Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Identification of Xanthomonas campestris pv. campestris races 4 and 9 by Molecular Marker-Based Approach

Plant Breeding and Biotechnology 2024;12:157-174.
Published online: October 28, 2024

1Department of Horticulture, Sunchon National University, Suncheon, Jeonnam 57922, Republic of Korea

2Interdisciplinary Program in IT-Bio Convergence System, Sunchon National University, Jeonnam 57922, Republic of Korea

3Crop Breeding Division, Rural Development Administration, National Institute of Crop Science, Jeollabuk-do, 55365, Republic of Korea

4Graduate School of Life Science, Tohoku University, Sendai, 980-8577, Japan

*Corresponding to Jong-In Park TEL. +82-61-750-3241 E-mail. jipark@scnu.ac.kr
• Received: March 5, 2024   • Revised: October 4, 2024   • Accepted: October 4, 2024

Copyright © 2024 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 15 Views
  • 0 Download
  • 3 Crossref
prev next
  • Black rot, a disease of significance affecting vegetable Brassica crops, is primarily caused by the bacterium Xanthomonas campestris pv. campestris (Xcc). When the disease spreads extensively in the field, it can lead to substantial yield losses, particularly under favorable environmental conditions. Controlling the spread of this disease is challenging, and the primary approach involves utilizing resistant cultivars or disease-free seeds. Among the various methods available for identifying different Xcc races, Polymerase Chain Reaction (PCR)-based molecular markers have proven to be highly reliable. To date, the PCR method has successfully identified Xcc races 1 to 7. In this study, molecular markers were developed for races 4 and 9 through the sequencing and alignment of the whole genome sequences of Xcc races, closely related Xanthomonas campestris (Xc) pathovars, and two Xanthomonas species. These designed markers were subsequently validated by PCR with bacterial genomic DNA samples from Xcc races and 7 other bacteria. The results indicated successful amplification only for race 4 and race 9, yielding amplicon sizes of 1080 bp and 830 bp, respectively, while the other strains failed to amplify. Furthermore, the amplicons from races 4 and 9 were cloned and sequenced, confirming that both races exhibited matching sequences after alignment. Consequently, the molecular marker method offers a rapid and efficient means of differentiating between Xcc races 4 and 9 within a few hours, presenting itself as a viable alternative to conventional methods that rely on the use of differential cultivars of Brassicaceae for identifying Xcc races.
Xanthomonas campestris pathovar campestris (Xcc) is a small, aerobic, rod-shaped, and Gram-negative bacterium, which causes the black rot disease in cabbage and other Brassica vegetables. It is considered the most serious disease that infects almost all the important cruciferous crops such as cabbage, cauliflower, broccoli, brussels sprouts, kohlrabi, and kale as well as the model plant Arabidopsis (An ShiQi et al. 2011; Soengas et al. 2007; Vicente et al. 2001). Xcc enters the plants through the hydathodes and wounded leaves and develops V-shaped yellow lesions with necrotic and blackening veins at the leaf margins (Cook et al. 1952; Williams 1981). In Korea, Xcc is one of the most damaging diseases in cabbage-growing fields (Kim 1986).
Conventional approaches for identifying the causal agent of plant diseases have traditionally involved the utilization of visual symptom assessment, microscopy techniques, and culturing methods (Ward et al. 2004). Nevertheless, reliance on these straightforward, cost-effective, and time-consuming methods can sometimes lead to erroneous conclusions, particularly when there are striking similarities between disease symptoms and the morphological characteristics of pathogens. This inherent limitation highlights the heavy dependence of these methods on prior knowledge and experimental expertise (Nezhad 2014). Up to now, Xcc races have been classified into eleven races based on race determination using the differential cultivars method (Cruz et al. 2017; Fargier et al. 2007; Kamoun et al. 1992; Vicente et al. 2001). Among eleven races, races 1 and 4 are predominant in Brassica oleracea whereas race 6 is predominant in Brassica rapa (Lema et al. 2012; Vicente et al. 2013). Although race 9 of Xanthomonas is not predominant in every part of the world, the recent development in the seed trade between the countries poses a potential threat of spreading the race to other countries. Therefore, it is important to detect the presence of these races. However, the identification of Xcc races based on differential cultivars is time-consuming and labor-intensive. Furthermore, the process of culturing pathogens for identification purposes is time-consuming and, in some cases, not feasible due to the inability to culture certain pathogens (Cardenas et al. 2008; Rinke et al. 2013).
The rapid advancements in molecular biotechnology have carried out the way for the application of rapid and dependable detection methods, including PCR (Ward et al. 2004). The development of race-specific molecular markers with PCR-based techniques is very effective, quick, and simple. Molecular identification of pathogens through PCR saves time (within a few hours) and is less laborious for detecting plant pathogenic bacterial races (Song et al. 2014). The emergence of Next-Generation Sequencing (NGS), has introduced a pioneering approach to diagnostics, and methods for detecting and identifying phytopathogens (Chalupowicz et al. 2019). These advancements have paved the way for DNA-based NGS, which encompasses many steps including variant/mutation annotation and interpretation (Qin 2019). Various variations, including single nucleotide polymorphisms (SNPs), insertions and deletions (INDELs), and structural variations can be discovered using the population genomics datasets based on NGS (Potgieter et al. 2020). These variations can be exploited to design molecular markers and can be used for plant pathogen diagnosis (Afrin et al. 2020; Rubel et al. 2019a). Many researchers have used PCR-based molecular markers to identify bacterial and fungal pathogens. Two (Sequence Characterized Amplified Region) SCAR markers were developed to detect the fungus Fusarium oxysporum f. sp. melonis race 2, caused vascular wilt of cucurbits (Luongo et al. 2012). The new Xanthomonas oryzae pv. oryzae K3a in rice plants was identified using a race-specific marker-based PCR technique (Song et al. 2014). Race 3 of Pseudomonas syringae pv. phaseolicola in halo blight of common bean was identified by PCR-based molecular markers (Schaad et al. 1995). This study aimed to develop a specific molecular marker for the identification of Xcc races 4 and 9.
