Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Identification of Quantitative Trait Loci for Agronomic Traits in Two Rice Populations Derived from a Cross with a Wide Compatibility Line

Plant Breeding and Biotechnology 2014;2(3):231-246.
Published online: September 30, 2014

Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute for Agriculture and Life Sciences, Seoul National University, 151-921, Seoul, Korea

*Corresponding author: Hee-Jong Koh, heejkoh@snu.ac.kr, Tel: +82-2-880-4541, Fax: +82-2-873-2056
• Received: September 20, 2014   • Revised: September 24, 2014   • Accepted: September 24, 2014

Copyright © 2014 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 186 Views
  • 0 Download
  • 2 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • QTL Analysis for Yield and Grain-Related Traits Using the Recombinant Inbred Lines Derived from a Cross between ‘Boramchan’ and ‘Pecos’
    Hyun-Su Park, Chang-Min Lee, Jeonghwan Seo, Songhee Park, Keon-Mi Lee, Jae-Ryoung Park, O-Young Jeong
    Korean Journal of Breeding Science.2025; 57(2): 131.     CrossRef
  • A meta-quantitative trait loci analysis identified consensus genomic regions and candidate genes associated with grain yield in rice
    Kelvin Dodzi Aloryi, Nnaemeka Emmanuel Okpala, Aduragbemi Amo, Semiu Folaniyi Bello, Selorm Akaba, Xiaohai Tian
    Frontiers in Plant Science.2022;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Identification of Quantitative Trait Loci for Agronomic Traits in Two Rice Populations Derived from a Cross with a Wide Compatibility Line
Plant Breed. Biotech.. 2014;2(3):231-246.   Published online September 30, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Identification of Quantitative Trait Loci for Agronomic Traits in Two Rice Populations Derived from a Cross with a Wide Compatibility Line
Plant Breed. Biotech.. 2014;2(3):231-246.   Published online September 30, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
Identification of Quantitative Trait Loci for Agronomic Traits in Two Rice Populations Derived from a Cross with a Wide Compatibility Line
Image Image Image Image Image Image
Fig. 1 The plant architecture and grain shape of Hwacheong, HWC-line and Dasan.
Fig. 2 Frequency distribution of culm length, panicle length, spikelet number per panicle, spikelet fertility, grain length, grain width, grain shape and 100 grains weight in two F2 populations.
Fig. 3 Chromosomal locations of QTLs for seven agronomic traits in the HD population. The number above each chromosome indicates linkage map coverage based on physical position of markers.
Fig. 4 Chromosomal locations of QTLs for seven agronomic traits in the HH population. The number above each chromosome indicates linkage map coverage based on physical position of markers.
Fig. 5 Frequency of HWC-line allele in HD (left) and HH (right) populations. Chromosome numbers are shown on the x-axis while the frequency of HWC-line allele is shown on y-axis.
Fig. 6 Physical position of markers spanning qcl1.1 (A) and sd1 sequence variation among HWC-line, Dasan and Hwacheong (B). Black arrows and box regions represent exons. Green arrows indicate primers used in sequencing.
Identification of Quantitative Trait Loci for Agronomic Traits in Two Rice Populations Derived from a Cross with a Wide Compatibility Line

The designed primers used in sequencing of sd1 coding region.

No. Primer name Sequence (5′→3′) Amplicon size (HWC-line and Hwacheong/Dasan) Amplifying region
1 SD1-2F CAACACAGCGCTCACTTCTC 1023/641bp exon1, intron1 and exon2
2 SD1ex1-2R TGGTTTACCATGAAGGTGTCG
3 SD1ex3F GGGAATTGTTGTGTGTGCAG 468/479bp exon3
4 SD1ex3R GTACAGCGGTAGGGTCCAAA

Agronomic traits of three parents and two F2 populations established in the field in 2010.

Character Parents F2 populations


Hwacheong HWC-line Dasan HWC/DS HWC/HC




Mean SDz) Mean SD Mean SD Mean SD Miny) Maxx) Mean SD Min Max
Heading date Aug. 20 Aug. 12 Aug. 14
Culm length (cm) 81.2 3.6 93.9 4.12 78.8 2.1 95.9 12.2 60.5 125.0 87.2 8.3 69.0 106.0
Panicle length (cm) 18.7 3.4 23.6 2.2 24.2 1.3 22.6 2.2 15.5 30.5 22.4 2.3 13.2 29.0
Spikelet per panicle 113.8 14.6 146.2 17.4 173.5 39.3 140.9 38.7 49.0 262.0 143.0 25.2 89.7 251.3
Spikelet fertility (%) 93.8 2.8 91.6 1.2 84.8 11.5 65.5 18.8 2.7 96.1 82.6 13.8 8.1 97.6
Grain length (mm) 6.31 0.24 7.47 0.23 7.72 0.25 7.08 0.34 6.06 8.10 6.98 0.29 6.29 7.76
Grain width (mm) 3.31 0.14 3.1 0.13 3.11 0.12 2.94 0.18 2.49 3.39 3.20 0.15 2.82 3.58
Grain shape (GL/GW) 1.91 0.09 2.41 0.1 2.49 0.14 2.43 0.19 2.00 2.98 2.19 0.14 1.82 2.57
100 grains weight (g) 2.4 0.12 2.4 0.09 2.83 0.07 2.27 0.24 1.70 3.10 2.35 0.23 1.61 2.92

z)SD is the abbreviation for standard deviation.

y)Min is the abbreviation for minimum.

x)Max is the abbreviation for maximum.

