Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Rapid Communication

Developing DNA Markers based on Male-Specific Chromosomal Regions for Selecting Male Plants in Hop (Humulus lupulus)

Plant Breeding and Biotechnology 2024;12:10-16.
Published online: March 14, 2024

1Research Center of Crop Breeding for Omics and Artificial Intelligence, Kongju National University, Yesan, Republic of Korea

2Gene engineering division, National Institute of Agricultural Sciences, Jeonju 54874, Republic of Korea

3Department of Horticulture, College of Industrial Sciences, Kongju National University, Yesan, Republic of Korea

*Corresponding to So Young Yi TEL. +82-41-330-1226, E-mail. yisy@kongju.ac.kr
*Corresponding to Si-Yong Kang TEL. +82-41-330-1226, E-mail. sykang@kongju.ac.kr
• Received: January 12, 2024   • Revised: February 16, 2024   • Accepted: February 19, 2024

Copyright © 2024 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 178 Views
  • 2 Download
prev next
  • Hops are dioecious, with only female plants cultivated for resin production and primarily used in brewing. Therefore, early sex identification at the seedling stage is crucial for breeding and cultivation. Molecular marker-assisted selection facilitates rapid and reliable sex identification of hops. We developed molecular male markers by leveraging sequence information from male-specific regions in a designated public database. To assess the accuracy of sex identification using the newly generated markers, we performed PCR analysis on four cultivars of hops with known sexes. Seventy-eight percent of the tested PCR primers correlated with the male sex phenotype. Following optimization, four primer pairs were successfully converted into male-specific PCR markers.
The hop (Humulus lupulus) is a diploid (2n=18 + XX/XY), dioecious, perennial plant (Edwardson 1952, Shephard et al. 2000). Hop cones (female inflorescences) contain lupulin glands that produce and store resins, bitter acids, oils, and flavonoids (Korpelainen et al. 2021; Wang et al. 2008). Rich in secondary metabolites, hop cones have been used as a critical ingredient in beer brewing for flavoring and preservation (Chopra et al. 1956). In hop fields, a single male plant can cause damage because the hop is wind-pollinated, and the presence of seeds in pollinated cones reduces the brewing quality (Thomas et al. 1976). Thus, the rapid identification of female hop plants is essential for commercial cultivation.
Molecular breeding methods, such as marker-assisted selection (MAS) (Hong et al. 2022), have the potential to determine the sex of hop plants before phenotypic differences. Although a few markers have been developed, their quality could be enhanced using Y chromosome-specific sequences (Cerenak et al. 2019; Patzak et al. 2002). Dioecious plants exhibit genotypic differences between males and females, characterized by a non-recombining region in the heterogametic sex and a pseudo-autosomal region (Ming et al. 2011; Shephard et al. 2000). An ideal marker system would utilize a male marker situated on the non-recombining region of the Y chromosome, enabling a simple and cost-effective PCR test for detecting its presence or absence.
Recently, Hill et al. (2016) identified a 1.3 Mb set of scaffolds, presumed to be the male-specific chromosomal region (MSR) in the Y-chromosome of a draft genome for the male hop line USDA 21422M. The MSR comprises a high-confidence 18 Kb set of scaffolds, supported by the USDA World Collection of Hop Varieties and two mapping populations with genotyping by sequencing. The authors proposed that these loci are prime candidates for male molecular markers (Hill et al. 2016). Building upon this proposition, we developed PCR markers to identify male hops using MSR sequence information from the public HopBase database (https://hopbase.cgrb.oregonstate.edu).
Plant material and DNA extraction
