search for




 

Development of SNP Markers for Identification of Squash F1 Hybrid Cultivars Using Fluidigm-Based Genotyping
Plant Breed. Biotech. 2022;10:163-173
Published online September 1, 2022
© 2022 Korean Society of Breeding Science.

Jong-Geun Park1, Jeong-Eui Hong1, Md Abdur Rahim2, Ill-Sup Nou1*

1Department of Horticulture, Sunchon National University, Suncheon 57922, Korea
2Department of Genetics and Plant Breeding, Sher-e-Bangla Agricultural University, Dhaka 1207, Bangladesh
Corresponding author: Ill-Sup Nou, nis@sunchon.ac.kr, Tel: +82-61-750-3249, Fax: +82-61-750-3208
Received July 4, 2022; Revised August 9, 2022; Accepted August 10, 2022.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Squash (Cucurbita moschata D.) is an economically important vegetable of the Cucurbitaceae family. The genetic purity of commercial hybrid seed is crucial for the success of hybrid seed production. The molecular markers like single nucleotide polymorphism (SNP) can efficiently and cost-effectively distinguish the genetic differences among F1 hybrid cultivars. Therefore, in this study, we used ‘Fluidigm SNP Genotyping’ assay using 27 SNPs to distinguish and purity analysis of registered commercial F1 hybrid cultivars and F1 breeding lines of squash. Of these, eight SNP markers, including CMo-A01, CMo-A02, CMo-A04, CMo-A05, CMo-A12, CMo-A16, CMo-A20 and CMo-A25 can successfully identified heterozygotes from the registered commercial F1 hybrid squash cultivars with 100% accuracy and partial contamination was detected for F1 hybrid squash breeding lines which resulted due to outcrossing. Moreover, the HRM analysis of a registered commercial F1 hybrid cultivar ‘Parangsae’ with CMo-A03 SNP marker showed 96.30-100% purity of the cultivar. Our results suggest that the ‘Fluidigm SNP Genotyping’ technology could be a rapid and cost-effective method for cultivar differentiation and genetic purity analysis of F1 hybrids and squash cultivars.
Keywords : Molecular marker, Genetic purity test, Squash, SNP, Fluidigm assay, High-throughput genotyping, F1 hybrid, Cultivar
INTRODUCTION

Squash (Cucurbita moschata D., 2n = 2× = 40) is an important vegetable crop of the Cucurbitaceae family. As per archaeological remains, this crop was domesticated from southern Mexico and coastal Peru (Feriol et al. 2004; Jacobo-Valenzuela et al. 2011). It is an essential component in human diet in different parts of the world. In Korea, squash ranked second position in the area cultivated under Cucurbitaceous crops (Kim et al. 2016). The fruit pulp and seed are used for human consumption (Gomes et al. 2020; Mashitoa et al. 2021). The fruit pulp of squash is the richest source of carotenoids, lutein, vitamin C, dietary fiber, phenolic compounds and minerals, including K, Ca, P, Mg and Cu (Jacobo-Valenzuela et al. 2011). Besides, it has various culinary uses as a food ingredient in different preparations, including breads, pasties, soups etc. (Guiné et al. 2012). Moreover, squash has many health promoting properties, including anti-diabetic, anti-carcinogenic, and anti-microbial activities (Yadav et al. 2010; Kim et al. 2016).

