Abstract
Simple sequence repeat (SSR) markers were developed from Pinus densiflora, a species native to Asia, to investigate its genetic diversity and population structure in order to provide information for the management and breeding of this species. Using next-generation sequencing, a total of 1,008 putatively polymorphic SSR primer sets were designed. Seventeen polymorphic SSR markers in 121 individuals belonging to four natural populations of P. densiflora were identified and characterized, with three to seventeen alleles per locus. The expected heterozygosity ranged from 0.1844 to 0.8731 in four populations, and the average of the PIC values ranged from 0.2789 to 0.8488. Cross amplification of these markers was performed among the related species P. rigida, P. koraiensis, P. parviflora, and P. bungeana. The developed novel SSR markers are promising tools for studying the genetic diversity or population structure of P. densiflora and its related species.
-
Key words: Genetic diversity, Next-generation sequencing, Pinaceae, Pinus densiflora, Simple sequence repeat
INTRODUCTION
Pinus densiflora is widely distributed in East Asian countries including Korea, Japan, China, and Russia. Especially in the Korean Peninsula, the distribution extends from Jeju Island (33° 29′ N), the southernmost island in Korea, to the northern part of Baekdu Mt. in North Korea (41° 59′ N) (
Kim et al. 1981). Although members of the Pinaceae family are among the most important plants ecologically and economically (
Liu et al. 2015), there were only a few reports of genetic relationships or population diversity among pine trees because of their very large genome. Molecular tools are necessary to understand the distribution of pine trees, to identify genetic resources, and to improve systematic breeding of pine trees. Several types of molecular markers have been reported from genus
Pinus.
Kim et al. (1995) reported the investigation of the genetic structure and the degree of genetic variation in natural
P. densiflora populations using random amplified polymorphic DNA (RAPD); they classified subjects into two groups dependent on geographic patterning.
Ahn et al. (2015) estimated the genetic diversity and differentiation of thirteen
P. densiflora populations in South Korea using expressed sequence tag polymorphism (ESTP) markers.
Hong et al. (2014) defined phylogenetic relationships within 17 taxa of
Pinus in Korea using two gene loci in chloroplast DNA; they classified them into diploxylon and haploxylon.
Simple sequence repeats (SSRs) are excellent molecular markers for many eukaryotes, and are widely applied to examine genetic diversity, molecular-assisted breeding, and germplasm resources for identification in a variety of species (
Neale et al. 2017).
Lian et al. (2000) developed SSR markers from
P. densiflora to investigate reproductive behavior and tested for amplification in 12
Pinus species.
Watanabe et al. (2006) developed seven SSR loci from
P. densiflora using a dual PCR technique and they investigated Mendelian inheritance in pine wood nematode-resistant trees using the developed markers. In related species, EST-SSR markers from
P. sylvestris (
Fang et al. 2014) and SSR markers from
P. armandii (
Dong et al. 2016) and
P. kesiya (
Cai et al. 2017) were developed. However, there is still limited genomic sequence information for the study of
Pinus species. In this study, we developed novel SSR markers for
P. densiflora by using next-generation sequencing to analyze the genetic diversity and population structure of this species.
MATERIALS AND METHODS
Needle samples of 121 individuals from four
P. densiflora natural populations in different areas of South Korea and 20 individuals from related species (
P. rigida, P. koraiensis, P. parviflora, and
P. bungeana) were collected (
Supplementary Table S1). All needle samples were ground into a fine powder using liquid nitrogen, and total genomic DNA was isolated from each sample using Biomedic
® Plant gDNA Extraction Kit (Biomedic, Bucheon, Gyeonggi, Korea). Paired-end libraries were constructed on two samples and sequenced by a customer sequencing service (Theragen Etex, Suwon, Gyeonggi, Korea) using Illumina HiSeq 2500 platform (Illumina, San Diego, California, USA). All the produced reads from the two representative plants were trimmed and assembled using CLC Genomics Workbench (CLC bio, Aarhus, Denmark) version 7.5.
Genomic SSR regions for
P. densiflora were detected using the SSRIT program (
Temnykh et al. 2001), and 1,008 pairs of primer sequences were successfully designed for the putatively polymorphic loci. A total of 192 primer sets with di, tri, and tetra-nucleotide SSR motifs were randomly selected to screen using the two representative individuals.
