7: 151-161.
- Stall R, Walter J. 1965. Selection and inheritance of resistance in tomato to isolates of races 1 and 2 of the Fusarium wilt organism. Phytopathology. 55: 1213-1215.
- Stevens M, Scott S, Gergerich R. 1991. Inheritance of a gene for resistance to Tomato spotted wilt virus (TSWV) from Lycopersicon peruvianum Mill. Euphytica. 59: 9-17.
- Tai TH, Dahlbeck D, Clark ET, Gajiwala P, Pasion R, Whalen MC, Stall RE, Staskawicz BJ. 1999. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato. Proc Natl Acad Sci USA. 96: 14153-14158.
- Takken FLW, Thomas CM, Joosten MHAJ, Golstein C, Westerink N, Hille J, et al. 1999. A second gene at the tomato Cf-4 locus confers resistance to Cladosporium fulvum through recognition of a novel avirulence determinant. Plant J. 20: 279-288.
- Tang X, Frederick RD, Zhou J, Halterman DA, Jia Y, Martin GB. 1996. Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science. 274: 2060-2063.
- Tanksley SD, Ganal MW, Martin GB. 1995. Chromosome landing: a paradigm for map-based gene cloning in plants with large genomes. Trends Genet. 11: 63-68.
- Thapa SP, Miyao EM, Michael Davis R, Coaker G. 2015. Identification of QTLs controlling resistance to Pseudo-monas syringae pv. tomato race 1 strains from the wild tomato, Solanum habrochaites LA1777. Theor Appl Genet. 128: 681-692.
- Thomas CM, Jones DA, Parniske M, Harrison K, Balint-Kurti PJ, Hatzixanthis K, et al. 1997. Characterization of the tomato Cf-4 gene for resistance to Cladosporium fulvum identifies sequences that determine recognitional specificity in Cf-4 and Cf-9. Plant Cell. 9: 2209-2224.
- Tomato Genome Consortium2012. The tomato genome sequence provides insights into fleshy fruit evolution. Nature. 485: 635-641.
- Van Zijl J, Bosch S, Coetzee C. 1985. Breeding tomatoes for processing in South Africa. editor. International Symposium on Fruit & Vegetables for Processing 194. Strydom DK, pp. 69-76. Cape Town: Acta Horticulturae.
- Veremis JC, Roberts PA. 2000. Diversity of heat-stable genotype specific resistance to Meloidogyne in Maranon races of Lycopersicon peruvianum complex. Euphytica. 111: 9-16.
- Verlaan MG, Hutton SF, Ibrahem RM, Kormelink R, Visser RGF, Scott JW, Edwards JD, Bai Y. 2013. The Tomato yellow leaf curl virus resistance genes Ty-1 and Ty-3 are allelic and code for DFDGD-class RNA-dependent RNA polymerases. PLoS Genet. 9: e1003399
- Vos P, Simons G, Jesse T, Wijbrandi J, Heinen L, Hogers R, Frijters A, Groenendijk J, Diergaarde P, Reijans M, Fierens-Onstenk J, de Both M, Peleman J, Liharska T, Hontelez J, Zabeau M. 1998. The tomato Mi-1 gene confers resistance to both root-knot nematodes and potato aphids. Nat Biotechnol. 16: 1365-1369.
- Wang JF, Stall RE, Vallejos CE. 1994. Genetic analysis of a complex hypersensitive reaction to bacterial spot in tomato. Phytopathology. 84: 126-132.
- Wang H, Hutton SF, Robbins MD, Sim SC, Scott JW, Yang W, Jones JB, Francis DM. 2011. Molecular mapping of hypersensitive resistance from tomato ‘Hawaii 7981’ to Xanthomonas perforans race T3. Phytopathology. 101: 1217-1223.
- Watanabe Y, Kishibayashi N, Motoyoshi F, Okada Y. 1987. Characterization of Tm-1 gene action on replication of common isolates and a resistance-breaking isolate of TMV. Virology. 161: 527-532.
- Wijkamp I, Almarza N, Goldbach R, Peters D. 1995. Distinct levels of specificity in thrips transmission of tospoviruses. Phytopathology. 85: 1069-1074.
- Wolters AM, Caro M, Dong S, Finkers R, Gao J, Visser RG, Wang X, Du Y, Bai Y. 2015. Detection of an inversion in the Ty-2 region between S. lycopersicum and S. habrochaites by a combination of de novo genome assembly and BAC cloning. Theor Appl Genet. 128: 1987-1997.
- Yang X, Caro M, Hutton SF, Scott JW, Guo Y, Wang X, Rashid MH, Szinay D, de Jong H, Visser RG, Bai Y, Du Y. 2014. Fine mapping of the Tomato yellow leaf curl virus resistance gene Ty-2 on chromosome 11 of tomato. Mol Breed. 34: 749-760.
- Yang W, Francis DM. 2005. Marker-assisted selection for combining resistance to bacterial spot and bacterial speck in tomato. J Amer Soc Hort Sci. 130: 716-721.
- Yang W, Sacks EJ, Lewis Ivey ML, Miller SA, Francis DM. 2005. Resistance in Lycopersicon esculentum intraspecific crosses to race T1 strains of Xanthomonas campestris pv. vesicatoria causing bacterial spot of tomato. Phytopathology. 95: 519-527.
- Yeam I, Kang BC, Lindeman W, Frantz JD, Faber N, Jahn MM. 2005. Allele-specific CAPS markers based on point mutations in resistance alleles at the pvr1 locus encoding eIF4E in Capsicum. Theor Appl Genet. 112: 178-186.
- Young ND, Tanksley SD. 1989. RFLP analysis of the size of chromosomal segments retained around the Tm-2 locus of tomato during backcross breeding. Theor Appl Genet. 77: 353-359.
- Zamir D1, Ekstein-Michelson I, Zakay Y, Navot N, Zeidan M, Sarfatti M, Eshed Y, Harel E, Pleban T, van-Oss H, Kedar N, Rabinowitch HD, Czosnek H. 1994. Mapping and introgression of a Tomato yellow leaf curl virus tolerance gene, Ty-1. Theor Appl Genet. 88: 141-146.
- Zhang C, Liu L, Wang X, Vossen J, Li G, Li T, Zheng Z, Gao J, Guo Y, Visser RG, Li J, Bai Y, Du Y. 2014. The Ph-3 gene from Solanum pimpinellifolium encodes CC-NBS-LRR protein conferring resistance to Phytophthora infestans. Theor Appl Genet. 127: 1353-1364.
- Zhang C, Liu L, Zheng Z, Sun Y, Zhou L, Yang Y, Cheng F, Zhang Z, Wang X, Huang S, Xie B, Du Y, Bai Y, Li J. 2013. Fine mapping of the Ph-3 gene conferring resistance to late blight (Phytophthora infestans) in tomato. Theor Appl Genet. 126: 2643-2653.
