Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

A Rapid and Simple Genotyping Method for Various Plants by Direct-PCR

Plant Breeding and Biotechnology 2013;1(3):290-297.
Published online: September 30, 2013

1Department of Agricultural Biotechnology, National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, Korea

*Corresponding author: Ancheol Chang, abychan@korea.kr, Tel: +82-31-299-1751, Fax: +82-31-299-1722
• Received: July 16, 2013   • Revised: August 21, 2013   • Accepted: August 27, 2013

Copyright © 2013 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 395 Views
  • 2 Download
  • 25 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Tobamovirus fructirugosum (Tomato Brown Rugose Fruit Virus—ToBRFV) is Widely Distributed in Tomato (Solanum lycopersicum) and Pepper (Capsicum annuum) Fields in Colombia
    Juliana Sánchez Yalí, Jeronimo Marulanda Pulgarín, Mauricio Marín Montoya, Pablo Gutiérrez Sánchez
    Journal of Phytopathology.2026;[Epub]     CrossRef
  • A rapid and highly sensitive fluorescent RT-LAMP assay for the detection of Crinivirus flavisolani (potato yellow vein virus - PYVV) in tomato
    Jazmín Gómez, María Coronado, Mauricio Marín
    Archives of Phytopathology and Plant Protection.2026; 59(1): 46.     CrossRef
  • Rapid detection of Kenyan tomato leaf curl virus isolates using probe-enhanced loop-mediated isothermal amplification coupled with a modified DNA extraction method
    Abigarl Ndudzo, Florence Ng’ong’a, Edith K. Avedi, Elijah M. Ateka, Adedapo Olutola Adediji
    PLOS One.2026; 21(5): e0349665.     CrossRef
  • Molecular characterization and phylogenetic analysis of tomato brown rugose fruit virus (ToBRFV) isolates in tomato in Antioquia (Colombia)
    Juliana Sánchez, Pablo A. Gutiérrez, Stefano Panno, Andrea G. Caruso, Salvatore Davino, Mauricio Marín
    Journal of Plant Pathology.2025; 107(4): 1721.     CrossRef
  • Development of a recombinase-aided amplification coupled with lateral flow dipstick assay for tobacco Corynespora leaf spot disease detection
    Dayu Lan, Yanhui Lu, Mingjun Deng, Haiyan Wu, Gaoqing Yuan
    Tropical Plant Pathology.2025;[Epub]     CrossRef
  • Rapid visual field detection of Pratylenchus coffeae in yam tissues via RPA-CRISPR/Cas12a
    Weichao Zhao, Mengli Lin, Yulong He, Jin Gao, Jiangli Zhang, Mingjun Li, Qingxiang Yang
    Crop Protection.2025; 197: 107341.     CrossRef
  • Future perspectives of GMO detection in agriculture: strategies for electrochemical nucleic acid detection
    Ana Kuprešanin, Stefan Jarić, Zorica Novaković, Marko Radović, Marija Pavlović, Teodora Knežić, Ljiljana Šašić Zorić, Ljiljana Janjušević, Zoran Pavlović
    Microchimica Acta.2025;[Epub]     CrossRef
