Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Genetic Diversity and Population Structure of Mongolian Wheat Based on SSR Markers: Implications for Conservation and Management

Plant Breeding and Biotechnology 2017;5(3):213-220.
Published online: September 1, 2017

1Institute of Plant and Agriculturel Sciences, Darkhan-Uul 45047, Mongolia

2National Agrobiodiversity Center, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Korea

*Corresponding author: Gi-An Lee, gkntl1@korea.kr, Tel: +82-63-238-4873, Fax: +82-63-238-4859

These authors contributed equally.

• Received: July 18, 2017   • Revised: August 17, 2017   • Accepted: August 17, 2017

Copyright © 2017 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 250 Views
  • 1 Download
  • 12 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • The Genetic Diversity of Tunisian Sea Barley (Hordeum marinum ssp. marinum): Insights from Cross-species SSRs
    Warda Saoudi, Wael Taamalli, Mounawer Badri, António Martin, Chedly Abdelly
    Plant Molecular Biology Reporter.2026;[Epub]     CrossRef
  • Harnessing genetic potentials for drought tolerance in wheat (Triticum aestivum L.) using tolerance indices and molecular markers
    Mst. Anamika Amzad, Md. Arifuzzaman, Md. Ashraful Alam
    Gene Reports.2025; 40: 102230.     CrossRef
  • Morphological characterization and molecular diversity assessment of rust resistant genetic stocks of wheat
    Sneha Adhikari, S. C. Bhardwaj, O. P. Gangwar, Pramod Prasad, Charu Lata, Subodh Kumar, Gulab Chand
    Tropical Plant Pathology.2024; 49(4): 525.     CrossRef
  • Structure and genetic diversity of macauba [Acrocomia aculeata (Jacq.) Lodd. ex Mart.] approached by SNP markers to assist breeding strategies
    Bruno Galvêas Laviola, Adriano dos Santos, Erina Vitório Rodrigues, Larissa Pereira Ribeiro Teodoro, Paulo Eduardo Teodoro, Tatiana Barbosa Rosado, Cíntia Gonçalves Guimarães, Léo Duc Haa Carson Schwartzhaupt da Conceição
    Genetic Resources and Crop Evolution.2022; 69(3): 1179.     CrossRef
  • Genetic diversity, population structure and relationship of Ethiopian barley (Hordeum vulgare L.) landraces as revealed by SSR markers
    Allo A. Dido, M. S. R. Krishna, Ermias Assefa, Dawit T. Degefu, B. J. K. Singh, Kassahun Tesfaye
    Journal of Genetics.2022;[Epub]     CrossRef
  • Genetic diversity and population structure in Jatropha (Jatropha curcas L.) based on molecular markers
    Adriana de Souza Carneiro, Adriano dos Santos, Bruno Galvêas Laviola, Larissa Pereira Ribeiro Teodoro, Paulo Eduardo Teodoro, Erina Vitório Rodrigues
    Genetic Resources and Crop Evolution.2022; 69(1): 245.     CrossRef
  • Association analysis for agronomic traits in wheat under terminal heat stress
    Adeel Khan, Munir Ahmad, Mukhtar Ahmed, Kulvinder Singh Gill, Zahid Akram
    Saudi Journal of Biological Sciences.2021; 28(12): 7404.     CrossRef
  • Genetic Diversity and Genome-Wide Association Study of Seed Aspect Ratio Using a High-Density SNP Array in Peanut (Arachis hypogaea L.)
    Kunyan Zou, Ki-Seung Kim, Kipoong Kim, Dongwoo Kang, Yu-Hyeon Park, Hokeun Sun, Bo-Keun Ha, Jungmin Ha, Tae-Hwan Jun
    Genes.2020; 12(1): 2.     CrossRef
  • Population structure of Nepali spring wheat (Triticum aestivum L.) germplasm
    Kamal Khadka, Davoud Torkamaneh, Mina Kaviani, Francois Belzile, Manish N. Raizada, Alireza Navabi
    BMC Plant Biology.2020;[Epub]     CrossRef
  • Development of genomic simple sequence repeat markers for Glycyrrhiza lepidota and cross-amplification of other Glycyrrhiza species
    Jun Hyoung Bang, Chi Eun Hong, Sebastin Raveendar, Kyong Hwan Bang, Kyung Ho Ma, Soon Wook Kwon, Hojin Ryu, Ick Hyun Jo, Jong-Wook Chung
    PeerJ.2019; 7: e7479.     CrossRef
  • Genome-Wide Genetic Diversity and Population Structure of Tunisian Durum Wheat Landraces Based on DArTseq Technology
    Cyrine Robbana, Zakaria Kehel, M’barek Ben Naceur, Carolina Sansaloni, Filippo Bassi, Ahmed Amri
    International Journal of Molecular Sciences.2019; 20(6): 1352.     CrossRef
  • Melatonin Mitigates Salt Stress in Wheat Seedlings by Modulating Polyamine Metabolism
    Qingbo Ke, Jun Ye, Bomei Wang, Jianhong Ren, Lina Yin, Xiping Deng, Shiwen Wang
    Frontiers in Plant Science.2018;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Genetic Diversity and Population Structure of Mongolian Wheat Based on SSR Markers: Implications for Conservation and Management
Plant Breed. Biotech.. 2017;5(3):213-220.   Published online September 1, 2017
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Genetic Diversity and Population Structure of Mongolian Wheat Based on SSR Markers: Implications for Conservation and Management
Plant Breed. Biotech.. 2017;5(3):213-220.   Published online September 1, 2017
Close