The reaction mixtures for SSR amplification included 50 ng of DNA template, 1 × HS Taq DNA polymerase buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.2 mM of each primer, and 1.25 units HS Taq DNA polymerase (Dongsheng Biotech, Guangzhou, Guangdong, China). The conditions for PCR amplification were as follows: 5 minutes for initial denaturation at 95°C, 35 cycles of 30 seconds at 94°C, 30 seconds at 56°C, 30 seconds at 72°C, concluding with 1 cycle of 10 minutes at 72°C. The PCR products were inspected with the Fragment Analyzer Automated CE system (Advanced Analytical Technologies [AATI], Ames, Iowa, USA) with the Quant-iT PicoGreen dsDNA reagent kit, 1–500 bp (Invitrogen, Carlsbad, California, USA). The raw data were analyzed by using PROSize version 2.0 software (AATI).
Statistical parameters such as number of alleles per locus, observed (
Ho) and expected heterozygosities (
He), Hardy-Weinberg equilibrium (HWE), and polymorphism information content (PIC) of each locus were calculated with PowerMarker version 3.25 (
Liu and Muse 2005).
RESULTS AND DISCUSSION
A total of 147 from 192 primer pairs showed at least one band, and 77 primer pairs showed monomorphisms (data not shown). The remaining 70 primer pairs showed polymorphic bands between the two
P. densiflora plants. Finally, 17 primer pairs showing clear polymorphic bands were selected as novel genomic SSR markers (
Table 1). These markers were applied to 121 tree samples that were collected from four regions in South Korea. Among the 121 genotyped individuals, the number of alleles per locus varied from three to seventeen. The averages of the expected heterozygosity (
He) and observed heterozygosity (
Ho) were highest in population 4, which was 0.6439 and 0.4254, respectively. The average PIC value of the markers ranged from 0.2789 to 0.8488, and twelve markers showed more than 0.5 (
Table 2). Also, transferability was tested from four
Pinus species; two markers, CPDE 0039 and CPDE 0076, amplified clear bands from the four
Pinus species (
Table 3).
In this study, we developed 17 novel polymorphic SSR markers from P. densiflora. These markers would be helpful for genetic studies and diversity analyses and could be applicable to four related species of Pinus. Also, these results would provide valuable information for molecular marker-assisted breeding, germplasm identification, and gene flow in pine trees.
Supplementary Information
ACKNOWLEDGEMENTS
This work was carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ01344302)” Rural Development Administration, Republic of Korea.
ACKNOWLEDGEMENTS