Bacterial strains and culture conditions
The 16 bacterial strains were used in this study, including nine Xcc races (races 1-9); three Xc pathovars: X. campestris pv. incanae (Xci), X. campestris pv. raphani (Xcr), and X. campestris pv. zinniae (Xcz); two Xanthomonas species: X. axonopodis pv. dieffenbachiae (Xad), and X. campestris pv. vesicatoria (Xcv) and two other plant pathogenic bacteria: Pseudomonas syringae pv. maculicola (Psm), and Erwinia carotovora subsp. carotovora (Ecc) (Table 1). All the bacterial isolates were grown on King's B medium (KB) for 48 hours at 30℃ (King et al. 1954).
Extraction of bacterial genomic DNA
The bacterial DNA was extracted from 16 bacterial strains using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA), according to the manufacturer's instructions. The concentration and quality of all the DNA after extraction were measured using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, USA). Then, the DNA was stored at -20℃ for further experiments.
Whole genome re-sequencing and alignment of Xcc races
The whole genome sequences of Xcc races: race 1 (B100 and CFBP1869), race 3 (ATCC33913), race 4 (CFBP5817), race 9 (str.8004), and Xci (CFBP1606R), Xcr (str.756C) and Xcv (str.85-10) were taken from the National Center for Biotechnology Information (NCBI) database (www.ncbi.nlm.nih.gov). The genomes of races 2, 5, 6, 7, and 8 were sequenced and aligned with the available genome sequences mentioned above using the Integrative Genomics Viewer (IGV) (https://software.broadinstitute.org/software/igv/) to identify the variant regions.
Primer designing and PCR conditions
The flanking DNA sequences near the variant regions were used to design primers using Primer3 (https://primer 3.ut.ee/), thereafter twenty primer pairs were designed (Supplementary Table S1). PCR was performed with a 10 μL reaction mixture containing 1 μL (30 ng μL-1) of DNA, 0.5 μL of each 10 pmol forward and reverse primers, 5 μL of 2X Prime Taq Premix (GenetBio, Daejeon, Korea) and 3 μL of sterile distilled water. The PCR conditions for race 4 and race 9-specific markers were adjusted with denaturation at 94℃ for 2 minutes followed by 30 cycles (94℃ for 20 seconds, 70℃ for 30 seconds, and 72℃ for 20 seconds) and terminated by a final elongation at 72℃ for 2 minutes, 25℃ overnight (Supplementary Table S1). The PCR products were analyzed with gel electrophoresis using 1.5% agarose at 100 V for 30 minutes and visualized with a gel documentation system under UV light (320 nm). The size of PCR products was determined using HiQ 100 bp DNA ladder. Additionally, reported primers for specific amplification of Xcc races 1-7 (Supplementary Table S1) were used for the validation using Xcc race 9 DNA.
Evaluation of the sensitivity and specificity of primers
To evaluate the sensitivity and specificity of 'XccR9-2F2-2R1' primer, 30 ng μL-1 DNA of races 4 and 9 was taken and serially diluted up to 10-4 dilution (30 ng μL-1, 3 ng μL-1, 0.3 ng μL-1, 0.03 ng μL-1, 0.003 ng μL-1). Thereafter, 1 μL of DNA from each dilution was used for PCR amplification using the PCR conditions described above.
Cloning and sequencing of races 4 and 9
The PCR amplicons of Xcc races 4 and 9 using the 'XccR9-2F2-2R1' primer were further cloned and sequenced. The visible bands were excised from the agarose gels (0.8%) and the amplicons were purified in mini-columns using the Wizard SV gel and PCR cleanup system (Promega, Madison, WI, USA). The amplicons were cloned into E. coli (DH5α) using the TOPcloner blunt kit (Enzynomics, Daejeon, Korea) following the manufacturer's instructions. Thereafter, the single colonies grown overnight on solid Luria Bertani (LB) media containing ampicillin (1 mg mL-1) were picked. Subsequently, these selected colonies were cultured in liquid LB media to isolate plasmid DNA. The plasmid DNA isolations were purified with QIAprep Spin Miniprep Kit (50). The alignment of cloned sequences was performed with Multiple Sequence Alignment by ClustalW online (https://www.genome.jp/tools-bin/clustalw). Additionally, the cloned and sequenced amplicons were subjected to ORF prediction using NCBI tool ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/). The predicted ORF sequences were searched for protein homology in the NCBI database using the Blastp tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins).
Bio-PCR assay
The susceptible cabbage lines were artificially inoculated with strains of Xcc races 1 to 9. Three plants for each race were inoculated at 35 days after sowing, and the three youngest leaves were inoculated using the clipping method followed by dipping into a bacterial suspension (108-109 CFU/mL) of Xcc races (Vicente et al. 2001). After 2 weeks, when the symptoms appeared on the leaves, three infected leaves were collected for bio-PCR assay. Afterward, the leaves with black rot symptoms were cut about 1 cm, sliced into small pieces, and soaked in 2 mL of sterile water for 1 hour at room temperature. Following this, 1 mL of bacterial ooze was transferred into a 1.5 mL microcentrifuge tube and incubated at 65℃ for 10 min. Eventually, 5 μL of the exudates were used for the bio-PCR assessment with the PCR condition stated above.
Identification of variant regions and primer designing