Four hop varieties with known sex [Calypso and El Dorado (American varieties) and German Magnum and Saaz (European varieties)] were sourced from Hop & Hope Co., Ltd. (http://www.hopnhope.com). Cultivation took place in an experimental field at Kongju National University. The sex of the hop cultivars was determined during the flower development stage by closely observing the morphological characteristics of their flower organs. For the subsequent PCR analysis, total genomic DNA was extracted from the leaves of both male and female hop plants. The extraction process involved using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions.
Primer design, PCR, and data analysis
We developed male-specific PCR markers (Table S1) based on the MSR sequence at https://hopbase.cgrb.oregonstate.edu. Primers were created using Primer3Plus (http://www.primer3plus.com). Amplification reactions were carried out in a 20 μl AccuPower PCR Premix kit (Bioneer, Daejeon, Korea) with 30 ng genomic hop DNA. For thermal cycling, the process began with a 7-minute denaturation at 94℃. This was followed by 35 cycles of 30 seconds each at 94℃, 60℃ (or 65℃), and 72℃, respectively. Finally, the process concluded with an 8-minute extension at 72℃. Amplified products were visualized on a 2% agarose gel with StaySafe Nucleic Acid Gel Stain (Real Biotech Corporation, Taipei, Taiwan). Male-specific primers were chosen by comparing phenotypic sex identification with molecular marker results from four hop varieties. PCR products were analyzed for the presence or absence of the desired band size in tested hop cultivars.
The 32 primer pairs developed based on MSR_contigs were designated as Humulus lupulus Male Specific Markers (HlMSMs) (Table S1). Owing to insufficient DNA sequence length, the MSR contigs MSR_26729 and MSR_33889 were excluded from the primer design. Male-specific marker screening utilized four-hop cultivars with confirmed sex (Fig. 1). PCR verification of the 32 HlMSM primers was performed on genomic DNA samples from eight hops (four females and four males). The sex confirmation was achieved using the hPb-CONT primer, a published male-specific primer (Cerenak et al. 2019), while the Contig18 primer served to confirm DNA amplification and exclude false negatives (Cerenak et al. 2019). Results for HlMSMs are depicted in Fig. 2 and Table S2. Despite being designed using MSR, four primers exhibited identical PCR band sizes in both sexes, indicating a lack of male specificity. Additionally, three primers failed to produce amplification products. Out of the 32 primers tested, 25 (78%) demonstrated specificity for males in one or more cultivars. Notably, 19 of these primers displayed male specificity across all four cultivars (Fig. 2 and Table S2). Remarkably, four of the nineteen primers (HlMSM1, HlMSM17, HlMSM22, and HlMSM29) showed potential as male-specific PCR markers by consistently producing single bands in male genotypes (Fig. 3 and Table 1).
We developed male markers in MSR, which are Y-chromosome-specific regions that may not recombine with the X chromosome. This MSR-based PCR marker suggests a new method for developing a stable and practical male molecular marker in hops, a dioecious plant.
This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the Ministry of Education (2021R1l1A3044254).
Fig. 1
Sex identification of hop cultivars for marker analysis. The result of Duplex PCR amplification with the male-specific marker, hPb-CONT (red arrow), and the positive control, contig18 (black arrow). M, 100 bp size marker; lanes 1 and 5, Calypso; lanes 2 and 6, El Dorado; lanes 3 and 7, German Magnum; lanes 4 and 8, Saaz.
pbb-12-10-f1.jpg
Fig. 2
The validation results of 32 HlMSMs in four cultivars of hops with known sex. The numbers in the box indicate the number of HlMSMs representing each PCR result. Refer to Tables S1 and S2 for primer sequences and PCR analysis results.
pbb-12-10-f2.jpg
Fig. 3
PCR for sex identification in four hop cultivars. Red arrows indicate male-specific bands and black arrows indicate chloroplast DNA-derived positive control. M, 100 bp size marker; lanes 1 and 5, Calypso; lanes 2 and 6, El Dorado; lanes 3 and 7, German Magnum; lanes 4 and 8, Saaz.
pbb-12-10-f3.jpg
Table 1
Primer sequences and PCR conditions.
Table 1
Marker name Primer sequence (5'→3') Cycles Tann size Reference
HlMSM_1_F TCAGTCCCTAACGCAACACC 35 60 340
HlMSM_1_R TGTGTTGAAATTGCCGGCTG