The genetic purity assessment of F1 hybrid seed is essential for successful adoption of hybrid seed technology (Nandakumar et al. 2004). There are many commercial F1 hybrid squash cultivars available in the seed market of the world including Korea. Therefore, commercial seed producers need genetic purity tests to ensure quality seeds. Traditionally, grow-out-trials (GOTs) are carried out to test the seed genetic purity, which time consuming and labor expressive while molecular markers can potentially dis-criminate the genetic variation among F1 hybrid cultivars with a low cost (Yashitola et al. 2002; Ye et al. 2013; Pattanaik et al. 2018). Recently, molecular markers have already been proven as an effective approach for detection of genetic variations between F1 commercial cultivars (Jamali et al. 2019; Kim et al. 2021). For example, simple sequence repeat (SSR) markers are successfully used for differentiation of F1 cultivars in several agricultural crops, including onion (Tsukazaki et al. 2006), asparagus (Caruso et al. 2008), watermelon (Kwon et al. 2010), radish (Lee et al. 2015), pear (Pierantoni et al. 2004), melon (Kwon and Hong, 2014), pumpkin (Sim et al. 2015), and tomato (Phan et al. 2016), sunflower (Pallavi, et al. 2011). However, SSR marker has a limitation for high-throughput genotyping due to a large number of sample and markers (Guichoux et al. 2011). On the other hand, the next-generation sequencing technology allows large-scale detection of genetic variants, including single nucleotide polymorphisms (SNPs) (Serba et al. 2019; Kishor et al. 2021). Now-a-days, SNPs are considered to be the most commonly used powerful genetic markers in plant breeding for detection of genetic differences among various crop cultivars due to their co-dominant inheritance, high abundance in the genome and high- throughput genotyping (Gupta et al. 2008; Chung et al. 2014). Therefore, SNP based genotyping technology like Fluidigm SNP array has been developed for effective exploration of genetic differences in the commercial F1 hybrid cultivars, including pumpkin (Nguyen et al. 2020), melon (Kishor et al. 2020), watermelon (Park et al. 2022), chili pepper (Kim et al. 2017), tomato (Kim et al. 2020), pearl millet (Serba et al. 2019). In this study, we developed SNP type assays for a purity test of F1 cultivars/breeding line of squash for use in 27 Fluidigm SNP array which will be useful in developing a high-throughput SNP type assays for variety identification in commercial F1 hybrid squash cultivars.

MATERIALS AND METHODS

Plant materials

Seven F1 hybrid breeding lines (SQ001, SQ002, SQ003, SQ004, SQ005, SQ006, and SQ007) and seven commercial F1 cultivars (PMR Teunteunae, DN-A, DN-B, Nongwooae, Jinhanae, Parangsae, and Doksuri) of squash were collec-ted from Republic of Korea were used for validation of the newly developed SNP type assays in this study (Table 1). A total of 751 individuals of the parangsae cultivars were used for F1 hybrid seed purity testing.

Table 1 . List of F1 hybrid breeding lines and commer-cial F1 cultivars of squash used in this study.

No.Cultivars
1SQ001
2SQ002
3SQ003
4SQ004
5SQ005
6SQ006
7SQ007
8PMR Teunteunae
9DN-A
10DN-B
11Nongwooae
12Jinhanae
13Parangsae
14Doksuri


Genomic DNA extraction

The genomic DNA was extracted from the young leaves of each squash commercial F1 hybrid cultivars and F1 hybrid breeding lines using the ‘DNeasy Plant Mini Kit’ (Qiagen, Wilmington, USA) according to the manufacturer’s instructions. A Nanodrop spectrophotometer was used to determine the concentration and purity of the extracted DNA samples (Thermo Scientific, Wilmington, USA) and then diluted to a concentration of 20 ng/mL with nuclease- free water.

Fluidigm SNP assay

The SNP information of was collected from ‘Cucurbit Genomics Database (CuGenDB)’ available at http:// cucurbitgenomics.org. For genotyping, seven F1 hybrid breeding lines and seven commercial F1 cultivars were used for hybrid seed purity testing (Table 1). The Fluidigm SNP assay sets used in this study were synthesized by Macrogen, Korea (Table 2). The Fluidigm assay was performed using the platform ‘Fluidigm EP1 genotyping’ (Fluidigm, USA) according to the manufacturer’s protocol. The SNPs were then called using the ‘Fludigidm EP1 Genotyping’ analysis software (version 4.8.1).

Table 2 . List of SNPs used in ‘Fluidigm SNP Genotyping’ assays.