The comparison of whole genome sequences, including Xcc races (1-9), two Xc pathovars (Xci and Xcr), and one other Xanthomonas species (Xcv), and the alignment of these available complete genome sequences allowed us to identify the variant regions (Fig. 1). Variant regions specific to Xcc race 4 and race 9 were identified using the Integrative Genomics Viewer (IGV) tool. Flanking genomic sequences of these variants were then utilized to initially design twenty pairs of primers to detect the Xcc races 4 and 9 (Supplementary Table S1). Out of these 20 pairs of primers, only one primer pair namely 'XccR9-2F2-2R1' (forward primer sequence- CGAACAGCAAAGGCAGATACAG; reverse primer sequence - CATGCGCATAGCGGCCCGCCTTG) able to differentiate Xcc races 4 and 9 from Xcc races 1-8, Xc pathovars, Xanthomonas species and other plant pathogenic bacteria. None of the markers developed for Xcc race 1-7 gave a specific reported amplicon with Xcc race 9 DNA (Figs. 2b-2h).
Detection of Xcc races 4 and 9 using 'XccR9-2F2-2R1' primer
In this study, we developed a marker for early and quick detection of Xcc race 4 and race 9. The designed primers were validated with bacterial DNA of Xcc races, Xc pathovars, Xanthomonas species, and other plant pathogenic bacteria by PCR amplifications (Table 1). Among twenty designed primers, only one primer pair 'XccR9-2F2-2R1' was able to differentiate the Xcc race 9 with an amplicon size of 830 bp (Fig. 2i and Supplementary Fig. S1). Interestingly this primer gave an amplicon size of 1080 bp with Xcc race 4 DNA whereas all the other Xcc races (races 1, 2, 3, 5, 6, 7, and 8), Xc pathovars (Xci, Xcr, and Xcz), Xanthomonas species (Xad and Xcv), and other plant pathogenic bacteria (Psm and Ecc) used in this study were unamplified (Fig. 2i). Despite this, the primer pair 'XccR9-2F2-2R1' amplified an amplicon in Xcc race 4 and race 9, but it was able to differentiate between both races (Fig. 2i). Therefore, the primer pair 'XccR9-2F2-2R1' can be used as a diagnostic molecular marker for detecting both races 4 and 9.
Marker sensitivity
We further conducted tests to evaluate the efficiency and sensitivity of the newly developed marker 'XccR9-2F2-2R1'. Remarkably, this marker successfully detected DNA from Xcc race 4 and race 9 even at a very low concentration of 0.003 ng µL-1(Fig. 3).
Cloning and sequencing
Cloning and sequencing of the PCR amplicons produced by the 'XccR9-2F2-2R1' primer in races 4 and 9 DNA revealed a 190 bp deletion in race 9 when compared to race 4. Therefore, this marker can be used proficiently to differentiate race 4 and race 9 with amplicon sizes of 830 bp and 1080 bp, respectively (Supplementary Figs. S2a, S2b).
The cloned and sequenced amplicons were subjected to Open Reading Frame (ORF) prediction using NCBI tool ORF Finder. The number of ORFs found in race 9 and race 4 cloned fragments was six and nine, respectively. The largest ORF found was 843 nucleotides and 630 nucleotides in length and encoded for 280 amino acids and 206 amino acids in race 4 and race 9, respectively (Supplementary Figs. S2c, S2d). This protein has significant homology with the protein-encoding IS5 transposase family, but the protein sequence of the race 9 amplicon has a 71 bp deletion when compared to the protein sequence of the race 4 amplicon (Fig. S2d).
Bio-PCR assessment
A bio-PCR assay was conducted to validate the competency of the developed markers in detecting the presence of Xcc races 4 and 9 from infected leaves. Cabbage leaves were artificially infected with various strains of Xcc races (1-9) strain. None of the samples infected with Xcc races 1, 2, 3, 5, 6, 7, and 8 showed amplification, whereas races 4 and 9 yielded amplicon sizes of 1080 bp and 830 bp, respectively. Therefore, the results demonstrated amplification with a base-pare size equivalent to positive control DNA (gDNA of Xcc race 4 and race 9) (Fig. 4). This finding affirmed the potential of the novel developed marker that can directly detect the bacterial ooze from soaking leaves of cabbage without the genomic DNA extraction of bacteria within a few hours with an accurate and reliable identification.
The establishment of races and differentiation of plant pathogens is associated with the presence of Avr genes in pathogens and its interaction with the corresponding R gene in the plant system, which became the basis of race differentiation using the differential cultivars. However, the system of race differentiation using differential cultivars requires rigorous efforts in growing plants, microbial culturing, optimization of culturing conditions, and skilled personnel. On the other hand, the use of molecular diagnostics of plant pathogens is less tedious. Identifying the race of a plant pathogen is an important criterion for the management of the disease. There have been various reports on the molecular diagnosis of plant-pathogenic bacteria and fungi (Hariharan et al. 2021; Tewari et al. 2019). The utilization of race-specific molecular markers in this study facilitated rapid, reliable, and precise identification of Xcc race 4 and race 9. The availability of genomic sequences for Xcc races (races 1- 9) and other Xc pathovars (Xci, Xcr, and Xcv) simplified the identification of highly variable genomic regions and the development of specific markers for race 4 and race 9 (Fig. 1). Alignment of genome sequences provides useful data about the variants. However, these variants need to be analyzed and interpreted with the help of certain tools. IGV is one of the tools for the visualization and interpretation of variants (Robinson et al. 2017). This study also used the IGV software for variant calling to design the specific primers. The previously developed marker by Rubel et al. (2017) specifically detected Xcc race 4 (Fig. 2e, Supplementary Table S1), whereas our marker provides the advantage of simultaneous detection of Xcc races 4 and 9. The race-specific markers developed in this study provided rapid and effective tools, requiring minimal labor and offering high reliability, for specifically detecting and differentiating races 4 and 9 from other Xcc races. In contrast, the cultivar-based race determination method requires extensive fieldwork and additional labor. Our 'XccR9-2F2-2R1' primer displayed the ability to identify Xcc races 4 and 9 through PCR amplification even at very low concentrations of genomic DNA of races 4 and 9, highlighting the high efficiency and sensitivity of the marker quality (Fig. 3).