Figure

  • 0
Genetic Diversity and Population Structure of Mongolian Wheat Based on SSR Markers: Implications for Conservation and Management
Image
Fig. 1 Phylogenetic dendrogram (A) and Bayesian model-based population structure (B) based on simple sequence repeat profiles in Mongolian wheat accessions.
Genetic Diversity and Population Structure of Mongolian Wheat Based on SSR Markers: Implications for Conservation and Management

Characterization of genetic diversity in 200 Mongolian wheat accessions based on 15 simple sequence repeat (SSR) loci.

Marker Primers NA MAF NG GD Ho PIC
Xwmc765 F: 5′gggATCAgACTgggACTggAg3′
R: 5′gggTTggCTTggCAgAgAA3′
6.0 0.38 10.0 0.72 0.10 0.68
Xwmc609 F: 5′CATCCAgCCCATgTAgACgC3′
R: 5′AACggTgCCCATCATCTCCC3′
5.0 0.53 9.0 0.62 0.08 0.56
Xwmc758 F: 5′TAggggAggCgACggAg3′
R: 5′gTTgCTggAgAgTggATTgC3′
6.0 0.30 15.0 0.80 0.20 0.77
xwmc657 F: 5′CgggCTgCgggggTAT3′
R: 5′CggTTgggTCATTTgTCTCA3′
4.0 0.40 6.0 0.66 0.02 0.59
Xwmc795 F: 5′ggCTCgATTCCgTTACCTCA3′
R: 5′ggCgATTCgCCACACCT3′
7.0 0.36 12.0 0.74 0.03 0.70
xbarc213 F: 5′gCgTAgATTCTCggTTTgTTggCTTgC3′
R: 5′CCgTCCCTCCTTCCTggTCT3′
4.0 0.48 7.0 0.58 0.06 0.49
Xwmc598 F: 5′TCgAggAgTCAACATgggCTg3′
R: 5′ACggTCgCTAgggAggggAg3′
4.0 0.43 10.0 0.71 0.22 0.66
Xgwm539 F: 5′CTgCTCTAAgATTCATgCAACC3′
R: 5′gAggCTTgTgCCCTCTgTAg3′
8.0 0.52 12.0 0.65 0.03 0.60
Xgwm282 F: 5′TTggCCgTgTAAggCAg3′
R: 5′TCTCATTCACACACAACACTAgC3′
7.0 0.62 8.0 0.58 0.04 0.55
Xwmc661 F: 5′CCACCATggTgCTAATAgTgTC3′
R: 5′AgCTCgTAACgTAATgCAACTg3′
6.0 0.29 14.0 0.79 0.35 0.75
Xgwm645 F: 5′TgACCggAAAAgggCAgA3′
R: 5′gCCCCTgCAggAgTTTAAgT3′
5.0 0.33 5.0 0.76 0.00 0.73
Xwmc783 F: 5′AggTTggAgATgCAggTggg3′
R: 5′TCTTCCTTCTCCTgCCgCTA3′
5.0 0.31 8.0 0.77 0.03 0.73
Xwmc671 F: 5′gTACgTCAAAgAAAgAgAATTACCTC3′
R: 5′CTCAgAgATATATCTTCgTTgTCAgT3′
9.0 0.30 18.0 0.76 0.18 0.72
Xwmc664 F: 5′gggCCAACAAATCCAAT3′
R: 5′TCTACTTCCTTCATCCACTCC3′
6.0 0.26 14.0 0.80 0.25 0.77
Xwmc720 F: 5′CACCATggTTggCAAgAgA3′
R: 5′CTggTgATACTgCCgTgACA3′
3.0 0.77 5.0 0.37 0.02 0.33
Total 85.0 153.0
Mean 5.7 0.42 10.2 0.69 0.11 0.64

NA: number of alleles, MAF: major allele frequency, NG: number of genotypes, Ho: observed heterozygosity, GD: Genetic diversity, PIC: polymorphic information content.