This work was carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ01344302)” Rural Development Administration, Republic of Korea.
Table 1Characteristics of 17 SSRs developed in Pinus densiflora.
Table 1
|
Locus |
Primer sequences (5′-3′) |
Repeat motif |
Allele size range (bp) |
Tm (°C) |
GenBank accession no. |
|
CPDE 0002 |
F;GAGGGTGCGAGGATTTAAGA |
(TA)9 |
171–239 |
54 |
KY826503 |
|
R;CAGCTGCTAGGAGTTGTTGATG |
|
|
|
|
|
CPDE 0032 |
F;ACCGCTGATCGATGTGTT |
(AT)16 |
174–214 |
58 |
KY826504 |
|
R;CATGAGGAGCATGTACCGA |
|
|
|
|
|
CPDE 0039 |
F;TTCCAAGAACTCCTGGCTCT |
(AT)15 |
169–209 |
58 |
KY826505 |
|
R;GGGAACAGGTCCTCATTTCT |
|
|
|
|
|
CPDE 0048 |
F;GCTTCTGCCCTTTGTTCTCT |
(TA)9 |
184–222 |
55 |
KY826506 |
|
R;GGGGCACTACGTATTTTACCAC |
|
|
|
|
|
CPDE 0057 |
F;CAGTGACCAACATACCTACCTC |
(AAT)18 |
138–189 |
55 |
KY826507 |
|
R;CGGTAGTGACGAAAGTAGAACG |
|
|
|
|
|
CPDE 0058 |
F;CAGTGGTCCACCACACTAACT |
(TA)10 |
172–200 |
57 |
KY826508 |
|
R;GTGTGGACCATGTAAGGTATGC |
|
|
|
|
|
CPDE 0060 |
F;ATTGATGCATGGCACCTG |
(GT)16 |
145–163 |
53 |
KY826509 |
|
R;ACAGGAGTTCCGATGAGGTT |
|
|
|
|
|
CPDE 0076 |
F;CTCAACTGGCCACTGTAGAACT |
(GA)9 |
188–206 |
57 |
KY826510 |
|
R;AAGGTTCAGGTTGGCATC |
|
|
|
|
|
CPDE 0077 |
F;ACTACAAGAGGGTCGGTCTTC |
(TA)15 |
180–216 |
54 |
KY826511 |
|
R;GTGCGATATCGTTGCATGTC |
|
|
|
|
|
CPDE 0079 |
F;CAACAGCAAGTTGAGAACCC |
(AC)12 |
169–191 |
54 |
KY826512 |
|
R;GTTGGTTCCTTCTTGGCAC |
|
|
|
|
|
CPDE 0093 |
F;GGCAAAGGGGATGAGAAT |
(TG)12 |
170–182 |
52 |
KY826513 |
|
R;GCAAGGTCTTCTCACATCCA |
|
|
|
|
|
CPDE 0106 |
F;CAGATGTTAATCTGGTAGCCCC |
(AT)11 |
160–190 |
55 |
KY826514 |
|
R;CACCTAAGTTGCCACAATGC |
|
|
|
|
|
CPDE 0110 |
F;ACCTCATTCTCCACCATGC |
(TTA)7 |
172–190 |
55 |
KY826515 |
|
R;CCCTTGAGATAAGCCTTAGTGG |
|
|
|
|
|
CPDE 0115 |
F;GGCAGCTTGAAATGGGTACT |
(AAAC)5 |
158–186 |
55 |
KY826517 |
|
R;GACGGTGTGAGGTAGGTGAATA |
|
|
|
|
|
CPDE 0122 |
F;GCCTTTAGGGGACGTTATAGTG |
(TA)5 |
171–215 |
55 |
KY826518 |
|
R;CCTTTCCCCACAAAACACCT |
|
|
|
|
|
CPDE 0137 |
F;AAACCCTAGCTGCAGAGGAT |
(TG)8 |
160–178 |
55 |
KY826519 |
|
R;ACCATTGACACTTGGTGCTC |
|
|
|
|
|
CPDE 0372 |
F;GGTCCAAAACCATAAGGCTC |
(TTTA)5 |
156–180 |
57 |
KY826520 |
|
R;AAGGAGGCTTGGGAAAGA |
|
|
|
|
Table 2Genetic properties of 17 polymorphic SSR markers in four Pinus densiflora populations.
Table 2
|
Locus |
Population 1 (N=35) |
Population 2 (N=25) |
Population 3 (N=33) |
Population 4 (N=28) |
Total |
|
|
|
|
|
|
Az)
|
Hey)
|
Hox)
|
HWEw)
|
A
|
He
|
Ho
|
HWE
|
A
|
He
|
Ho
|
HWE
|
A
|
He
|
Ho
|
HWE
|
A
|
PICv)
|
|
CPDE 0002 |
3 |
0.5174 |
0.0000 |
0.000*
|
8 |
0.7888 |
0.3200 |
0.000*
|
4 |
0.6747 |
0.2143 |
0.000*
|
4 |
0.6111 |
0.000*
|
0.000*
|
9 |
0.6604 |