Moreover, PCR-based molecular marker techniques have been successfully employed for the detection of bacterial and fungal pathogens. Xanthomonas pathovars were detected in Brassica seeds and plants, and X. campestris was specifically distinguished from other Xanthomonas using PCR (Berg et al. 2005). In Korea, Rubel et al. (2017) developed specific markers using SCAR for the detection of Xcc races 1 and 4. Wang et al. (2010), in China, reported highly reliable PCR-based SCAR markers for detecting wheat stripe rust races CYR32 and CYR33 caused by Puccinia striiformis f. sp. tritici. Pasquali et al. (2007), successfully employed an inter-retrotransposon sequence-characterized amplified region (IR-SCAR) marker to identify race 1 of F. oxysporum f. sp. lactucae in lettuce.
PCR-based methods have also proven effective in identifying other pathogens, including race 3 of Pseudomonas syringae pv. phaseolicola in halo blight of common bean (Schaad et al. 1995), Xcc in black rot disease (Singh et al. 2014), Xoo in rice bacterial blight (Song et al. 2014), and Colletotrichum spp. causing anthracnose disease in sweet persimmon (Iee et al. 2002). Therefore, this PCR-based molecular marker holds promise for the rapid identification of Xcc race 4 and race 9 in cabbage fields affected by black rot disease caused by Xcc worldwide.
Insertion sequences (IS) and transposons play a significant role in bacterial pathogenicity and evolution, including Xanthomonas, by facilitating genome rearrangement (Ferreira et al. 2015). In the case of Xanthomonas, it has been reported that IS elements might potentially introduce inversions and rearrangements, thereby contributing to race diversity (Ochiai et al. 2005). In this study, we conducted sequence analysis of the amplicons from race 4 and race 9 using the 'XccR9-2F2-2R1' marker, which indicated the presence of transposases belonging to the IS5 family. However, the presence of a complete gene in race 4 likely aided its adaptation through genome rearrangement, and further studies are required to confirm the role of this gene.
In conclusion, this study developed a molecular marker-based PCR amplification for the specific identification of races 4 and 9 through the realignment of whole genome sequences of Xcc races (1-9), two Xanthomonas species (Xci and Xcr), and one other Xc pathovar (Xcv). The newly developed marker (XccR9-2F2-2R1) illustrated a quick and reliable detection of race 4 and race 9 among various bacterial strains such as Xcc races, Xanthomonas species, and other plant pathogenic bacteria. Therefore, to our knowledge, this novel marker proved as a useful and rapid diagnostic tool for accurate and reliable detection of Xcc races 4 and 9. Additionally, this marker can be used as an alternative method compared to a traditional one using differential cultivars of Brassicas for race identification, which is time-consuming and labor-intensive.
This study was supported by grants from Ministry of Agriculture, Food and Rural Affairs (MAFRA) (322059- 03-2-HD050) and Regional Innovation Strategy (RIS) through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (MOE) (2021RIS-002). We would thank Dr. Pilar Soengas, Department of Plant Genetics, Spain for providing Xcc race 8. We also thank Dr. Joana G. Vicente, University of Warwick, UK for providing Xcc races (races 1-7) and Xc pathovars. We thank the Korean Agriculture Culture Collection (KACC), Korea for providing Xanthomonas species, and ICMP collection, New Zealand for providing isolates of plant pathogenic bacteria.
Fig. 1
. a) Alignment of the whole genome sequences of Xcc races (1-9), two other Xc. pathovars (incanae and raphani), and another Xanthomonas species (X. campestris pv. vesicatoria); b) Line diagram representation of PCR amplification pattern with XccR9-2F2-2R1 primer; Dashed lines represent deletion region; Solid black bar represents similar genomic regions; Green arrow and blue arrows represent forward and reverse primers, respectively.
PBB-12-157-f1.jpg
Fig. 2
Agarose gel electrophoresis of PCR products of Xcc race 4 and race 9 DNA using race a 9-specific primer, and Xcc race specific primer and specific primer sets of Xcc races 1-7 reported by previous studies. a) Xcc specific (Xcc-53, 930-bp); b) Xcc race 1-specific (Xcc-47R1, 1089-bp); c) Xcc race 2-specific (Xcc-R2-89-2, 929-bp); d) Xcc race 3-specific (XccR3-49, 867-bp); e) Xcc race 4-specific (Xcc2-46R4, 578-bp); f) Xcc race 5-specific (XccR5-89.2, 1515-bp); g) Xcc race 6-specific (XccR6-60, 693-bp); h) Xcc race 7-specific (Race 7-1F-1R, 600-bp); i) Xcc race 9-specific (XccR9-2F2-2R1, 830-bp) amplified from genomic DNA of Xcc races, Xc. pathovars and other plant pathogenic bacteria. Lane M: DNA ladder-100 bp; Lanes 1-9: Xcc races (1-9); Lane 10: X. campestris pv. incanae (WHRI-6377); Lane 11: X. campestris pv. raphani (WHRI-8305); Lane 12: X. campestris pv. zinniae (KACC17126); Lane 13: X. axonopodis pv. dieffenbachiae (KACC17821); Lane 14: X. campestris pv. vesicatoria (KACC11153); Lane 15: Pseudomonas syringae pv. maculicola (ICMP13051); Lane 16: Erwinia carotovora subsp. carotovora (ICMP12464).
PBB-12-157-f2.jpg
Fig. 3
Efficient detection of different rates of DNA concentrations by PCR amplification using XccR9-2F2-2R1 primer. a) Detection of genomic DNA of race 4; b) Detection of genomic DNA of race 9. Lane M: DNA ladder (100-bp); Lane 1: 30 ng μL-1; Lane 2: 3 ng μL-1; Lane 3: 0.3 ng μL-1; Lane 4: 0.03 ng μL-1; Lane 5: 0.003 ng μL-1.
PBB-12-157-f3.jpg
Fig. 4
Bio-PCR assessment using race 9-specific primer (XccR9-2F2-2R1) to detect 27 samples from infected cabbage leaves after inoculation with strains of Xcc races 1-9. Lane M: DNA ladder (100-bp); Lane 1-3: race 1; Lane 4-6: race 2; Lane 7-9: race 3; Lane 10-12: race 4; Lane 13-15: race 5; Lane 16-18: race 6; Lane 19-21: race 7; Lane 22-24: race 8; Lane 25-27: race 9; +ve1: positive control of gDNA of race 4, +ve2: positive control of gDNA of race 9; -ve: negative control of distilled water.
PBB-12-157-f4.jpg
Table 1
List of bacterial strains used in this study.
Table 1
SL. Bacterial Strains Races Host Country Collection Year References
1 X. campestris pv. campestris (HRIW-3811) 1 B. oleracea US 2017 , Vicente et al. (2001)