SNP Marker NameChromosomeLocation (bp)SNP [Ref/Alt]SNP (color of dye)a)
CMo-A0113,318,442…CAA[A/G]CCA…A(F):G(H)
CMo-A0219,837,040…TCT[G/A]AGG…G(F):A(H)
CMo-A0328,873,265…CTC[A/G]GCA…A(F):G(H)
CMo-A04210,378,972…GAG[G/A]ATT…G(F):A(H)
CMo-A0535,724,100…AGC[G/C]CCG…G(F):C(H)
CMo-A0636,119,169…AGG[T/C]TTA…T(F):C(H)
CMo-A0748,389,880…CTC[G/A]ATT…G(F):A(H)
CMo-A08420,447,172…TCC[C/T]TCA…C(F):T(H)
CMo-A0963,712,655…TTG[G/A]GTC…G(F):A(H)
CMo-A10611,115,368…TTC[C/T]CTC…C(F):T(H)
CMo-A1182,798,704…AGG[T/G]TAA…T(F):G(H)
CMo-A1286,252,977…AAA[C/A]AAA…C(F):A(H)
CMo-A13106,646,259…GCT[C/T]GAT…C(F):T(H)
CMo-A14114,451,324…GCC[G/A]AAC…G(F):A(H)
CMo-A15138,296,803…GAA[C/T]GCG…C(F):T(H)
CMo-A16151,475,799…TGT[G/C]CAA…G(F):C(H)
CMo-A17159,704,446…GGG[T/C]GTA…T(F):C(H)
CMo-A18161,782,015…TAT[G/A]TAG…G(F):A(H)
CMo-A19163,290,808…TTG[G/T]TGC…G(F):T(H)
CMo-A20168,018,335…GGG[G/T]AAA…G(F):T(H)
CMo-A21172,812,397…GAC[G/A]GTC…G(F):A(H)
CMo-A221710,502,431…TCC[C/T]GTA…C(F):T(H)
CMo-A23181,876,608…CAG[G/A]TCT…G(F):A(H)
CMo-A24183,666,538…TTT[C/G]ATG…C(F):G(H)
CMo-A251810,701,307…TCT[C/G]ACT…C(F):G(H)
CMo-A26203,466,354…TGC[C/A]AGA…C(F):A(H)
CMo-A27204,075,437…CTA[G/A]GCT…G(F):A(H)

a)F: FAM dye, H: HEX dye.



High resolution melting (HRM) analysis

SNPs were detected using high resolution melting (HRM) analysis combined with a 3’-blocked and unlabeled oligonucleotide probe (HybProbe) specific to the SNP site. The HRM primers used in this study were ordered from Macrogen (Table 3). After that, using a LightCycler 96 instrument, the gDNA was used for HRM analysis (Roche, Mannheim, Germany) according to the manufacturer’s instructions. HRM was carried out in 10 mL reaction mixtures containing 1 mL at 5ng/mL DNA, 0.1 mL of forward primer (10 pmol), 0.5 mL of reverse primer (10 pmol), 0.5 mL of probe (10 pmol), 0.3 mL of SYTO9 fluorescent dye (Invitrogen, USA), 5 mL of HS prime LP premix (GENETBIO, Korea), and 2.6 mL of DDW. HRM conditions were include three steps, first step is pre- incubation (300 seconds initial pre-incubation at 95℃), second step is 40 cycle of 3 step amplification (95℃ for 10 seconds, 64℃ to 56℃ for 15 seconds under touchdown and 72℃ for 15 seconds), and the last step is HRM reading (last step is four readings per ℃ at the final step after 60 seconds at 95℃, 60 seconds at 40℃, and 1 at 97℃). HRM data was analyzed using LightCycler 96 software (version 1.1) with a 0.2 positive/negative threshold level and 100 percent discrimination for delta Tm and curve shape.

Table 3 . List of primer and probe sequences used in HRM assay of SNPs.