Correlation coefficients among eight agronomic traits of HD population (Lower) and HH population (Upper).

Culm length Panicle length Spikelet per panicle Spikelet fertility Grain length Grain width Grain shape 100 grains weight
Culm length 0.28** 0.17* −0.01 0.22** 0.18* 0.01 0.14
Panicle length 0.39** 0.35** 0.03 0.33** 0.02 0.20** 0.23**
Spikelet per panicle 0.12 0.34** 0.03 0.05 0.06 −0.03 0.05
Spikelet fertility 0.12 −0.14* −0.07 −0.15* −0.22** 0.07 0.31**
Grain length 0.25** 0.34** 0.00 −0.11 0.00 0.65** 0.30**
Grain width 0.18* −0.12 −0.08 0.11 0.18* −0.75** 0.45**
Grain shape 0.01 0.34** 0.05 −0.13 0.40** −0.78** −0.16*
100 grains weight 0.33** 0.12 −0.19** −0.03 0.51** 0.65** −0.23**

* and ** indicate significant at 5% and 1% level, respectively.

Number of polymorphic markers in two F2 populations.

Total HWC vs. DS HWC vs. HC
STS marker 293 213 (72.7%) 51 (17.4%)
SS-STS marker 55 53 (96.4%) 2 (3.6%)
SSR marker 374 293 (78.3%) 64 (17.1%)
FNP marker 1 1 (100%) 1 (100%)
Total 723 560 (77.5%) 118 (16.3%)

Main-effect QTLs underlying eight agronomic traits in two F2 populations.

Trait Chr. QTL Marker interval HWC/DS HWC/HC Remarks


positionz) F y) Ax) PVE(%)w) position F A PVE(%)
CL 1 qcl1.1v) S01140–S01160 76.4 33.6 6.59 25.6 novel QTL
1 qcl1.1v) S01143A–RM472 238.7 54.0 5.76 37.2 novel QTL
1 qcl1.2 RM472–S01157B 269.3 60.4 6.93 39.1 sd1 (Sasaki et al. 2002)
7 qcl7 S07105A–S07118B 166.1 8.2 2.96 7.8 novel QTL
PL 10 qpl10 S10055A–RM5471 5.0 7.4 −0.47 1.0 qPL10-1 (Cui et al. 2002)
SPP 4 qspp4 S04065–S04075 81.9 12.1 19.4 11.4 qSPN-4b (Teng et al. 2002)
SF 6 qsf6 RM276–S06054 17.0 15.9 6.18 11.6 qSF6.2 (Reflinur et al. 2012)
9 qsf9 S09000A–S09031 0.0 10.5 −7.24 7.8 qSF9.1 (Reflinur et al. 2012)
GL 1 qgl1.1 S01038–S01054 103.4 12.2 0.17 11.7 qGL-1 (Wan et al. 2005)
1 qgl1.2 S01143A–RM472 238.7 12.6 0.15 12.7 - (Huang et al. 1997)
1 qgl1.3 S01160–S01176 119.5 11.3 0.14 10.8 novel QTL
2 qgl2.1 S02014–S02023 8.0 7.6 −0.08 5.5 qGL-2b (Li et al. 2003)
2 qgl2.2 S02026–S02039 48.8 8.6 −0.14 7.9 GW2 (Song et al. 2007)
3 qgl3 RM3766–RM218 58.3 17.6 0.14 14.2 gl3a (Xing et al. 2001)
5 qgl5 qSW5–S05047 4.8 14.6 0.11 6.7 novel QTL
6 qgl6 S06087–S06105 109.9 14.0 0.18 11.6 gl6 (Aluko et al. 2004), qGL-6 (Li et al. 2003
7 qgl7 S07081B–S07105A 118.8 15.4 0.12 6.5 - (Redona et al. 1998)
GW 1 qgw1 S01160–S01176 121.5 7.5 0.06 2.8 qGW-1 (Wan et al. 2005), kw1.1 (Li et al. 2004), gw1.1 (Septiningsih et al. 2003)
2 qgw2 S02052–RM341 80.4 13.6 0.10 8.6 - (Cai et al. 2002)
3 qgw3.1 S03057–RM15007 89.2 11.9 0.06 5.5 novel QTL
3 qgw3.2 RM15007–S03076B 113.2 13.3 0.04 5.4 novel QTL
4 qgw4 RM303–RM5503 192.1 7.5 −0.05 4.2 novel QTL
5 qgw5 S05030A–S05048 59.2 55.3 −0.17 34.0 qSW5 (Shomura et al. 2008), GW5 (Weng et al. 2008)
5 qgw5 qSW5–S05047 5.8 90.5 −0.16 47.0 qSW5 (Shomura et al. 2008), GW5 (Weng et al. 2008)
9 qgw9 S09082A–S09090C 93.8 6.7 0.05 3.0 novel QTL
GS 2 qgs2 S02026–S02039 54.8 15.1 −0.10 11.4 GW2 (Song et al. 2007)
3 qgs3.1 S03099–S03115 153.1 19.2 −0.09 7.4 qLWR-3 (Li et al. 2003)
3 qgs3.2 RM3766–RM218 58.3 7.9 0.04 4.0 novel QTL
4 qgs4 RM303–RM5503 193.1 13.1 0.05 7.8 lwr4.1 (Li et al. 2004)
5 qgs5.1 qSW5–S05047 4.8 74.9 0.14 48.1 qSW5 (Shomura et al. 2008), GW5 (Weng et al. 2008)
5 qgs5.2 S05048–S05054 69.9 37.5 0.08 29.1 - (Tan et al. 2000)
5 qgs5.3 S05066–S05077A 102.8 21.5 0.08 21.9 qLWR-5b (Li et al. 2003)
6 qgs6 S06105–S06124 125.2 8.7 0.06 6.5 - (Hagiwara et al. 2006)
100GW 1 q100gw1 S01157B–S01176 299.1 17.4 0.16 13.8 gw1.1 (Thomson et al. 2003), qTGW1-3 (Hittalmani et al. 2003), gw1.1 (Septiningsih et al. 2003), qTGW-1 (Hittalmani et al. 2002)
1 q100gw1 S01160–S01176 121.5 21.5 0.16 15.2 gw1.1 (Thomson et al. 2003), qTGW1-3 (Hittalmani et al. 2003), gw1.1 (Septiningsih et al. 2003), qTGW-1 (Hittalmani et al. 2002)
5 q100gw5 S05030A–S05048 65.2 21.4 −0.15 16.9 qSW5 (Shomura et al. 2008), GW5 (Weng et al. 2008)
5 q100gw5 S05038–qSW5 2.0 16.2 −0.12 11.4 qSW5 (Shomura et al. 2008), GW5 (Weng et al. 2008)
9 q100gw9 S09069–S09082A 87.2 16.3 0.10 8.2 gw9.1 (Thomson et al. 2003), qGW-9 (Suh et al. 2005)