2 X. campestris pv. campestris (HRIW-3849A) 2 B. oleracea var. botrytis US 2017

3 X. campestris pv. campestris (HRIW-5212) 3 B. oleracea var. gemmifera UK 2017

4 X. campestris pv. campestris (HRIW-1279A) 4 B. oleracea var. capitata UK 2017

5 X. campestris pv. campestris (HRIW-3880) 5 B. oleracea var. capitata Australia 2017

6 X. campestris pv. campestris (HRIW-6181) 6 B. rapa Portugal 2017

7 X. campestris pv. campestris (HRIW-8450A) 7 B. oleracea var. capitata UK 2017

8 X. campestris pv. campestris (MBG-145.3) 8 B. rapa Spain 2017 , Lema et al. (2012)

9 X. campestris pv. campestris (NCPPB-1145) 9 - UK 2022 NCPPB

10 X. campestris pv. incanae (WHRI-6377) - Matthiola incana UK 2017 , Vicente et al. (2001)

11 X. campestris pv. raphani (WHRI-8305) 2 B. rapa var. perviridis UK 2017

12 X. campestris pv. zinniae (KACC17126) - Zinnia elegans South Korea (Suwon) 2017 KACC

13 X. axonopodis pv. dieffenbachiae (KACC17821) - Anthurium andreanum South Korea (Yongin) 2017

14 X. campestris pv. vesicatoria (KACC11153) - - South Korea 2017

15 Pseudomonas syringae pv. maculicola (ICMP13051) - B. oleracea var. capitata New Zealand 2016 ICMP

16 Erwinia carotovora subsp. carotovora (ICMP12464) - B. oleracea var. capitata New Zealand 2016

Note: NCPPB-The National Collection of Plant Pathogenic Bacteria, KACC- Korean Agriculture Culture Collection, Jeollabuk-do, Korea; ICMP-International Collection of Microorganisms from Plants, Auckland, New Zealand; HRI-W-Horticulture Research International, Wellesbourne, UK