HRM MarkerPrimer (5’-3’)
ForwardReverseProbea)
CMo-A01PAGTCTTCAGTGCCAACGGTGATTCATGGGTTTTGGAGGAGATTCTTATCAGATTGGCAGGCAAACCATGAGCAT
CMo-A02PATTGCCAAAATGCCATTAAGTAAGCGTTGTAGTTTTAGCTGCTGCTCTCACTGCAAATCTTACCTCTGAGGTGTTT
CMo-A03PATTATAGAACATGATATGCTGCCCACTCCCTTACGCTATCACTTGTTTGTTAAACATTCACAAATCTCAGCATCATCC
CMo-A04PGTCCACCAACCCATTATGCTTTGAAAAGAGGCAATAGTGGAAGAACTTGAGCAAGGTGGAGAGGATTGTTTCCA
CMo-A05PTGAGCAGCTCTTCAACCTCTTCGAATGCTGCAGTTTCAAATTGGGTTTCAAGGAATGTACCAGCAGCGCCGAGA
CMo-A06PAGCAGCAATGTTGGCAGTGGCAAATTCCCATGTTGACCTCAATGTCCTAAGGCACCAATGCCTAAACCTCGCA
CMo-A07PGATGAAGTTTCTTCAAGAACTAGTCCGACATAGTTAATGATTTCGTCTAGCATCACATCAATTCGCTCGATTAAAGTT
CMo-A08PTTGAAGTCCATGCAGCCCTTGTTCTGTTCTTCAGCCTCAATGTGGATAGACCATTTCTCTCCCTCAATCACT
CMo-A09PTGAAACTGTGTAAACTGGCTGCTCTCATGTTGGATTTAAGAAATGGAAGAAGTTCAAGAGGAATTGGGTCTGAAGAA
CMo-A10PCAATTGGAGAAAGGGTTTCGCGAGCAGCAGCGGAATGAAGTTGATTGAAGAACTCGATTCCCTCGAGAG
CMo-A11PCTTATATGTGCATGGAGAAACGGCCATGAGAGAAATGATGAAAGGACAGTCCCTAAAACCTTAACCTCTTTCAG
CMo-A12PGCGGTTGTTACTCATATAATGAGAAGGAGCATCTGCAGCAAGTTCTCTCTGTTTTCCCTTTGTTTGGGGTTGTT
CMo-A13PGAGGTTGCACATCGGCTAGGTCTGCAGCAAGACCTATAGGATTTGAGAGAAGAGGCTTGATCCACAAAGTT
CMo-A14PATGTCAAATAAATCTGTCTCGACGCTGGAATGGATAATCTAGAGCTACAGTCTGGAAATGCCGAACTTTTGATACT
CMo-A15PCGGCATTGTCGAGAGATATCGAATCGTGAAGAACTCCATAATGGCTACCGATAAGCTTCGCATTCCTGTTG
CMo-A16PTGTACTTTCATGGAAGCTGGCGTTTGACGGTTCGGAGGTTGGAGATACGGAAGATGTGCAAAGACGCCAT
CMo-A17PGTGATATAATTCCAGTAATTTGCAGCTTGCCCATTCTATTGCAGCTATAGTTCATCCTACGCCCATCGGTTCAT
CMo-A18PTCTTGATCTCTTCCATTCTGGATCGATGAAGCAAGCGAAATTGCTACATCTACGTCTTATATAGATTCTGACACG
CMo-A19PGCAGCTATCTAAGAAGGCTAAATATCATGATTCGAAGAAACTGCCGAATTAGTTCCTTCTTTGGTTGGTGCAATGTGC
CMo-A20PCCGAAACTCAACGTCAAATAATGTGACGGAGAGCGAAGGGCTAAATTTTCAAGTCTTTTCCCCACCATCCAAT
CMo-A21PTGATTGCGAAATAGTCTTTCGTTGCTCTTGTTCAGCGTTCGAGTATCGAGACTCGACGACGGTCACGATGA
CMo-A22PTGCTTATCAGAGTGGCATTTATTCTGGAGCTTAGTAAGAATGGTGATTAGAACAGACATACCGTCCTGTACAGTAAGA
CMo-A23PGAAGCTTACAAACGGGTATGCAGAATATGTAGTGTTCTTGATAGTGTTAATGTGACAAAGACGCTGCCATTGTCTT
CMo-A24PCTCACTTAAGAGGATCCAGGGTGTGCCTTGAACACCAATGTTGCCTTCATGACAGCATGAAAAGCATTCTCTG
CMo-A25PTACGAGTCGCATTTCTTGACCGACGAAGTTAGCACAGTAATAGTCATCTTAGGTCATTTCTGACTTTGATGCTAG
CMo-A26PCTGTCAACTGTTTGAATACTCGGGGTACCTAACAGTTGAAGAATCTCCATGGACCAGAAATGCAAGAAATGGAG
CMo-A27PCATGTGAGCTGCTGTGGACGATTACAAGCGAAAGACTTCATAGCAGATATAGGAATAGATCTAAGCTGAATGGCT

a)Bold indicates SNP.