z)Position is genetic distance (in centiMorgan) of the M-QTL from the first top marker on the chromosome.

y)F represents the F-statistic value.

x)A represents the estimated additive effect of HWC-line allele.

w)PVE(%) is the proportion of additive phenotypic variation explained by each QTL.

v)Same QTL has overlapping marker interval in two populations.

Digenic epistatic QTLs for culm length and grain shape in the HD population.

Trait Chr. Marker Interval i Chr. Marker Interval j AAz) PVE (%)y) ADx) PVE (%) DAw) PVE (%) DDv) PVE (%)
CL 5 S05066–S05077A 11 S11052–RM287 5.2** 2.8 −8.7** 0.1 −1.4 5.2 3.1 0.3
GS 3 S03099–S03115 (qgs3.1) 5 S05048–S05054 (qgs5.2) −0.02 0.2 0.10** 1.7 −0.10** 2.1 0.066 0.5
5 S05048–S05054 (qgs5.2) 5 S05066–S05077A (qgs5.3) 0.18** 1.7 0.03 0.0 −0.06 0.0 −0.15* 0.6

z)AA represents the estimated additive by additive effect.

y)PVE(%) is the proportion of phenotypic variation explained by each QTL.

x)AD represents the estimated additive by dominance effect.

w)DA represents the estimated dominance by additive effect.

v)DD represents the estimated dominance by dominance effect.

*,**denote significance levels of P<0.05, 0.001 respectively.

Table 1 The designed primers used in sequencing of sd1 coding region.
Table 2 Agronomic traits of three parents and two F2 populations established in the field in 2010.

SD is the abbreviation for standard deviation.

Min is the abbreviation for minimum.

Max is the abbreviation for maximum.

Table 3 Correlation coefficients among eight agronomic traits of HD population (Lower) and HH population (Upper).

* and ** indicate significant at 5% and 1% level, respectively.

Table 4 Number of polymorphic markers in two F2 populations.
Table 5 Main-effect QTLs underlying eight agronomic traits in two F2 populations.

Position is genetic distance (in centiMorgan) of the M-QTL from the first top marker on the chromosome.

F represents the F-statistic value.

A represents the estimated additive effect of HWC-line allele.

PVE(%) is the proportion of additive phenotypic variation explained by each QTL.

Same QTL has overlapping marker interval in two populations.

Table 6 Digenic epistatic QTLs for culm length and grain shape in the HD population.

AA represents the estimated additive by additive effect.

PVE(%) is the proportion of phenotypic variation explained by each QTL.

AD represents the estimated additive by dominance effect.

DA represents the estimated dominance by additive effect.

DD represents the estimated dominance by dominance effect.

denote significance levels of P<0.05, 0.001 respectively.