HlMSM_17_F TTCTCCTCCGAACCCGTTTC 35 65 326
HlMSM_17_R CCCGCAGCCTCTTTTATTGC

HlMSM_22_F TGCCCGTATCAACAGAAGCG 35 65 199
HlMSM_22_R GTGGCAGCATAGGGGAAGAA

HlMSM_29_F AGGTAGTAATCCCATGCAGCTC 35 65 150
HlMSM_29_R TGCACTTTCACGACCCAAGT

hPb-CONT_F TCATCAGCAGGTGGGTCAGGCA 35 60 400 (Cerenak et al. 2019)
hPb-CONT_R TCCGCACTTCTCTCACAGGCGA

contig18_F TCCTGGTCCCTGCGGAAAGGAA 35 60 569 (Cerenak et al. 2019)
contig18_R AGAGCGCGCCCCTGATAATTGC

Tann: annealing temperature in ℃; size: expected size in base pairs

  • Cerenak A, Kolenc Z, Sehur P, Whittock SP, Koutoulis A, Beatson R, et al. 2019. New male specific markers for hop and application in breeding program. Sci. Rep-Uk. 9: 14223
  • Chopra RN, Nayar SL, Chopra IC. 1956. Glossary of Indian medicinal plants: Council of Scientific & Industrial Research.
  • Edwardson JR. 1952. Hops-Their botany, history, production and utilization. Economic Botany. 6: 160-175.
  • Hill ST, Coggins J, Liston A, Hendrix D, Henning JA. 2016. Genomics of the hop pseudo-autosomal regions. Euphytica. 209: 171-179.
  • Hong J-E, Hossain MR, Jung H-J, Nou I-S. 2022. Inheritance of resistance to race 5 of powdery mildew fungus Podosphaera xanthii in melon and development of race 5-specific high resolution melting markers. Plant Breed. Biotech. 10: 272-281.
  • Korpelainen H, Pietiläinen M. 2021. Hop (Humulus lupulus L.): Traditional and present use, and future potential. Economic Botany. 75: 302-322.
  • Ming R, Bendahmane A, Renner SS. 2011. Sex chromosomes in land plants. Annual Review of Plant Biology. 62: 485-514.
  • Patzak J, Vejl P, Skupinová S, Nesvadba V. 2002. Identification of sex in F1 progenies of hop (Humulus lupulus L.) by molecular marker. Plant, Soil and Environment. 48: 318-321.
  • Shephard HL, Parker JS, Dabby P, Ainsuorth CC. 2000. Sexual development and sex chromosomes in hop. New Phytologist. 148: 397-411.
  • Thomas GG, Neve RA. 1976. Studies on the effect of pollination on the yield and resin content of hops (Humulus Lupulus L.). Journal of the Institute of Brewing. 82: 41-45.
  • Wang G, Tian L, Aziz N, Broun P, Dai X, He J, et al. 2008. Terpene biosynthesis in glandular trichomes of hop. Plant Physiology. 148: 1254-1266.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Developing DNA Markers based on Male-Specific Chromosomal Regions for Selecting Male Plants in Hop (Humulus lupulus)
Plant Breed. Biotech.. 2024;12:10-16.   Published online March 14, 2024
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Developing DNA Markers based on Male-Specific Chromosomal Regions for Selecting Male Plants in Hop (Humulus lupulus)
Plant Breed. Biotech.. 2024;12:10-16.   Published online March 14, 2024
Close

Figure

  • 0
  • 1
  • 2
Developing DNA Markers based on Male-Specific Chromosomal Regions for Selecting Male Plants in Hop (Humulus lupulus)
Image Image Image
Fig. 1 Sex identification of hop cultivars for marker analysis. The result of Duplex PCR amplification with the male-specific marker, hPb-CONT (red arrow), and the positive control, contig18 (black arrow). M, 100 bp size marker; lanes 1 and 5, Calypso; lanes 2 and 6, El Dorado; lanes 3 and 7, German Magnum; lanes 4 and 8, Saaz.
Fig. 2 The validation results of 32 HlMSMs in four cultivars of hops with known sex. The numbers in the box indicate the number of HlMSMs representing each PCR result. Refer to Tables S1 and S2 for primer sequences and PCR analysis results.
Fig. 3 PCR for sex identification in four hop cultivars. Red arrows indicate male-specific bands and black arrows indicate chloroplast DNA-derived positive control. M, 100 bp size marker; lanes 1 and 5, Calypso; lanes 2 and 6, El Dorado; lanes 3 and 7, German Magnum; lanes 4 and 8, Saaz.
Developing DNA Markers based on Male-Specific Chromosomal Regions for Selecting Male Plants in Hop (Humulus lupulus)

Primer sequences and PCR conditions.

Marker name Primer sequence (5'→3') Cycles Tann size Reference
HlMSM_1_F TCAGTCCCTAACGCAACACC 35 60 340
HlMSM_1_R TGTGTTGAAATTGCCGGCTG

HlMSM_17_F TTCTCCTCCGAACCCGTTTC 35 65 326
HlMSM_17_R CCCGCAGCCTCTTTTATTGC

HlMSM_22_F TGCCCGTATCAACAGAAGCG 35 65 199
HlMSM_22_R GTGGCAGCATAGGGGAAGAA

HlMSM_29_F AGGTAGTAATCCCATGCAGCTC 35 65 150
HlMSM_29_R TGCACTTTCACGACCCAAGT

hPb-CONT_F TCATCAGCAGGTGGGTCAGGCA 35 60 400 (Cerenak et al. 2019)
hPb-CONT_R TCCGCACTTCTCTCACAGGCGA

contig18_F TCCTGGTCCCTGCGGAAAGGAA 35 60 569 (Cerenak et al. 2019)
contig18_R AGAGCGCGCCCCTGATAATTGC
Table 1 Primer sequences and PCR conditions.

Tann: annealing temperature in ℃; size: expected size in base pairs