  • A Rapid, Equipment-Free Method for Detecting Avirulence Genes of Pyricularia oryzae Using a Lateral Flow Strip-Based RPA Assay
    Zhongqiang Qi, Fangyi Ju, Yunxia Guo, Yan Du, Junjie Yu, Rongsheng Zhang, Mina Yu, Huijuan Cao, Tianqiao Song, Xiayan Pan, Tingting Dai, Yongfeng Liu
    Plant Disease.2024; 108(8): 2283.     CrossRef
  • A reverse transcription loop-mediated isothermal amplification assay for quick detection of tomato mosaic virus
    Phostine M. Kirasi, Elijah M. Ateka, Edith K. Avedi, Hillary K. Yegon, Bramwel W. Wanjala, Hanu R. Pappu, Adedapo Olutola Adediji
    PLOS ONE.2024; 19(6): e0304497.     CrossRef
  • Rapid detection of apple stem grooving virus from reverse transcription recombinase polymerase amplification with a lateral flow dipstick (RT-RPA-LFD)
    X.Y. Ma, J.H. Bao, J.W. Li, X. Cheng, M.M. Tahir, M.Z. Liu, X. Lu, M.R. Wang, Z.B. Hamborg, D. Zhang
    Acta Horticulturae.2024; (1401): 255.     CrossRef
  • Methodological approaches to gene identification of tea raw materials and raw material composition of tea-based soft drinks
    R. R. Vafin, I. Yu. Mikhailova, I. I. Ageykina
    Food systems.2024; 7(2): 282.     CrossRef
  • One-Step Reverse-Transcription Recombinase-Aided Amplification CRISPR/Cas12a-Based Lateral Flow Assay for Fast Field Screening and Accurate Differentiation of Four Major Tobamoviruses Infecting Tomato and Pepper
    Zhenxing Zhao, Siyuan Wang, Zheng Dong, Qixuan Fan, Rong Lei, Ruirui Kuang, Yongjiang Zhang
    Journal of Agricultural and Food Chemistry.2023;[Epub]     CrossRef
  • A low-cost, portable, dual-function readout device for amplification-based point-of-need diagnostics
    Yiping Zou, Michael Glenn Mason, Jose Ramon Botella, Pablo Ivan Nikel
    Applied and Environmental Microbiology.2023;[Epub]     CrossRef
  • Portable rapid detection of maize chlorotic mottle virus using RT-RAA/CRISPR-Cas12a based lateral flow assay
    Rong Lei, Ruirui Kuang, Xuanzi Peng, Zhiyuan Jiao, Zhenxing Zhao, Haolong Cong, Zaifeng Fan, Yongjiang Zhang
    Frontiers in Plant Science.2023;[Epub]     CrossRef
  • Rapid detection of apple stem grooving virus from reverse transcription recombinase polymerase amplification with a lateral flow dipstick (RT-RPA-LFD)
    Xiaoyan Ma, Junhua Bao, Jinwei Li, Xi Cheng, Muhammad Mobeen Tahir, Meizi Liu, Xian Lu, Minrui Wang, Zhibo Hamborg, Dong Zhang
    Fruit Research.2023;[Epub]     CrossRef
  • Optimization of a simple, low-cost one-step reverse transcription recombinase polymerase amplification method for real-time detection of potato virus A in potato leaves and tubers
    Ravinder Kumar, Priyanka Kaundal, Rahul Kumar Tiwari, Milan Kumar Lal, Hema Kumari, Rakesh Kumar, Vinay Sagar, Brajesh Singh
