Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Method and Technology

A Simple DNA Preparation Method for High Quality Polymerase Chain Reaction in Rice

Plant Breeding and Biotechnology 2016;4(1):99-106.
Published online: February 28, 2016

1Plant Breeding, Genetics, and Biotechnology Division, International Rice Research Institute, Metro Manila 1226, Philippines

2Crop Biotech Institute and Graduate School of Biotechnology, Kyung Hee University, Yongin 17104, Korea

*Corresponding author: Kshirod K. Jena, k.jena@irri.org, Tel: +63-2-580-5600, Fax: +63-2-891-1236
• Received: January 4, 2016   • Revised: January 31, 2016   • Accepted: February 4, 2016

Copyright © 2016 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 14 Views
  • 0 Download
  • 16 Crossref
prev

Citations

Citations to this article as recorded by  Crossref logo
  • Development and validation of genome-wide polymorphic InDel marker set for harnessing the CC-genome wild rice species in the genus Oryza
    Patricia Izabelle M. Lopez, Sherry Lou Hechanova, Charng-Pei Li, Sam Cohrs, Il-Ryong Choi, Pompe C. Sta. Cruz, Jose E. Hernandez, Tonette P. Laude, Sung-Ryul Kim
    Frontiers in Plant Science.2026;[Epub]     CrossRef
  • TP-ARMS: A Cost-Effective PCR-Based Genotyping System for Precision Breeding of Small InDels in Crops
    Yuan Wang, Jiahong Chen, Yi Liu
    International Journal of Molecular Sciences.2026; 27(3): 1406.     CrossRef
  • In planta genome editing in citrus facilitated by co‐expression of CRISPR/Cas and developmental regulators
    Gilor Kelly, Elena Plesser, Eyal Bdolach, Maria Arroyave, Eduard Belausov, Adi Doron‐Faigenboim, Ada Rozen, Hanita Zemach, Yair Yehoshua Zach, Livnat Goldenberg, Tal Arad, Yossi Yaniv, Nir Sade, Amir Sherman, Yoram Eyal, Nir Carmi
    The Plant Journal.2025;[Epub]     CrossRef
  • Augmenting carotenoid accumulation by multiplex genome editing of the redundant CCD family in rice
    Heebak Choi, Tae Gyu Yi, Yun-Shil Gho, Ji Hye Kim, Sangyun Kim, Yong Jin Choi, Sooyeon Lim, Seok Hyun Eom, Ki-Hong Jung, Sun-Hwa Ha
    Plant Physiology and Biochemistry.2025; 225: 110008.     CrossRef
  • Cost-effective and reliable genomic DNA extraction from plant seedlings for high-throughput genotyping in seed industries
    Shyamkumar S. Wanere, Archana P. Phad, Rameshwar K. Jagtap, Shuban K. Rawal, Prashant S. Pyati, Purushottam R. Lomate
    Analytical Biochemistry.2023; 676: 115245.     CrossRef
  • Development and validation of a genome-wide InDel marker set discriminating the alleles between the BB-genome Oryza species and rice (O. sativa)
    Katrina B. Malabanan-Bauan, Sherry Lou Hechanova, Eok-Keun Ahn, Charng-Pei Li, Il-Ryong Choi, Jose E. Hernandez, Kshirod K. Jena, Sung-Ryul Kim
    Current Plant Biology.2023; 34: 100285.     CrossRef
  • Marker‐assisted forward breeding to develop a drought‐, bacterial‐leaf‐blight‐, and blast‐resistant rice cultivar
    Uma Maheshwar Singh, Shilpi Dixit, Shamshad Alam, Shailesh Yadav, Vinukonda Vishnu Prasanth, Arun Kumar Singh, Challa Venkateshwarlu, Ragavendran Abbai, Abhilash Kumar Vipparla, Jyothi Badri, Tilatoo Ram, Madamshetty Srinivas Prasad, Gouri Sankar Laha, Vi
    The Plant Genome.2022;[Epub]     CrossRef
