Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Genetic Mapping of a Rice Loose Upper Panicle Mutant

Plant Breeding and Biotechnology 2015;3(4):366-375.
Published online: November 30, 2015

1Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea

2Department of Plant Science, College of Agriculture and Environmental Science, Arsi University, Asella, P.O.Box No. 193, Ethiopia

*Corresponding author: Hee-Jong Koh, heejkoh@snu.ac.kr, Tel: +82-2-880-4541, Fax: +82-2-873-2056
• Received: November 18, 2015   • Revised: November 23, 2015   • Accepted: November 23, 2015

Copyright © 2015 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 233 Views
  • 0 Download
  • 4 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • OsFBK4, a novel GA insensitive gene positively regulates plant height in rice (Oryza Sativa L.)
    Workie Anley Zegeye, Daibo Chen, MdAnowerul Islam, Hong Wang, Aamir Riaz, Mohammad Hasanuzzaman Rani, Kashif Hussain, Qunen Liu, Xiaodeng Zhan, Shihua Cheng, Liyong Cao, Yingxin Zhang
    Ecological Genetics and Genomics.2022; 23: 100115.     CrossRef
  • MutMap Approach Enables Rapid Identification of Candidate Genes and Development of Markers Associated With Early Flowering and Enhanced Seed Size in Chickpea (Cicer arietinum L.)
    Praveen Kumar Manchikatla, Danamma Kalavikatte, Bingi Pujari Mallikarjuna, Ramesh Palakurthi, Aamir W. Khan, Uday Chand Jha, Prasad Bajaj, Prashant Singam, Annapurna Chitikineni, Rajeev K. Varshney, Mahendar Thudi
    Frontiers in Plant Science.2021;[Epub]     CrossRef
  • Heterosis analysis and underlying molecular regulatory mechanism in a wide-compatible neo-tetraploid rice line with long panicles
    Mohammed Abdullah Abdulraheem Ghaleb, Cong Li, Muhammad Qasim Shahid, Hang Yu, Junhong Liang, Ruoxin Chen, Jinwen Wu, Xiangdong Liu
    BMC Plant Biology.2020;[Epub]     CrossRef
  • Whole Genome Resequencing from Bulked Populations as a Rapid QTL and Gene Identification Method in Rice
    Workie Anley Zegeye, Yingxin Zhang, Liyong Cao, Shihua Cheng
    International Journal of Molecular Sciences.2018; 19(12): 4000.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Genetic Mapping of a Rice Loose Upper Panicle Mutant
Plant Breed. Biotech.. 2015;3(4):366-375.   Published online November 30, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Genetic Mapping of a Rice Loose Upper Panicle Mutant
Plant Breed. Biotech.. 2015;3(4):366-375.   Published online November 30, 2015
Close

Figure

  • 0
  • 1
  • 2
Genetic Mapping of a Rice Loose Upper Panicle Mutant
Image Image Image
Fig. 1 Comparison of the agronomic traits between wild-type and lup mutant. (a) Panicle structure, (b) Plants before heading, (c) after heading, (d) Internode, and (e) grain size. Scale bars (a) 3 cm, (b–c) 20 cm, (d) 5 cm, and (e) 5 mm.
Fig. 2 Spikelet distance (SD) variability between lup mutant and WT primary branches. SDFPB Spikelet distance of first primary branch, SDMPB Spikelet distance on middle primary branches, and SDLPB Spikelet distance on last primary branch. **Significant at 1% level of probability.
Fig. 3 Genetic map of lup mutant: (a) Primary mapping of the lup locus on chromosome 8, (b) the lup locus was fine mapped with the adjacent markers. (c) Graphical genotype results of fine mapping. W: wild type, M: mutant type, 1: mutant type, 2: wild type, 3: hetero type.
Genetic Mapping of a Rice Loose Upper Panicle Mutant

The PCR-based molecular markers used in fine mapping of the lup gene.

STS marker Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′) Size (bp)
S08012b GAAGCCAAAATGGGAGAGAA TTTTGTGCTGCCACTGAAAG 224
S08032 GTACGAGAACCTGCAGAGCA TTTCCACCTCAACCAAGTCC 208
AP004396 TACAAGGATGCGGAAAGACC CCACCATTAAAGCAGCACAA 246
S08060b GGAGAGGAAAGTGGGAGAGG ACCTCGTGATTGGTTGCTTC 223
182170 CAAAGCTGGGTGTAGGGAGA CTGGTCAAGTTGAGGCACAG 263
S08070 ACTACATCGTCCGGCTCAAG GGTGCAAGCAAGCAATGAT 143
S08072b AAATTAATGGATGTACTCTTCTGTTTG CAGCAGCGGATTTGCTATC 265
S08075 AAACAAGTTTGCGGACCAAG TGAGTGATAAACAACTCACAACAAAA 256
S08076 TTGCATGTGTCGTCTGTCCT GTTTCAAGCAGTTGGGAAGC 212

Agronomic traits of the lup mutant and wild-type.

Traits PBL (cm) SBL (cm) PB SB SPP SPS TSP SPF (%) 1000-GW (g) CL (cm) PL (cm) TN GL (mm) GW (mm) GS (mm)
WT 6.8 1.49 9.75 13.75 57.50 37.88 95.37 94.21 26.30 101.50 18.86 11.5 9.14 5.18 1.77
lup 7.3 1.46 9.20 13.90 49.28 37.38 86.67 66.79 18.67 89.50 16.80 9 8.64 4.71 1.84
Difference NS NS * NS ** NS * ** * ** ** * * * NS

PBL: Primary branch length, SBL: Secondary branch length, PB: Number of primary branch, SB: Number of secondary branch, SPP: Number of spikelet per PB, SPS: Number of spikelet per SB, TSP: Total number of spikelet per panicle, SPF%: Spikelet fertility % per panicle, 1000-GW: 1000 grain weight, CL: Culm length, PL: Panicle length, TN: Tiller number, GL: Grain length, GW: Grain weight, GS: Grain shape.