  • Afrin KS, Rahim MA, Rubel MH, Natarajan S, Song J-Y, Kim H-T, et al. 2018. Development of race-specific molecular marker for Xanthomonas campestris pv. campestris race 3, the causal agent of black rot of crucifers. Can J Plant Sci. 98: 1119-1125.
  • Afrin KS, Rahim MA, Jung H-J, Park J-I, Kim H-T, Nou I-S. 2019. Development of molecular marker through genome realignment for specific detection of Xanthomonas campestris pv. campestris race 5, a pathogen of black rot disease. J Microbiol Biotechnol. 29: 785-793.
  • Afrin KS, Rahim MA, Rubel MH, Park J-I, Jung H-J, Kim H-T, et al. 2020. Development of PCR-based molecular marker for detection of Xanthomonas campestris pv. campestris Race 6, the causative agent of black rot of Brassicas. The Plant Pathol J. 36: 418-427.
  • An ShiQi AS, Lu GuangTao LG, Su HuiZhao SH, Li RuiFang LR, He YongQiang HY, Jiang BoLe JB, et al. 2011. Systematic mutagenesis of all predicted gntR genes in Xanthomonas campestris pv. campestris reveals a GntR family transcriptional regulator controlling hypersensitive response and virulence. Mol Plant-Microbe Interact. 24: 1027-1039.
  • Berg T, Tesoriero L, Hailstones D. 2005. PCR-based detection of Xanthomonas campestris pathovars in Brassica seed. Plant Pathol. 54: 416-427.
  • Cardenas E, Tiedje JM. 2008. New tools for discovering and characterizing microbial diversity. Curr Opin Biotechnol. 19: 544-549.
  • Chalupowicz L, Dombrovsky A, Gaba V, Luria N, Reuven M, Beerman A, et al. 2019. Diagnosis of plant diseases using the Nanopore sequencing platform. Plant Pathol. 68: 229-238.
  • Cook A, Walker J, Larson R. 1952. Studies on the disease cycle of black rot of crucifers. Phytopathology. 42: 162-167.
  • Cruz J, Tenreiro R, Cruz L. 2017. Assessment of diversity of Xanthomonas campestris pathovars affecting cruciferous plants in Portugal and disclosure of two novel X. campestris pv. campestris races. J Plant Pathol. 99: 403-414.
  • Fargier E, Manceau C. 2007. Pathogenicity assays restrict the species Xanthomonas campestris into three pathovars and reveal nine races within X. campestris pv. campestris. Plant Pathol. 56: 805-818.
  • Ferreira RM, de Oliveira ACP, Moreira LM, Belasque J Jr, Gourbeyre E, Siguier P, et al. 2015. A TALE of transposition: Tn 3-like transposons play a major role in the spread of pathogenicity determinants of Xanthomonas citri and other xanthomonads. MBio. 6: 10-1128.
  • Hariharan G, Prasannath K. 2021. Recent advances in molecular diagnostics of fungal plant pathogens: a mini review. Front Cell Infect Microbiol. 10: 600234
  • Iee S-P, Lee Y-S. 2002. Development of rapid molecular detection marker for Colletotrichum spp. in leaf and fruit tissues of sweet persimmon. J Microbiol Biotechnol. 12: 989-992.
  • Kamoun S, Kamdar HV, Tola E, Kado CI. 1992. A vascular hypersensitive response: role of the hrpK locus. Mol Plant Microbe Interact. 5: 22-33.
  • Kim BS. 1986. Testing for Detection of Xanthomonas campestris pv. campestris in crucifer seeds and seed disinfection. Korean J Plant Pathol. 2: 96-101.
  • Kim Y-H, Mao S, Sahu N, Somaddar U, Kim H-T, Watanabe M, et al. 2023. Molecular marker development for the rapid differentiation of black rot causing Xanthomonas campestris pv. campestris race 7. Plant Pathol J. 39: 494
  • King EO, Ward MK, Raney DE. 1954. Two simple media for the demonstration of pyocyanin and fluorescin. J Lab Clin Med. 44: 301-307.
  • Lema M, Cartea ME, Sotelo T, Velasco P, Soengas P. 2012. Discrimination of Xanthomonas campestris pv. campestris races among strains from northwestern Spain by Brassica spp. genotypes and rep-PCR. Eur J Plant Pathol. 133: 159-169.
  • Luongo L, Vitale S, Haegi A, Belisario A. 2012. Development of SCAR markers and PCR assay for Fusarium oxysporum f. sp. melonis race 2-specific detection. J Plant Pathol. 94: 193-199.
  • Nezhad AS. 2014. Future of portable devices for plant pathogen diagnosis. Lab Chip. 14: 2887-2904.
  • Ochiai H, Inoue Y, Takeya M, Sasaki A, Kaku H. 2005. Genome sequence of Xanthomonas oryzae pv. oryzae suggests contribution of large numbers of effector genes and insertion sequences to its race diversity. JARQ. 39: 275-287.
