Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Physiological and Molecular Responses of Red Maple (Acer rubrum L.) Cultivars to Drought Stress

Plant Breeding and Biotechnology 2022;10(1):62-74.
Published online: March 28, 2022

Department of Agriculture and Natural Resources, Delaware State University, Dover, DE 19901, USA

*Corresponding author Sathya Elavarthi, selavarthi@desu.edu, Tel: +13028576418, Fax: +13028576787
• Received: February 7, 2022   • Revised: February 19, 2022   • Accepted: February 21, 2022

Copyright © 2022 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 197 Views
  • 0 Download
  • 4 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Nitrogen deposition interacts with water availability to influence herbivore abundance and herbivory on red maple (Acer rubrum L.)
    Jane Emily Petzoldt, Elsa Youngsteadt, Steve Frank
    Royal Society Open Science.2026;[Epub]     CrossRef
  • The Irrigation Water pH Has a Dominant Impact on the Growth and Stress Markers of Bigleaf Hydrangea
    Monika Marković, Vlatko Galić, Veronika Težak, Marija Ravlić, Željko Barač, Irena Jug, Lucija Galić
    Applied Sciences.2025; 15(16): 8773.     CrossRef
  • Genome-wide identification of the UGT genes family in Acer rubrum and role of ArUGT52 in anthocyanin biosynthesis under cold stress
    Khan Arif Kamal, Faheem Afzal Shah, Yue Zhao, Zhu Chen, Songling Fu, Zhiyong Zhu, Jie Ren, Hua Liu
    BMC Plant Biology.2025;[Epub]     CrossRef
  • Transcriptome profiling, physiological, and biochemical analyses provide new insights towards drought stress response in sugar maple (Acer saccharum Marshall) saplings
    Lungowe Mulozi, Amaranatha R. Vennapusa, Sathya Elavarthi, Oluwatomi E. Jacobs, Krishnanand P. Kulkarni, Purushothaman Natarajan, Umesh K. Reddy, Kalpalatha Melmaiee
    Frontiers in Plant Science.2023;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Physiological and Molecular Responses of Red Maple (Acer rubrum L.) Cultivars to Drought Stress
Plant Breed. Biotech.. 2022;10(1):62-74.   Published online March 28, 2022
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Physiological and Molecular Responses of Red Maple (Acer rubrum L.) Cultivars to Drought Stress
Plant Breed. Biotech.. 2022;10(1):62-74.   Published online March 28, 2022
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Physiological and Molecular Responses of Red Maple (Acer rubrum L.) Cultivars to Drought Stress
Image Image Image Image Image
Fig. 1 Volumetric water content of pots of maple cultivars subjected to drought stress (drought time regimes) in greenhouse conditions.
Fig. 2 Variation in the chlorophyll index (SPAD units) of the maple leaf samples in response to drought stress in greenhouse conditions evaluated across two years.
Fig. 3 Mean concentrations (± SE) of malondialdehyde (MDA) concentrations (nmol/mg) observed in leaves of the three maple cultivars exposed to drought stress.
Fig. 4 Mean concentrations (± SE) of SOD (A, B) and proline (C, D) levels accumulated in three maple cultivars in response to drought stress.
Fig. 5 Relative quantification of GGAT1 and CSD2 expression in three maple cultivars subjected to drought stress. The fold change (RQ values) were normalized with actin as a reference gene. RQ values of 2 and above show significant overexpression and below 0.5 is significant downregulation.
Physiological and Molecular Responses of Red Maple (Acer rubrum L.) Cultivars to Drought Stress

Details of the two primers used in the qRT-PCR analysis.