*,**Significant at 5 and 1% level of probability and NS represents non-significant difference, respectively.

Genetic segregation of lup mutant in two F2 populations.

Cross combination Wild type Mutant Total χ2 (3:1)
lup mutant / Milyang 23 357 131 488 0.885
lup mutant / Hwacheongbyeo (WT) 209 53 262 1.92

Candidate genes comprising SNPs in the lup mutant.

No. Gene name No. of SNPs Nucleotide length Description
1 Os08g0384500 3 4161 Similar to PDR-like ABC transporter (PDR3 ABC transporter).
2 Os08gt0384602 1 2755 Hypothetical gene.
3 Os08g0384700 3 2953 Hypothetical gene.
4 Os08g0384900 1 4269 Zinc finger, RING/FYVE/PHD-type domain containing protein.
5 Os08g0385000 1 455 Conserved hypothetical protein.
6 Os08g0385400 1 3466 Conserved hypothetical protein.
7 Os08g0385900 1 6297 Similar to Transformer-2-like protein.
8 Os08g0386700 4 5856 Similar to Avr9 elicitor response protein-like.
9 Os08g0386800 1 907 Hypothetical conserved gene.
10 Os08g0386900 1 2635 Prefoldin domain containing protein.
11 Os08g0387050 7 2867 Hypothetical conserved gene.
12 Os08g0387200 8 7262 Protein of unknown function DUF81 family protein.
13 Os08g0388300 1 13132 Hypothetical conserved gene.
14 Os08g0388900 1 7795 Similar to para-hydroxybenzoate--polyprenyltransferase.
15 Os08g0392100 1 1381 2OG-Fe(II) oxygenase domain containing protein.
16 Os08g0392300 25 2237 Similar to Oxidoreductase, 2OG-Fe oxygenase family protein, expressed.
17 Os08g0392500 25 10744 Hypothetical conserved gene.
18 Os08g0392700 8 749 Conserved hypothetical protein.
19 Os08g0393600 4 2474 Protein-tyrosine phosphatase-like, PTPLA domain containing protein.
20 Os08g0393700 4 1332 Similar to predicted protein.
21 Os08g0393900 3 640 Hypothetical gene.
22 Os08g0394000 6 758 Conserved hypothetical protein.
23 Os08g0395300 1 1826 Similar to AP-4 complex subunit sigma-1.
24 Os08g0395700 1 1394 Conserved hypothetical protein.
25 Os08g0395800 2 1937 Protein of unknown function DUF247, plant family protein.
26 Os08g0396200 6 698 Hypothetical gene.
27 Os08g0396500 7 3203 Hypothetical conserved gene.
28 Os08g0396700 47 13559 D1 domain containing protein.
29 Os08g0397800 6 770 Conserved hypothetical protein.
30 Os08g0397900 3 2682 Similar to Holocarboxylase synthetase.
31 Os08g0398000 9 6202 ABC transporter-like domain containing protein.
32 Os08g0398300 3 5664 ABC transporter-like domain containing protein.
33 Os08g0398350 73 6346 Similar to ABC transporter family, cholesterol/phospholipid flippase.
34 Os08g0398400 24 4030 Similar to Hypersensitive-induced response protein.
35 Os08g0398800 2 1703 Cleavage and polyadenylation specificity factor, 25 kDa subunit domain containing protein.
36 Os08g0398966 2 507 Hypothetical gene.
37 Os08g0399300 2 2618 Hypothetical conserved gene.
38 Os08g0399550 3 1436 Hypothetical conserved gene.
39 Os08g0399600 1 1501 Similar to Elongation factor Ts.
40 Os08g0399900 6 1498 Conserved hypothetical protein.
41 Os08g0400000 2 5349 Similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-) (PSA).
42 Os08g0400200 1 3653 Similar to SET domain protein.
43 Os08g0401100 1 3001 Ankyrin repeat containing protein.
44 Os08g0401601 4 1958 Hypothetical genes.
45 Os08g0401800 14 2568 Similar to C2; Peptidase, cysteine peptidase active site.
46 Os08g0402001 4 653 Hypothetical conserved gene.
47 Os08g0402100 2 1517 Lateral organ boundaries, LOB domain containing protein.
48 Os08g0402500 2 1151 Conserved hypothetical protein.
49 Os08g0402600 1 1978 Pentatricopeptide repeat domain containing protein.
50 Os08g0402700 7 4088 Similar to 10A19I.7.
51 Os08g0402800 2 5457 Protein of unknown function DUF6, transmembrane domain containing protein.
Table 1 The PCR-based molecular markers used in fine mapping of the lup gene.
Table 2 Agronomic traits of the lup mutant and wild-type.

PBL: Primary branch length, SBL: Secondary branch length, PB: Number of primary branch, SB: Number of secondary branch, SPP: Number of spikelet per PB, SPS: Number of spikelet per SB, TSP: Total number of spikelet per panicle, SPF%: Spikelet fertility % per panicle, 1000-GW: 1000 grain weight, CL: Culm length, PL: Panicle length, TN: Tiller number, GL: Grain length, GW: Grain weight, GS: Grain shape.

Significant at 5 and 1% level of probability and NS represents non-significant difference, respectively.

Table 3 Genetic segregation of lup mutant in two F2 populations.
Table 4 Candidate genes comprising SNPs in the lup mutant.