RESULTS

We analyzed a total of 192 primer sets for the ‘Fuidigm SNP type’ assays and 29 of which had successful DNA amplification (Fig. 1, Table 2). The red, green, and blue dots represent XX (fluorescence of only the FAM dye), XY (both FAM and HEX dyes), YY (only HEX dye), respec-tively. The SNP markers and their chromosomal position of 27 successful SNPs are presented in Table 2. The primers and probe sequences of each SNP marker are present in Table 3. The marker type of each SNP type assay was divided into homozygote reference SNP (XX), homo-zygote alternative SNP (YY) and heterozygotes (XY) (Fig. 1 and Table 4). Twenty-nine SNP markers were further checked by the high resolution melting (HRM) analysis (Fig. 2) and 27 SNP markers can distinguish three different types (Table 4), including homozygote reference SNP (XX), homozygote alternative SNP (YY) and heterozygotes (XY). Eight SNP markers (CMo-A01, CMo-A02, CMo- A04, CMo-A05, CMo-A12, CMo-A16, CMo-A20 and CMo-A25) accurately distinguished hetero-zygotes (XY) from the registered commercial F1 hybrid squash cultivars while partially heterozygotes (XY) and partially homozy-gotes (XX and YY) from the analyzed squash breeding lines (Table 4). Three SNP markers (CMo-A06, CMo-A11 and CMo-A13) were distinguished all the registered com-mercial F1 hybrid squash cultivars either as homozygote reference allele (XX) or homozygote alternate allele (YY) but partially heterozygotes (XY) and partially homozygote reference allele (XX) from the squash breeding lines. However, CMo-A08 successfully identified most of the registered commercial F1 cultivars as heterozygotes (XY) except ‘Doksuri’ and CMo-A24 iden-tified the heterozygotes except ‘Doksuri’ and ‘PMR Teun-teunae’.

Table 4 . Validation of ‘Fluidigm SNP Genotyping’ assay developed for the purity test.

AssaySQ001SQ002SQ003SQ004SQ005SQ006SQ007PMR
Teun-teunae
DN-ADN-BNong-wooaeJin-hanaeParang-saeDok-suri
CMO-A01YYYYXYXYXYYYYYXYXYXYXYXYXYXY
CMO-A02YYYYXYXYXYYYXYXYXYXYXYXYXYXY
CMO-A03YYYYXYYYYYYYXYYYXYXYXYXYXYXY
CMO-A04XYYYXYXYXYYYXXXYXYXYXYXYXYXY
CMO-A05XXXYXYXYXYXYXYXYXYXYXYXYXYXY
CMO-A06XXXYXYXYXXXYXYXXXXXXXXXXXXXX
CMO-A07XXXXXXXXXXXXXXXXXXXXXXXXYYXY
CMO-A08YYYYXYXYXYYYXYXYXYXYXYXYXYXX
CMO-A09XXXXXYXYXYXXXYXXXYXYXYXYXYXY
CMO-A10XYXXXXXXXXXXXXXXXYXYXYXYXYXY
CMO-A11YYYYXYYYYYYYXYYYYYYYYYYYYYYY
CMO-A12XXXXXYXYXYXXXYXYXYXYXYXYXYXY
CMO-A13XXXXXYXXXXXXXYXXXXXXXXXXXXXX
CMO-A14XXXXXXXYXXXXXYXXXYXYXYXYXYXY
CMO-A15XYYYYYXYYYYYXYXYXYXYXYXYYYYY
CMO-A16XYXXXXXYXYXXXYXYXYXYXYXYXYXY
CMO-A17XYYYXYXYXYYYXXXYXYXYXYXYXXXX
CMO-A18XYYYYYXYXYYYXYXYXYXYXYXYXXXX
CMO-A19YYYYYYYYYYYYYYYYXYXYXYXYYYYY
CMO-A20XYYYYYYYXYYYXYXYXYXYXYXYXYXY
CMO-A21YYYYXYXYXYYYXYXYXYXYXYXYXYXX
CMO-A22XYXXXYXYXYXXYYXYXYXYXYXYXYXX
CMO-A23XYXYYYYYYYYYXXYYXYXYXYXYXYYY
CMO-A24XYXYXXXXXXXXXYXXXYXYXYXYXYXX
CMO-A25XYXXXXXYXYXXXYXYXYXYXYXYXYXY
CMO-A26XXXXXYXXXXXXXYXXXXXXXXXXXXXY
CMO-A27YYYYXYYYYYYYXYYYXYXYXYXYXYXY


Figure 1. Scatter plots of 27 ‘Fluidigm SNP Genotyping’ assays. Red, blue and green dots indicated XX (fluorescence of the only FAM dye), XY (both FAM and HEX dyes) and YY (only HEX dye) types, respectively.

Figure 2. HRM curve profiles of 27 SNP primers (CMo-A01P – A27P). XX, YY and XY indicate reference SNP, alternative SNP and heterozygotes, respectively.