|
CPDE 0032 |
3 |
0.2669 |
0.1724 |
0.101 |
6 |
0.5584 |
0.2000 |
0.000*
|
6 |
0.3609 |
0.2414 |
0.010 |
4 |
0.2013 |
0.0435 |
0.000*
|
10 |
0.3394 |
|
CPDE 0039 |
13 |
0.7845 |
0.1714 |
0.000*
|
10 |
0.7624 |
0.2800 |
0.000*
|
9 |
0.8194 |
0.4667 |
0.000*
|
13 |
0.8731 |
0.2222 |
0.000*
|
17 |
0.8094 |
|
CPDE 0048 |
6 |
0.4453 |
0.2286 |
0.000*
|
3 |
0.1844 |
0.2000 |
1.000 |
4 |
0.2928 |
0.0667 |
0.000*
|
5 |
0.5242 |
0.2143 |
0.000*
|
8 |
0.3700 |
|
CPDE 0057 |
11 |
0.8278 |
0.7143 |
0.016 |
11 |
0.8712 |
0.6000 |
0.015 |
11 |
0.8646 |
0.6061 |
0.000*
|
11 |
0.8457 |
0.5714 |
0.001 |
12 |
0.8488 |
|
CPDE 0058 |
8 |
0.8098 |
0.6857 |
0.019 |
6 |
0.7313 |
0.5500 |
0.001 |
6 |
0.7415 |
0.3636 |
0.000*
|
6 |
0.7679 |
0.4286 |
0.000*
|
9 |
0.7666 |
|
CPDE 0060 |
7 |
0.7143 |
0.3143 |
0.000*
|
7 |
0.7174 |
0.2609 |
0.000*
|
8 |
0.7158 |
0.4545 |
0.000*
|
6 |
0.7462 |
0.6071 |
0.098 |
10 |
0.7185 |
|
CPDE 0076 |
5 |
0.5882 |
0.4857 |
0.010 |
6 |
0.6784 |
0.5600 |
0.109 |
4 |
0.6717 |
0.4545 |
0.000*
|
5 |
0.6626 |
0.5357 |
0.044 |
6 |
0.6676 |
|
CPDE 0077 |
10 |
0.7543 |
0.2000 |
0.000*
|
9 |
0.8507 |
0.0833 |
0.000*
|
9 |
0.7555 |
0.0968 |
0.000*
|
10 |
0.8306 |
0.2308 |
0.000*
|
15 |
0.8119 |
|
CPDE 0079 |
10 |
0.7943 |
0.7714 |
0.003 |
5 |
0.6953 |
0.9167 |
0.080 |
7 |
0.7153 |
0.4375 |
0.000*
|
7 |
0.6435 |
0.6429 |
0.087 |
10 |
0.7151 |
|
CPDE 0093 |
3 |
0.2152 |
0.0800 |
0.005 |
2 |
0.3403 |
0.2609 |
0.253 |
2 |
0.4537 |
0.3478 |
0.354 |
3 |
0.2675 |
0.1304 |
0.007 |
3 |
0.2789 |
|
CPDE 0106 |
9 |
0.8032 |
0.5000 |
0.001 |
7 |
0.7996 |
0.5652 |
0.006 |
9 |
0.7966 |
0.6364 |
0.001 |
10 |
0.8482 |
0.9286 |
0.014 |
12 |
0.8067 |
|
CPDE 0110 |
5 |
0.5986 |
0.1765 |
0.000*
|
4 |
0.5425 |
0.2000 |
0.000*
|
5 |
0.4458 |
0.2593 |
0.001 |
4 |
0.5302 |
0.3333 |
0.000*
|
6 |
0.4694 |
|
CPDE 0115 |
3 |
0.4503 |
0.5588 |
0.349 |
2 |
0.3848 |
0.5200 |
0.143 |
3 |
0.3802 |
0.4848 |
0.346 |
4 |
0.4681 |
0.5000 |
0.387 |
4 |
0.3688 |
|
CPDE 0122 |
6 |
0.7163 |
0.9714 |
0.003 |
2 |
0.2778 |
0.3333 |
1.000 |
7 |
0.6769 |
0.8387 |
0.131 |
7 |
0.7309 |
1.0000 |
0.032 |
8 |
0.6616 |
|
CPDE 0137 |
5 |
0.5913 |
0.5588 |
0.334 |
6 |
0.6112 |
0.6000 |
0.350 |
6 |
0.6782 |
0.4375 |
0.005 |
6 |
0.6301 |
0.5357 |
0.351 |
7 |
0.5814 |
|
CPDE 0372 |
7 |
0.7739 |
0.5313 |
0.000*
|
6 |
0.7117 |
0.3043 |
0.000*
|
7 |
0.7640 |
0.5172 |
0.000*
|
7 |
0.7655 |
0.3077 |
0.000*
|
8 |
0.7426 |
|
Mean |
6.7 |
0.6266 |
0.4189 |
|
5.9 |
0.6180 |
0.3973 |
|
6.3 |
0.6357 |
0.4073 |
|
6.6 |
0.6439 |
0.4254 |
|
9.1 |
0.6245 |
Table 3Transferability of the 17 SSR markers developed in Pinus densiflora across four Pinus species.