    3 Biotech.2023;[Epub]     CrossRef
  • Cas12a‐based on‐site, rapid detection of genetically modified crops
    Zhiqiang Duan, Xiaoliang Yang, Xingkun Ji, Ying Chen, Xiaomu Niu, Anping Guo, Jian‐Kang Zhu, Feng Li, Zhaobo Lang, Hui Zhao
    Journal of Integrative Plant Biology.2022; 64(10): 1856.     CrossRef
  • Diagnostics of Infections Produced by the Plant Viruses TMV, TEV, and PVX with CRISPR-Cas12 and CRISPR-Cas13
    María-Carmen Marqués, Javier Sánchez-Vicente, Raúl Ruiz, Roser Montagud-Martínez, Rosa Márquez-Costa, Gustavo Gómez, Alberto Carbonell, José-Antonio Daròs, Guillermo Rodrigo
    ACS Synthetic Biology.2022; 11(7): 2384.     CrossRef
  • Establishment of a one-step reverse transcription recombinase polymerase amplification assay for the detection of potato virus S
    Ravinder Kumar, Priyanka Kaundal, Rahul Kumar Tiwari, Sundaresha Siddappa, Hema Kumari, Milan Kumar Lal, Kailash Chandra Naga, Sanjeev Sharma, Vinay Sagar, Manoj Kumar
    Journal of Virological Methods.2022; 307: 114568.     CrossRef
  • The Potential Use of Isothermal Amplification Assays for In-Field Diagnostics of Plant Pathogens
    Aleksandr V. Ivanov, Irina V. Safenkova, Anatoly V. Zherdev, Boris B. Dzantiev
    Plants.2021; 10(11): 2424.     CrossRef
  • Rapid and sensitive detection of potato virus X by one-step reverse transcription-recombinase polymerase amplification method in potato leaves and dormant tubers
    Ravinder Kumar, Priyanka Kaundal, Rahul Kumar Tiwari, Sundaresha Siddappa, Hema Kumari, Kailash Chandra Naga, Sanjeev Sharma, Manoj Kumar
    Molecular and Cellular Probes.2021; 58: 101743.     CrossRef
  • A Rapid, Equipment-Free Method for DetectingPhytophthora infestansin the Field Using a Lateral Flow Strip-Based Recombinase Polymerase Amplification Assay
    Xinyu Lu, Ying Zheng, Fan Zhang, Jia Yu, Tingting Dai, Rongbo Wang, Yuee Tian, Heng Xu, Danyu Shen, Daolong Dou
    Plant Disease.2020; 104(11): 2774.     CrossRef
  • Direct genotyping from whole blood using alkaline polyethylene glycol
    Xiaonan Liu, Chao Zhang, Kai Hua, Jianping Liang, Hang Li, Ting Ma, Juanli Zhu, Yali Cui
    Analytical Biochemistry.2019; 582: 113351.     CrossRef
  • Rapid detection of potyviruses from crude plant extracts
    Gonçalo Silva, Joshua Oyekanmi, Chukwuemeka K. Nkere, Moritz Bömer, P. Lava Kumar, Susan E. Seal
    Analytical Biochemistry.2018; 546: 17.     CrossRef
  • Multiplex polymerase chain reaction assays for the detection of the zearalenone chemotype of Fusarium species in white and brown rice
    Jae Ho Sim, Fei Tian, Soo Yeon Jung, Joong-Hyuck Auh, Hyang Sook Chun
    International Journal of Food Microbiology.2018; 269: 120.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