Further, the genetic purity of the registered commercial F1 hybrid cultivar was determined by HRM analysis using CMo-A03 SNP marker (Fig. 3). Four lots of individuals from the registered commercial F1 hybrid cultivar ‘Paransae’ were used to determine genetic purity (Table 5). The HRM analysis results revealed that LOT1 (186 heterozygotes out of 186 individuals), LOT3 (187 heterozygotes out of 187 individuals) and LOT4 (189 heterozygotes out of 189 individuals) showed 100% purity whereas LOT2 (182 heterozygotes out of 189 individuals) had 96.3% purity (Table 5).

Table 5 . Results of purity test in ‘Parangsae’ cultivars.

CultivarLotsNo. of indivi-dualsSNP markerHeterozygote (F1)Purity (%)
ParangsaeLOT1186CMo-A03186100
LOT2189CMo-A0318296.3
LOT3187CMo-A03187100
LOT4189CMo-A03189100


Figure 3. HRM curve profiles for purity test of ‘Parangsae’ F1 cultivars using CMo-A03 marker. (A) LOT1 of ‘Parangsae’, (B) LOT2, (C) LOT3 and (D) LOT4. Red and blue curves indicate genotypes of parental and F1, respectively.
DISCUSSION

The genetically pure seed crop cultivar is the key criteria for commercial cultivars including F1 hybrids. We aimed to develop SNP marker set for rapid and high-throughput genotyping system to identify and genetic purity analysis of squash cultivars based on ‘Fluidigm SNP Genotyping’ assay. The ‘Fluidigm SNP Genotyping’ assay is a cost- effective platform for distinguishing commercial crop cul-tivars (Park et al. 2022). The genetic purity of commercial F1 hybrids and cultivars is of great importance for the success of plant breeding programs (Kishor et al. 2020).

In this study, we analyzed seven registered commercial F1 hybrid cultivars and seven squash breeding lines using 27 SNP markers based on ‘Fluidigm SNP Genotyping’ assay to evaluate the genetic purity (Table 1 and 5). The results showed that all the tested SNP markers had successful DNA amplification in both the eight registered commercial F1 hybrid cultivars and the seven breeding lines of squash (Fig. 1 and Table 3). Moreover, all of those markers were analyzed using HRM analysis and all were amplified (Fig. 2). Similar results on HRM-based SNP markers for genetic purity analysis of cultivars/species were reported in melon and Capsicum species (An et al. 2010; Jeong et al. 2010). Even though total 27 SNP markers were tested, eight SNP markers (CMo-A01, CMo-A02, CMo-A04, CMo-A05, CMo-A12, CMo-A16, CMo-A20 and CMo-A25) successfully identified hetero-zygotes (XY) from the registered commercial F1 hybrid squash cultivars with 100% accuracy (Table 3). However, in case of squash breeding lines, partially heterozygotes (XY) and partially homozygotes alleles (XX and YY) were identified which suggested that those F1 hybrid squash breeding lines were contaminated due to outcrossing. Similar results were previously reported in several crop species (Pattanaik et al. 2018; Kishor et al. 2020). Then again, HRM analysis of a registered commercial F1 cultivar ‘Parangsae’ with CMo-A03 SNP marker also revealed 96.30-100% purity of the cultivar (Fig. 3 and Table 4). Our results suggested that ‘Fluidigm SNP Genotyping’ platform could be an effective approach for purity testing and identification of registered commercial squash F1 hybrids cultivars and breeding lines.

STATEMENT

All our experiments complied with local and national regulations.

CONFLICT OF INTEREST

The authors declare that they have no competing interests.

FUNDING

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through Digital Breeding Transformation Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (Project number 322071-03) and Sunchon National University Research Fund in 2020 (Grant no. 2020-0192).

AUTHOR’S CONTRIBUTIONS

I.-S.N. conceived the study. J.-G.P. and J.-E.H. con-ducted the experiments and analyzed the data. M.A.R. wrote and revised the final version of the manuscript. All authors read the final version and approved the manuscript.