  • Cultivar-specific markers, mutations, and chimerisim of Cavendish banana somaclonal variants resistant to Fusarium oxysporum f. sp. cubense tropical race 4
    Bo-Han Hou, Yi-Heng Tsai, Ming-Hau Chiang, Shu-Ming Tsao, Shih-Hung Huang, Chih-Ping Chao, Ho-Ming Chen
    BMC Genomics.2022;[Epub]     CrossRef
  • Identification of Genetic Factors Affecting Fruit Weight in the Tomato (Solanum lycopersicum L.) Cultivar ‘Micro-Tom’
    Rihito Takisawa, Atsushi Nishida, Eri Maai, Kazusa Nishimura, Ryohei Nakano, Tetsuya Nakazaki
    The Horticulture Journal.2021; 90(2): 209.     CrossRef
  • Marker-assisted forward and backcross breeding for improvement of elite Indian rice variety Naveen for multiple biotic and abiotic stress tolerance
    Perumalla Janaki Ramayya, Vishnu Prasanth Vinukonda, Uma Maheshwar Singh, Shamshad Alam, Challa Venkateshwarlu, Abhilash Kumar Vipparla, Shilpi Dixit, Shailesh Yadav, Ragavendran Abbai, Jyothi Badri, Ram T., Ayyagari Phani Padmakumari, Vikas Kumar Singh,
    PLOS ONE.2021; 16(9): e0256721.     CrossRef
  • Development of a genome-wide InDel marker set for allele discrimination between rice (Oryza sativa) and the other seven AA-genome Oryza species
    Sherry Lou Hechanova, Kamal Bhattarai, Eliza Vie Simon, Graciana Clave, Pathmasiri Karunarathne, Eok-Keun Ahn, Charng-Pei Li, Jeom-Sig Lee, Ajay Kohli, N. Ruaraidh Sackville Hamilton, Jose E. Hernandez, Glenn B. Gregorio, Kshirod K. Jena, Gynheung An, Sun
    Scientific Reports.2021;[Epub]     CrossRef
  • CTP synthase is essential for early endosperm development by regulating nuclei spacing
    Jinmi Yoon, Lae‐Hyeon Cho, Sung‐Ryul Kim, Win Tun, Xin Peng, Richa Pasriga, Sunok Moon, Woo‐Jong Hong, Hyeonso Ji, Ki‐Hong Jung, Jong‐Seong Jeon, Gynheung An
    Plant Biotechnology Journal.2021; 19(11): 2177.     CrossRef
  • STUDY OF ALLELIC VARIATION AT GENOME WIDE SSR LOCI IN PARENTS OF MAPPING POPULATION FOR HIGH GRAIN ZINC IN RICE (Oryza sativa L.)
    Sonali Habde, S. K. Singh, Korada Mounika, Amrutlal Khaire, D. K. Singh, Prasanta Kumar Majhi
    Journal of Experimental Biology and Agricultural Sciences.2020; 8(5): 558.     CrossRef
  • Marker Assisted Forward Breeding to Combine Multiple Biotic-Abiotic Stress Resistance/Tolerance in Rice
    Shilpi Dixit, Uma Maheshwar Singh, Arun Kumar Singh, Shamshad Alam, Challa Venkateshwarlu, Vishnu Varthini Nachimuthu, Shailesh Yadav, Ragavendran Abbai, Ramchander Selvaraj, M. Nagamallika Devi, Perumalla Janaki Ramayya, Jyothi Badri, T. Ram, Jhansi Laks
    Rice.2020;[Epub]     CrossRef
  • Molecular identification of some wild Nigerian mushrooms using internal transcribed spacer: polymerase chain reaction
    Mobolaji Adeniyi, Yinka Titilawo, Anthonia Oluduro, Olu Odeyemi, Motebang Nakin, Anthony Ifeanyi Okoh
    AMB Express.2018;[Epub]     CrossRef
  • Monosomic alien addition lines (MAALs) of Oryza rhizomatis in Oryza sativa: production, cytology, alien trait introgression, molecular analysis and breeding application
    Sherry Lou Hechanova, Manas R. Prusty, Sung-Ryul Kim, LaRue Ballesfin, Joie Ramos, G. D. Prahalada, Kshirod K. Jena
    Theoretical and Applied Genetics.2018; 131(10): 2197.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