Gene Protein NCBI reference ID Function Primer sequence
GGAT1 Glutamate-glyoxylate aminotransferase 1 NM_102180.4 Required for ABA and stress-mediated response Forward: AGGCGGTTTAGGTGCTTAC
Reverse: GAGTTCTGGGTCACTTGGATAC
CSD2 Superoxide dismutase [Cu-Zn] KY471357.1 Destroy reactive radicals produce within the cell (ROS) Forward: CTCATTCCTCCTTCCTCCAATC
Reverse: GCTTTAACGGCGAAGGAAAC

ANOVA for volumetric water contentbetween variety and across the years.

Source of variation SS* df MS** F Sig.
Variety Between Variety (year 2018) 26.236 3 8.745 0.048 0.985
Within Variety (year 2018) 2896.607 16 181.038
Total 2922.843 19
Variety Between Variety (year 2019) 28.081 3 9.36 0.032 0.992
Within Variety (year 2019) 4742.443 16 296.403
Total 4770.524 19
Year Between Year 330.257 7 47.18 0.198 0.984
Within Year 7639.05 32 238.72
Total 7969.307 39

*SS, sum of squares; **MS, mean square.

ANOVA by year for Proline, MDA, SOD, and chlorophyll in all the treatments.

Time regime Proline MDA SOD Chlorophyll
Between groups Within groups Total Between groups Within groups Total Between groups Within groups Total Between groups Within groups Total
Day 0 Sum of 1411 642.6 2053.6 0.94 0.16 1.09 1.53 0.26 1.79 100.2 37.33 137.5
squares
Mean 1411 160.7 0.94 0.04 1.53 0.06 100.2 9.33
square
F 8.8 23.85 23.71 10.7
Sig. 0.041 0.008 0.008 0.031
Day 7 Sum of 820.6 4.7 825.3 0.93 0.23 1.16 1.76 2.31 4.08 506.4 8.91 515.3
squares
Mean 820.6 1.2 0.93 0.06 1.76 0.58 506.4 2.23
square
F 705.8 16.22 3.04 227.4
Sig. 0 0.016 0.156 0
Day 14 Sum of 1028.9 60.8 1089.7 0.05 0.03 0.08 1.28 0.38 1.66 365 34.55 399.6
squares
Mean 1028.9 15.2 0.05 0.01 1.28 0.1 365 8.64
square
F 67.7 6.94 13.33 42.3
Sig. 0.001 0.058 0.022 0.003
Day 21 Sum of 245.1 1705.3 1950.4 0 0.02 0.02 1.14 0.27 1.41 289.3 30.83 320.1
squares
Mean 245.1 426.3 0 0 1.14 0.07 289.3 7.71
square
F 0.6 0.06 16.63 37.5
Sig. 0.491 0.823 0.015 0.004
Day 28 Sum of 165.7 275.2 440.9 0.03 0.13 0.15 0.54 0.13 0.67 88.5 208.64 297.1
squares
Mean 165.7 68.8 0.03 0.03 0.54 0.03 88.5 52.16
square
F 2.4 0.84 16.31 1.7
Sig. 0.196 0.411 0.016 0.263

Pearson correlation analysis of moisture content with MDA, SOD, proline, and chlorophyll levels in the maple leaf samples exposed to drought stress.

Variable Moisture (year 2018) Moisture(year 2019)
MDA 0.613** ‒0.094
SOD 0.063 0.127
Proline ‒0.183 ‒0.464**
Chlorophyll 0.399* 0.318*

*Correlation is significant at the 0.05 level (2-tailed).

**Correlation is significant at the 0.01 level (2-tailed).

Table 1 Details of the two primers used in the qRT-PCR analysis.
Table 2 ANOVA for volumetric water contentbetween variety and across the years.

*SS, sum of squares; **MS, mean square.

Table 3 ANOVA by year for Proline, MDA, SOD, and chlorophyll in all the treatments.
Table 4 Pearson correlation analysis of moisture content with MDA, SOD, proline, and chlorophyll levels in the maple leaf samples exposed to drought stress.

*Correlation is significant at the 0.05 level (2-tailed).

**Correlation is significant at the 0.01 level (2-tailed).