References
  1. Caruso M, Federici CT, and Roose ML. 2008. EST-SSR markers for asparagus genetic diversity evaluation and cultivar identification. Mol. Breed. 21(2): 195-204.
    CrossRef
  2. Chung H, Jeong YM, Mun JH, Lee SS, Chung WH, Yu HJ. 2014. Construction of a genetic map based on high- throughput SNP genotyping and genetic mapping of a TuMV resistance locus in Brassica rapa. Mol. Genet. Genom. 289(2): 149-160.
    Pubmed CrossRef
  3. Ferriol M, Pico B. de Cordova PF, Nuez F. 2004. Molecular diversity of a germplasm collection of squash (Cucurbita moschata) determined by SRAP and AFLP markers. Crop Sci. 44(2): 653-664.
    CrossRef
  4. Gomes RS, de Almeida CF, Chagas RR, Júnior RM, Fara JS, da Silva DJH. 2020. Winter squash (Cucurbita moschata D.) Displays Promising Nutritional Aspects in Fruits, Seeds and in the Seed Oil. J. Plant Biochem. Physiol. 8: 248.
  5. Guichoux E, Lagache L, Wagner S, Chaumeil P, Léger P, Lepais O, et al. 2011. Current trends in microsatellite genotyping. Mol. Ecol. Resour. 11(4): 591-611.
    Pubmed CrossRef
  6. Guiné RPF, Henrriques F, João Barroca M. 2012. Mass Transfer Coefficients for the Drying of Pumpkin (Cucurbita moschata) and Dried Product Quality. Food Bioproc. Tech. 5: 176-183.
    CrossRef
  7. Gupta PK, Rustgi S, Mir RR. 2008. Array-based high- throughput DNA markers for crop improvement. Heredity 101(1): 5-18.
    Pubmed CrossRef
  8. Jacobo-Valenzuela N, Zazueta-Morales JJ, Gallegosinfante JA. 2011. Chemical and physicochemical characterization of winter squash (Cucurbita moschata D.) Notulae. Botanicae. Horti. Agrobotanici. Cluj-Napoca.9: 34-40
    CrossRef
  9. Jacobo-Valenzuela N, Maróstica-Junior MR, de Jesús Zazueta-Morales J, Gallegos-Infante JA. 2011. Physico-chemical, technological properties, and health-benefits of Cucurbita moschata Duchense vs. Cehualca: A Review. Food Res. Int. 44(9): 2587-2593.
    CrossRef
  10. Jamali SH, Cockram J, Hickey LT. 2019. Insights into deployment of DNA markers in plant variety protection and registration. Theor. Appl. Genet. 132(7): 1911-1929.
    Pubmed CrossRef
  11. Jeong HJ, Jo YD, Park SW, Kang BC. 2010. Identification of Capsicum species using SNP markers based on high resolution melting analysis. Genome 53(12) 1:029-1040.
    Pubmed CrossRef
  12. Kim DK, Seo SG, Kwon SB, Park YD. 2016. Development of RAPD and SCAR markers related to watermelon mosaic virus and zucchini yellow mosaic virus resistance in Cucurbita moschata. Hortic. Environ. Biotechnol. 57(1): 61-68.
    CrossRef
  13. Kim H, Yoon JB, Lee J. 2017. Development of fluidigm SNP type genotyping assays for marker-assisted breeding of chili pepper (Capsicum annuum L.). Hortic. Sci. Technol. 35(4): 465-479.
    CrossRef
  14. Kim M, Jung JK, Shim EJ, Chung SM, Park Y, Lee GP, et al. 2021. Genome-wide SNP discovery and core marker sets for DNA barcoding and variety identification in commercial tomato cultivars. Sci. Hortic. 276: 109734.
    CrossRef
  15. Kishor DS, Noh Y, Song WH, Lee GP, Jung JK, Shim EJ, et al. 2020. Identification and purity test of melon cultivars and F1 hybrids using fluidigm-based snp markers. Hortic. Sci. Technol. 38(5): 686-694.
  16. Kishor DS, Noh Y, Song WH, Lee GP, Park Y, Jung JK, et al. 2021. SNP marker assay and candidate gene identifi-cation for sex expression via genotyping-by-sequencing- based genome-wide associations (GWAS) analyses in Oriental melon (Cucumis melo L. var. makuwa). Sci. Hortic. 276: 109711.
    CrossRef
  17. Kwon YS, Oh YH, Yi SI, Kim HY, An JM, Yang SG, et al. 2010. Informative SSR markers for commercial variety discrimination in watermelon (Citrullus lanatus). Genes Genom. 32(2): 115-122.