A Simple DNA Preparation Method for High Quality Polymerase Chain Reaction in Rice
Plant Breed. Biotech.. 2016;4(1):99-106.   Published online February 28, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
A Simple DNA Preparation Method for High Quality Polymerase Chain Reaction in Rice
Plant Breed. Biotech.. 2016;4(1):99-106.   Published online February 28, 2016
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
A Simple DNA Preparation Method for High Quality Polymerase Chain Reaction in Rice
Image Image Image Image Image
Fig. 1 Agarose gel image of leaf extracts and screening of the optimal dilution degree of the crude leaf extracts for polymerase chain reaction (PCR). (A) Gel image of leaf extracts. Leaf tissue (4 cm long) was collected from 15 to 80 days old plants of varieties NSIC Rc222 (lane 1), PSB Rc82 (lane 2), Nipponbare (lane 3), and Osmancik-97 (lane 4), respectively. Following extraction, the supernatants (15 μl) were electrophoresed in 1% agarose gel. (B) PCR amplification efficiency according to dilution degree of leaf extracts. Leaf tissue (2 cm long) was prepared from 50 days-old plant of NSIC Rc222 (lane 1) and Taichung 65 (lane 2) as described. PCRs were performed with four primer sets. Product sizes and GC contents are shown next to the gel images. CTAB-extracted DNA was used as a control. M: DNA size marker, CTAB: cetyltrimethylammonium bromide; 500 ng of genomic DNA (gDNA) extracted by CTAB method, T: 100 mM tris-HCl pH 9.5, P: 1 M KCl, E: 10 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0.
Fig. 2 The influences of sample quantity and plant developmental stages on polymerase chain reaction (PCR) of tris-phosphate (TPE)-extracted DNA. Leaf tissue (0.5, 1, 2, 4, and 8 cm long) was collected from the seedling stage (SD, 20 days after germination) of IR24 and NSIC Rc222 and from the grain filling stage (GF, 10 days after pollination) of Taichung 65 and IR64, respectively. DNAs were prepared by TPE buffer with six times dilution. PCR efficiency was tested using Chr06A (A), Chr02A (B), Chr07A (C), and Chr03B (D) primers. Cetyltrimethylammonium bromide (CTAB)-extracted DNA was used as control. M: DNA size marker.
Fig. 3 DNA quality test by polymerase chain reaction (PCR) amplifications of regions of various GC content (34% to 67%) and product sizes (580 to 1,987 bp). The leaf extracts were prepared based on the tris-phosphate protocol from 11 rice accessions. PCRs were performed with five primer sets. M: DNA size marker.
Fig. 4 DNA stability test. Leaf extracts were prepared by the tris-phosphate protocol from 12 BC2F2 plants of breeding line YPF14-853, and then they were stored at 4°C for 8 months. Genomic DNA integrity was tested by gel electrophoresis of 15 μl of the stored extracts (A) and by polymerase chain reaction amplification of the stored extracts with Chr09A primer set (B). M: DNA size marker.
Fig. 5 Various polymerase chain reaction (PCR) applications using genomic DNA extracted by the TPE method. (A) Genotyping of 12 T2 plants of the rice T-DNA insertional mutant line, PFG_3A-52268. (B) F1 hybridity test using rice microsatellite (RM) marker, RM 11 from 10 F1 plants. (C) Discrimination of SNP type DNA polymorphism for marker-assisted breeding. The A/G SNP located in the promoter region of Gn1a gene which regulates grain number per panicle (Ashikari et al. 2005) was determined from 12 BC1F2 plants of the intermediate breeding line YPF14-582 using the tetra-primer PCR method (Ye et al. 2001). M: DNA size marker, p1 and p2: parents of F1.
A Simple DNA Preparation Method for High Quality Polymerase Chain Reaction in Rice

List of polymerase chain reaction primers used in this study.

PrimersZ) Forward primer (5′→3′) Reverse primer (5′→3′)
Chr02A TTGACAACCACTCCTGTCCT CCCTTCAACATGGTTGAGGT
Chr02B TGGGCATGTTTCTGGAGACA CTCGAATGGCTTCCAATGAC
Chr03A GCTCCAAGAACTAATACAAGC CTAGCTTGAGGGTTCCTGCA
Chr03B TTGGCTTGATTTCCTGTGCTA GCTTTCTGCTCCTGCTGTAA
Chr03C TGCACCATAACTACACTTGCT CTTGAATGCTTGCTGGTCGA
Chr06A TTCCCATCTGCACTACCATAATCC GAGCAGAGATGTGCTTTGCTACC
Chr06B GAGATCAGTACTTGTACTAGC TCAACTTACTCCCTCAGTCT
Chr07A GACCTCACCTGCTATAGCTA GCTCGATCGAGCCGATCAT
Chr08A GGTTGTTCAGTGGCAATGTC GCAAAAGTGCAGCTAACCAC
Chr09A GCAAGTGCTCACCCAAGTG AGCAACCACTGAGACAGCAT

Z)The number in the primer name represents rice chromosome number.

Table 1 List of polymerase chain reaction primers used in this study.

The number in the primer name represents rice chromosome number.