A Rapid and Simple Genotyping Method for Various Plants by Direct-PCR
Plant Breed. Biotech.. 2013;1(3):290-297.   Published online September 30, 2013
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
A Rapid and Simple Genotyping Method for Various Plants by Direct-PCR
Plant Breed. Biotech.. 2013;1(3):290-297.   Published online September 30, 2013
Close

Figure

  • 0
  • 1
  • 2
  • 3
A Rapid and Simple Genotyping Method for Various Plants by Direct-PCR
Image Image Image Image
Fig. 1 Working flow chart of direct-PCR for plant genotyping. The newly optimized ‘Alkaline PEG lysis buffer’ was prepared by mixing PEG and NaOH. Each plant leaf tissue punched with 1.0 mm diameter puncher was soaked in 50 μl of the buffer. Vortex briefly and incubate at room temperature for one minute. About 2 ul of lysate of each sample was used for PCR reaction. Various genes were successfully amplified from various plant leaf samples.
Fig. 2 Analyses of PCR products amplified from various plant leaf tissues lysed by different concentration of NaOH. PCR products were loaded on lane 2 to 8 (NaOH concentration 0, 1, 5, 10, 20, 50, 100 mM in 6% PEG200 solution, respectively) and they were compared to those amplified with a commercial direct-PCR kit on lane 1. Each plant leaf sample was lysed in 50 ul of the lysis buffer for one minute at room temperature. A total of 2 ul of each lysate was used for each PCR reaction in a total volume of 20 ul. A. rice, TPI (360bp), B. Arabidopsis, Actin (491bp), C. potato, Actin (320bp). No template control PCR reactions (without lysates) were performed at the same time and no PCR product could be seen from all on the gel (data not shown).
Fig. 3 Direct-PCR amplification of endogenous genes from various plants using the new ‘Alkaline PEG lysis buffer’. A 35-cycle PCR was performed with selected primers for each gene of different plants. PCR product of 3 independent lines of each plant was loaded on lane 1 to 3, respectively. A. Rice TPI, 360bp B. Arabidopsis Actin, 491bp C. Tobacco Actin, 524bp D. Potato Actin, 320bp E. Tomato Actin, 247bp F. Chrysanthemum Actin, 243bp G. Rape Actin, 512bp. No template control PCR reactions (without lysates) were performed at the same time and no PCR product could be seen from all on the gel (data not shown). A PCR product of each plant was randomly selected and sequenced. Finally, each of targeted genes was confirmed by blasting at http://blast.ncbi.nlm.nih.gov/Blast.cgi (data not shown).
Fig. 4 Amplification of transgenes from various plant species by direct-PCR. A. Rice, Cry1Ac (658bp) B. Arabidopsis, Hyg (510bp), C. Tobacco, Bar (170bp), D. Potato, Km (NPTII) (249bp), E. Chrysanthemum, Hyg (510bp) F Rape, Bar (170bp). Lane 1 is Wt; wild type and Lane 5 contains no template control PCR reaction. Lane 2 to 4 represents three independent T0 transgenic plant lines of each plant species (A and C to F) or three independent T1 transgenic plant lines of Arabidopsis (B). A PCR product of each plant species was randomly selected and sequenced. Finally, each of target genes was verified by blasting sequences at http://blast.ncbi.nlm.nih.gov/Blast.cgi (data not shown).
A Rapid and Simple Genotyping Method for Various Plants by Direct-PCR

Plant materials and primer sequences used for direct-PCR.

Plant Cultivar Name of gene Size of amplicon (bp) GI No. (NCBI) Primer sequences (5′->3′)
Endogenous genes

Rice Dongjin OsTPI 360 115434515 Forward AGCTAGCCTGCCTTCACTTG
Reverse CGTTATCCCCAGGTTTGGCT
Arabidopsis Columbia-0 AtActin 491 145361675 Forward GGCGATGAAGCTCAATCCAAAC
Reverse GGTCACGACCAGCAAGATCAAG
Tobacco Xanthi NtActin 524 20038 Forward CCCTCCCACATGCTATTCT
Reverse AGAGCCTCCAATCCAGACA
Potato Superior StActin 320 460408873 Forward TCCTCCATTGAAAAGAACTATG
Reverse CCAGACACTGTACTTTCTCTC
Tomato Microtome SlActin 247 460378622 Forward CTCGAGCAGTGTTTCCCAGT
Reverse GGTGCCTCAGTCAGGAGAAC
Chrysanthemum Shinma CmActin 243 475393035 Forward TGCTGACAGGATGAGCAAGG
Reverse GGGCCAGACTCGTCGTATTC
Rape Youngsan BnActin 512 4139263 Forward TCACCATCGGAGCTGAGAGA
Reverse TGGACCCGACTCATCGTACT

Transgenes

Rice Dongjin Cry1Ac 658 22415750 Forward TTGTGGCTCTCTTCCCGAAC
Reverse AACTCGGCAGAACGGTGAAT
Arabidopsis Columbia-0 Hyg 510 34596493 Forward CGTCTGCTGCTCCATACAAG
Chrysanthemum Shinma Reverse GTGCTTGACATTGGGGAGTT
Tobacco Xanthi Bar(ppt) 170 375153555 Forward TACACCCACCTGCTGAAGTC
Rape Youngsan Reverse AAACCCACGTCATGCCAGTT
Potato Superior Km (NptII) 249 19569229 Forward CAAGATGGATTGCACGCAGG
Reverse TTCAGTGACAACGTCGAGCA
Table 1 Plant materials and primer sequences used for direct-PCR.