    CrossRef
  18. Lee ON, Park HY. 2017. Assessment of genetic diversity in cultivated radishes (Raphanus sativus) by agronomic traits and SSR markers. Sci. Horti. 223: 19-30.
    CrossRef
  19. Mashitoa FM, Shoko T, Shai JL, Slabbert RM, Sultanbawa Y, Sivakumar D. 2021. Influence of different types of drying methods on color properties, phenolic metabolites and bioactivities of pumpkin leaves of var. Butternut squash (Cucurbita moschata Duchesne ex Poir). Front. nutr. 8.
    Pubmed KoreaMed CrossRef
  20. Nandakumar N, Singh AK, Sharma RK, Mohapatra T, Prabhu KV, Zaman FU. 2004. Molecular fingerprinting of hyb-rids and assessment of genetic purity of hybrid seeds in rice using microsatellite markers. Euphytica 136(3): 257- 264.
    CrossRef
  21. Nguyen NN, Kim M, Jung JK, Shim EJ, Chung SM, Park Y, 2020. Genome-wide SNP discovery and core marker sets for assessment of genetic variations in cultivated pumpkin (Cucurbita spp.). Hortic. Res. 7: 121.
    Pubmed KoreaMed CrossRef
  22. Pallavi HM, Gowda R, Shadakshari YG, Bhanuprakash K, Vishwanath K. 2011. Identification of SSR markers for hybridity and seed genetic purity testing in sunflower (Helianthus annuus L.). Helia 34(54): 59-66.
    CrossRef
  23. Park JY, Jang YJ, Jung JK, Shim EJ, Sim SC, Chung SM. 2022. Development of SNP Markers for the Identification of Commercial Korean Watermelon Cultivars Using Fluidigm Genotyping Analysis. Hortic. Sci. Technol. 40(1): 75-84.
  24. Pattanaik A, Reddy DCL, Ramesh S, Aswath C. 2018. Comparison of traditional grow-out test and DNA-based PCR assay to estimate F1 hybrid purity in cauliflower. Curr. Sci. 115: 2095-2102.
    CrossRef
  25. Phan NT, Kim MK, Sim SC. 2016. Genetic variations of F1 tomato cultivars revealed by a core set of SSR and InDel markers. Sci. Hortic. 212: 155-161.
    CrossRef
  26. Pierantoni L, Cho KH, Shin IS, Chiodini R, Tartarini S, Dondini, L. et al. 2004. Characterisation and transfera-bility of apple SSRs to two European pear F1 populations. Theor. Appl. Genet. 109(7): 1519-1524.
    Pubmed CrossRef
  27. Serba DD, Muleta KT, Amand P, Bernardo A, Bai G, Perumal R, Bashir E. 2019. Genetic diversity, population structure, and linkage disequilibrium of pearl millet. Plant Genome 12(3): 180091.
    Pubmed CrossRef
  28. Sim SC, Hong JH, Kwon YS. 2015. DNA profiling of commercial pumpkin cultivars using simple sequence repeat polymorphisms. Hortic. Environ. Biotechnol. 56(6): 811-820.
    CrossRef
  29. Tsukazaki H, Fukuoka H, Song YS, Yamashita KI, Wako T, Kojima A. 2006. Considerable heterogeneity in commer-cial F1 varieties of bunching onion (Allium fistulosum) and proposal of breeding scheme for conferring variety traceability using SSR markers. Breed. Sci. 56(3): 321- 326.
    CrossRef
  30. Yadav M, Jain S, Tomar R, Prasad GBKS, Yadav H. 2010. Medicinal and biological potential of pumpkin: an updated review. Nutr. Res. Rev. 23(2): 184-190.
    Pubmed CrossRef
  31. Yashitola J, Thirumurugan T, Sundaram RM, Naseerullah MK, Ramesha MS, Sarma NP, et al. 2002. Assessment of purity of rice hybrids using microsatellite and STS markers. Crop Sci. 42(4): 1369-1373.
    CrossRef
  32. Ye S, Wang Y, Huang D, Li J, Gong Y, Xu L, et al. 2013. Genetic purity testing of F1 hybrid seed with molecular markers in cabbage (Brassica oleracea var. capitata). Sci. Hortic. 155: 92-96.
    CrossRef


September 2022, 10 (3)
Full Text(PDF) Free

Cited By Articles
  • CrossRef (0)

Funding Information

Social Network Service
Services
  • Science Central