Table 3
|
Locus |
P. densiflora
|
P. rigida
|
P. koraiensis
|
P. parviflora
|
P. bungeana
|
|
CPDE 0002 |
171–239 |
218–222 |
- |
- |
- |
|
CPDE 0032 |
174–214 |
-z)
|
- |
- |
- |
|
CPDE 0039 |
169–209 |
190–206 |
162–170 |
162 |
170–176 |
|
CPDE 0048 |
184–222 |
- |
- |
- |
- |
|
CPDE 0057 |
138–189 |
141 |
- |
- |
- |
|
CPDE 0058 |
172–200 |
174–192 |
- |
- |
- |
|
CPDE 0060 |
145–163 |
- |
- |
- |
- |
|
CPDE 0076 |
188–206 |
190–218 |
212–216 |
212 |
216 |
|
CPDE 0077 |
180–216 |
- |
- |
- |
- |
|
CPDE 0079 |
169–191 |
- |
- |
- |
- |
|
CPDE 0093 |
170–182 |
- |
- |
- |
- |
|
CPDE 0106 |
160–190 |
168–186 |
- |
- |
- |
|
CPDE 0110 |
172–190 |
- |
- |
- |
- |
|
CPDE 0115 |
158–186 |
162–190 |
- |
- |
- |
|
CPDE 0122 |
171–215 |
- |
- |
- |
- |
|
CPDE 0137 |
160–178 |
- |
- |
- |
- |
|
CPDE 0372 |
156–180 |
- |
- |
- |
- |
References
- Ahn JY, Hong KN, Lee JW, Hong YP, Kang H. 2015. Genetic variation of Pinus densiflora populations in South Korea based on ESTP markers. Korean J Plant Resour. 28: 279-289.
- Cai NH, Xu YL, Wang DW, Chen S, Li GQ. 2017. Identification and characterization of microsatellite markers in Pinus kesiya var langbianensis (Pinaceae). Appl Plant Sci. 5: 1600126
- Dong WL, Wang RN, Yan XH, Niu C, Gong LL, Li ZH. 2016. Characterization of polymorphic microsatellite markers in Pinus armandii (Pinaceae), an endemic conifer species to China. Appl Plant Sci. 4: 1600072
- Fang P, Niu S, Yuan H, Li Z, Zhang Y, Yuan L, et al. 2014. Development and characterization of 25 EST-SSR markers in Pinus sylvestris var mongolica (Pinaceae). Appl Plant Sci. 2: 1300057
- Hong JK, Yang JC, Lee YM, Kim JH. 2014. Molecular phylogenetic study of Pinus in Korea based on chloroplast DNA psbA-trnH and atpF-H sequences data. Korean J Pl Tax. 44: 111-118.
- Kim YS, Ko SC, Choi BH. 1981. Distribution atlas of plants of Korea (IV), Atlas of Pinaceae in Korea. Korean J Pl Tax. 11: 53-75.
- Kim YY, Hyun JO, Hong KN, Choi TB, Kim KS. 1995. Genetic variation of natural populations of Pinus densiflora in Korea based on RAPD marker analysis. Korean J Breed. 27: 23-48.
- Lian C, Miwa M, Hogetsu T. 2000. Isolation and characterization of microsatellite loci from the Japanese red pine, Pinus densiflora. Mol Ecol. 9: 1171-1193.
- Liu K, Muse SV. 2005. PowerMarker: an integrated analysis environment for genetic marker data. Bioinformatics. 21: 2128-2129.
- Liu L, Zhang S, Lian C. 2015. De novo transcriptome sequencing analysis of cDNA library and large-scale unigene assembly in Japanese red pine (Pinus densiflora). Inter J Mol Sci. 16: 29047-29059.
- Neale DB, Martínez-García PJ, De La Torre AR, Montanari S, Wei XX. 2017. Novel insights into tree biology and genome evolution as revealed through genomics. Ann Rev Plant Biol. 68: 457-483.
- Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, McCouch S. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 11: 1441-1452.
- Watanabe A, Iwaizumi MG, Ubukata M, Kondo T, Lian C, Hogetsu T. 2006. Isolation of microsatellite markers from Pinus densiflora Sieb. et Zucc. using a dual PCR technique. Mol Ecol Notes. 6: 80-82.
Citations
Citations to this article as recorded by
- Analysis of the genetic diversity and population structure of Lindera obtusiloba (Lauraceae), a dioecious tree in Korea
Ho Bang Kim, Hye-Young Lee, Mi Sun Lee, Yi Lee, Youngtae Choi, Sung-Yeol Kim, Jaeyong Choi
Journal of Plant Biotechnology.2023;[Epub] CrossRef - Genome-wide microsatellite characterization and marker development in Diospyros oleifera
Yang Xu, Cuiyu Liu, Xu Yang, Kaiyun Wu, Bangchu Gong
Industrial Crops and Products.2023; 203: 117182. CrossRef - Genetic Diversity and Structure of Pinus densiflora Siebold & Zucc. Populations in Republic of Korea Based on Microsatellite Markers
Ji-Young Ahn, Jei-Wan Lee, Kyung-Nak Hong
Forests.2021; 12(6): 750. CrossRef