Genetic diversity in the Mongolian wheat based on 15 simple sequence repeat (SSR) loci.

Group No. of accessions MAF NA GD PIC
Total (200 accs) 200 0.42 (0.26–0.77) 5.7 (3–9) 0.69 (0.37–0.80) 0.64 (0.33–0.77)
T. aestivum (181 accs) 181 0.412 (0.25–0.77) 5.7 (3–9) 0.69 (0.37–0.80) 0.64 (0.33–0.77)
T. compactum (17 accs) 17 0.53 (0.27–0.77) 3.7 (2–5) 0.58 (0.38–0.76) 0.51 (0.31–0.72)
T. polonicum (2 accs) 2 0.5 (0–1) 1.3 (0–3) 0.52 (0–1) 0.47 (0–1)

MAF: major allele frequency, NA: number of alleles, GD: Genetic diversity, PIC: polymorphic information content.

Diversity information and FST values in the inferred subpopulations.

Inferred group Diversity *FST

n NA GD H PIC 1 2 Overall
pop1 142  5.3   0.63   0.11   0.59   0.000  - -
pop2 58 4.0 0.51 0.09 0.47 0.159 0.000 -
Average 4.6 0.57 0.10 0.53 - - 0.159

N: The number of accession, NA: Average number of allele, GD: Gene diversity, H: Heterozygosity, PIC: Polymorphic information content.

*For AMOVA-based estimates, P<0.005 for 100 permutations for all population comparisons.

Analysis of molecular variance (AMOVA) of a number of populations.

Source df SS MS Est. Var. %Tv P
Among species 1 239.199 239.199 1.398 22% 0.001
Among accessions  198 1767.981 8.929  4.088  66%  0.001 
Within accessions 200 150.500 0.753 0.753 12% 0.001
Total 399 2157.680 6.239 100%

df: degree of freedom, SS: Sum of Square, MS: Mean Square, Est. Var.: Estimate Variance, %Tv: Percentage of total variation.

Average values±SD of each group in STRUCTURE based on wheat characters.

Structure Vegetation period Yield (g/m2) 1000 seed weight Plant height Leaf length Leaf width Seed number per spike Seed weight per spike Spike length
Pop1 107.2±19.4 268.1±55.3 30.2±4.4 96.1±9.6 20.7±3.9 1.3±0.3 36.0±7.9 1.2±0.3 7.9±1.0
Pop2 106.5±19.4 285.6±50.3 32.3±4.8 98.8±12.1 21.2±3.6 1.3±0.3 27.4±7.8 1.0±0.3 7.9±1.0
ns * ** ns ns ns ** ** ns

*Significant at the 0.05 probability level,

**Significant at the 0.01 probability level.

Table 1 Characterization of genetic diversity in 200 Mongolian wheat accessions based on 15 simple sequence repeat (SSR) loci.

NA: number of alleles, MAF: major allele frequency, NG: number of genotypes, Ho: observed heterozygosity, GD: Genetic diversity, PIC: polymorphic information content.

Table 2 Genetic diversity in the Mongolian wheat based on 15 simple sequence repeat (SSR) loci.

MAF: major allele frequency, NA: number of alleles, GD: Genetic diversity, PIC: polymorphic information content.

Table 3 Diversity information and FST values in the inferred subpopulations.

N: The number of accession, NA: Average number of allele, GD: Gene diversity, H: Heterozygosity, PIC: Polymorphic information content.

For AMOVA-based estimates, P<0.005 for 100 permutations for all population comparisons.

Table 4 Analysis of molecular variance (AMOVA) of a number of populations.

df: degree of freedom, SS: Sum of Square, MS: Mean Square, Est. Var.: Estimate Variance, %Tv: Percentage of total variation.

Table 5 Average values±SD of each group in STRUCTURE based on wheat characters.

Significant at the 0.05 probability level,

Significant at the 0.01 probability level.