  • Pasquali M, Dematheis F, Gullino ML, Garibaldi A. 2007. Identification of race 1 of Fusarium oxysporum f. sp. lactucae on lettuce by inter-retrotransposon sequence-characterized amplified region technique. Phytopathology. 97: 987-996.
  • Potgieter L, Feurtey A, Dutheil JY, Stukenbrock EH. 2020. On variant discovery in genomes of fungal plant pathogens. Front Microbiol. 11: 626
  • Qin D. 2019. Next-generation sequencing and its clinical application. Cancer Biol Med. 16: 4-10.
  • Rinke C, Schwientek P, Sczyrba A, Ivanova NN, Anderson IJ, Cheng J-F, et al. 2013. Insights into the phylogeny and coding potential of microbial dark matter. Nature. 499: 431-437.
  • Robinson JT, Thorvaldsdóttir H, Wenger AM, Zehir A, Mesirov JP. 2017. Variant review with the integrative genomics viewer. Cancer Res. 77: 31-34.
  • Rubel MH, Natarajan S, Hossain MR, Nath UK, Afrin KS, Lee J-H, et al. 2019a. Pathovar specific molecular detection of Xanthomonas campestris pv. campestris, the causal agent of black rot disease in cabbage. Can J of Plant Pathol. 41: 318-328.
  • Rubel MH, Natarajan S, Nath UK, Denison MIJ, Hee-Jeong J, Hoy-Taek K, et al. 2019b. Development of a marker for detection of Xanthomonas campestris pv. campestris races 1 and 2 in Brassica oleracea. Hortic Environ Biotechnol. 60: 511-517.
  • Rubel MH, Robin AHK, Natarajan S, Vicente JG, Kim H-T, Park J-I, et al. 2017. Whole-genome re-alignment facilitates development of specific molecular markers for races 1 and 4 of Xanthomonas campestris pv. campestris, the cause of black rot disease in Brassica oleracea. Int J Mol Sci. 18: 2523
  • Schaad NW, Cheong S, Tamaki S, Hatziloukas E, Panopoulos N. 1995. A combined biological and enzymatic amplification (BIO-PCR) technique to detect Pseudomonas syringae pv. phaseolicola in bean seed extracts. Phytopathology. 85: 243-246.
  • Singh D, Raghavendra B, Rathaur PS, Singh H, Raghuwanshi R, Singh R. 2014. Detection of black rot disease causing pathogen Xanthomonas campestris pv. campestris by bio-PCR from seeds and plant parts of cole crops. Seed Sci. Technol. 42: 36-46.
  • Soengas P, Hand P, Vicente J, Pole J, Pink D. 2007. Identification of quantitative trait loci for resistance to Xanthomonas campestris pv. campestris in Brassica rapa. Theor Appl Genet. 114: 637-645.
  • Song E-S, Kim S-Y, Noh T-H, Cho H, Chae S-C, Lee B-M. 2014. Identification of quantitative trait loci for resistance to Xanthomonas campestris pv. campestris in Brassica rapa. Theor Appl Genet. 24: 732-739.
  • Tewari S, Sharma S. 2019. PCR-based assay for rapid and specific detection of the new Xanthomonas oryzae pv. oryzae K3a race using an AFLP-derived marker. J Microbiol Biotechnol. Elsevier. pp. 481-497.
  • Vicente JG, Conway J, Roberts S, Taylor J. 2001. Identification and origin of Xanthomonas campestris pv. campestris races and related pathovars. Phytopathology. 91: 492-499.
  • Vicente JG, Holub EB. 2013. X anthomonas campestris pv. campestris (cause of black rot of crucifers) in the genomic era is still a worldwide threat to brassica crops. Mol Plant Pathol. 14: 2-18.
  • Wang B, Hu X, Li Q, Hao B, Zhang B, Li G, et al. 2010. Development of race-specific SCAR markers for detection of Chinese races CYR32 and CYR33 of Puccinia striiformis f. sp. tritici. Plant Dis. 94: 221-228.
  • Ward E, Foster SJ, Fraaije BA, McCartney HA. 2004. Plant pathogen diagnostics: immunological and nucleic acid-based approaches. Ann Appl Biol. 145: 1-16.
  • Williams PH. 1981. Black rot: A continuing threat to world crucifers. Plant Dis. 64: 736-742.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Identification of Xanthomonas campestris pv. campestris races 4 and 9 by Molecular Marker-Based Approach
Plant Breed. Biotech.. 2024;12:157-174.   Published online October 28, 2024
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Identification of Xanthomonas campestris pv. campestris races 4 and 9 by Molecular Marker-Based Approach
Plant Breed. Biotech.. 2024;12:157-174.   Published online October 28, 2024
Close

Figure

  • 0
  • 1
  • 2
  • 3
Identification of Xanthomonas campestris pv. campestris races 4 and 9 by Molecular Marker-Based Approach
Image Image Image Image
Fig. 1 . a) Alignment of the whole genome sequences of Xcc races (1-9), two other Xc. pathovars (incanae and raphani), and another Xanthomonas species (X. campestris pv. vesicatoria); b) Line diagram representation of PCR amplification pattern with XccR9-2F2-2R1 primer; Dashed lines represent deletion region; Solid black bar represents similar genomic regions; Green arrow and blue arrows represent forward and reverse primers, respectively.
Fig. 2 Agarose gel electrophoresis of PCR products of Xcc race 4 and race 9 DNA using race a 9-specific primer, and Xcc race specific primer and specific primer sets of Xcc races 1-7 reported by previous studies. a) Xcc specific (Xcc-53, 930-bp); b) Xcc race 1-specific (Xcc-47R1, 1089-bp); c) Xcc race 2-specific (Xcc-R2-89-2, 929-bp); d) Xcc race 3-specific (XccR3-49, 867-bp); e) Xcc race 4-specific (Xcc2-46R4, 578-bp); f) Xcc race 5-specific (XccR5-89.2, 1515-bp); g) Xcc race 6-specific (XccR6-60, 693-bp); h) Xcc race 7-specific (Race 7-1F-1R, 600-bp); i) Xcc race 9-specific (XccR9-2F2-2R1, 830-bp) amplified from genomic DNA of Xcc races, Xc. pathovars and other plant pathogenic bacteria. Lane M: DNA ladder-100 bp; Lanes 1-9: Xcc races (1-9); Lane 10: X. campestris pv. incanae (WHRI-6377); Lane 11: X. campestris pv. raphani (WHRI-8305); Lane 12: X. campestris pv. zinniae (KACC17126); Lane 13: X. axonopodis pv. dieffenbachiae (KACC17821); Lane 14: X. campestris pv. vesicatoria (KACC11153); Lane 15: Pseudomonas syringae pv. maculicola (ICMP13051); Lane 16: Erwinia carotovora subsp. carotovora (ICMP12464).
Fig. 3 Efficient detection of different rates of DNA concentrations by PCR amplification using XccR9-2F2-2R1 primer. a) Detection of genomic DNA of race 4; b) Detection of genomic DNA of race 9. Lane M: DNA ladder (100-bp); Lane 1: 30 ng μL-1; Lane 2: 3 ng μL-1; Lane 3: 0.3 ng μL-1; Lane 4: 0.03 ng μL-1; Lane 5: 0.003 ng μL-1.
Fig. 4 Bio-PCR assessment using race 9-specific primer (XccR9-2F2-2R1) to detect 27 samples from infected cabbage leaves after inoculation with strains of Xcc races 1-9. Lane M: DNA ladder (100-bp); Lane 1-3: race 1; Lane 4-6: race 2; Lane 7-9: race 3; Lane 10-12: race 4; Lane 13-15: race 5; Lane 16-18: race 6; Lane 19-21: race 7; Lane 22-24: race 8; Lane 25-27: race 9; +ve1: positive control of gDNA of race 4, +ve2: positive control of gDNA of race 9; -ve: negative control of distilled water.
Identification of Xanthomonas campestris pv. campestris races 4 and 9 by Molecular Marker-Based Approach

List of bacterial strains used in this study.

SL. Bacterial Strains Races Host Country Collection Year References
1 X. campestris pv. campestris (HRIW-3811) 1 B. oleracea US 2017 Vicente et al. (2001)

2 X. campestris pv. campestris (HRIW-3849A) 2 B. oleracea var. botrytis US 2017

3 X. campestris pv. campestris (HRIW-5212) 3 B. oleracea var. gemmifera UK 2017

4 X. campestris pv. campestris (HRIW-1279A) 4 B. oleracea var. capitata UK 2017

5 X. campestris pv. campestris (HRIW-3880) 5 B. oleracea var. capitata Australia 2017

6 X. campestris pv. campestris (HRIW-6181) 6 B. rapa Portugal 2017

7 X. campestris pv. campestris (HRIW-8450A) 7 B. oleracea var. capitata UK 2017

8 X. campestris pv. campestris (MBG-145.3) 8 B. rapa Spain 2017 Lema et al. (2012)

9 X. campestris pv. campestris (NCPPB-1145) 9 - UK 2022 NCPPB

10 X. campestris pv. incanae (WHRI-6377) - Matthiola incana UK 2017 Vicente et al. (2001)

11 X. campestris pv. raphani (WHRI-8305) 2 B. rapa var. perviridis UK 2017

12 X. campestris pv. zinniae (KACC17126) - Zinnia elegans South Korea (Suwon) 2017 KACC

13 X. axonopodis pv. dieffenbachiae (KACC17821) - Anthurium andreanum South Korea (Yongin) 2017

14 X. campestris pv. vesicatoria (KACC11153) - - South Korea 2017

15 Pseudomonas syringae pv. maculicola (ICMP13051) - B. oleracea var. capitata New Zealand 2016 ICMP

16 Erwinia carotovora subsp. carotovora (ICMP12464) - B. oleracea var. capitata New Zealand 2016
Table 1 List of bacterial strains used in this study.

Note: NCPPB-The National Collection of Plant Pathogenic Bacteria, KACC- Korean Agriculture Culture Collection, Jeollabuk-do, Korea; ICMP-International Collection of Microorganisms from Plants, Auckland, New Zealand; HRI-W-Horticulture Research International, Wellesbourne, UK