Landrace can be defined as a dynamic population of a cultivated plant that has historical origin, distinct identity and lacks formal crop improvement, as well as often being genetically diverse, locally adapted and associated with traditional farming systems (Camacho et al. 2005). Kwon et al. (2000) reported that Korean rice landrace contain high genetic diversity compared to Korean japonica cultivar and this result shows the potential value of landrace.

Meanwhile, one of the problems discussed recently in Korea rice cultivation is bakanae disease. Although this disease had not been big problem over the last few decades, incidence of bakanae disease has been increased recently because of some reasons such as climate change and spread of organic farming which don’t use chemical fungicides (Park et al. 2003; Hur et al. 2016). This disease occurred 28.8% of rice paddy in 2006 and 31% in 2013 (Han 2007; Hur et al. 2016). Since infected seedlings normally die or bear empty grains later when it grows up, increased bakanae disease led to serious yield loss (Ou 1985; Yasin et al. 2003). The common way to prevent bakanae disease is seed disinfection using hot water or fungicide (Hayasaka et al. 2001). But the hot water immersion method can’t work when rice seed is severely infected because its effect cannot be efficiently transmitted into the pericarp layers. And using fungicides can be restricted due to pathogens which have tolerance to fungicides (Ishii et al. 1989; Lee et al. 2010). Moreover, because the fungicides can harm environment, it can’t be used for organic farming. To help this situation, alternative solution is required. In this situation, developing resistance resource would be efficient, environment friendly way to prevent danger from bakanae disease. Accordingly, to secure genetic control to bakanae disease, several studies have been processed and several QTLs related to resistance to bakanae disease were identified (Hur et al. 2015; Fiyaz et al. 2016; Volante et al. 2017; Ji et al. 2018). However genetic resources that is clearly identified to have resistance to bakanae disease is not sufficient (Li 1993; Khokhar et al. 2002; Hur et al. 2016; Volante et al. 2017).

Plant materials

Total 359 rice landrace used for estimation of bakanae resistance with ‘Shingwang’ as resistant control and ‘Ilpum’ as susceptible control. ‘Shingwang’ and ‘Ilpum’ showed clear different resistance to bakanae before (Hur et al. 2016). Isolate used for inoculation is CF283 reported that have tolerance to tebuconazole and benomyl (Lee et al. 2010).

Evaluation of bakanae disease resistance

To identify resistance to bakanae disease rice have been inoculated by different ways such as cultured fungal spores (Khokhar et al. 2002; Iqbal et al. 2011; Lee et al. 2011), artificially infected soil (Rajagopalan 1961) and naturally infected soil (Saremi et al. 2008). This study was performed based on method of Kim et al. (2014) and Hur et al. (2016). For inoculation, pathogen cultured by using PDB (Potato Dextrose Broth) was diluted with water and set the concentration of solution to 2 × 10⁶ spore/mL. Then, 30 seeds per each accession were contained in separated tissue embedding cassette to soak seeds for inoculation. These tissue embedding cassette had been soaked in the solution for 3 days with dark condition and the temperature was 26℃. After inoculation, seeds were sowed on seedling boxes. They had been grown in green house for 3 weeks to identify their response to pathogen and phenotype. Estimation of phenotype was based on method of Hur et al. (2016). The response to pathogen was evaluated by calculating the plants showing resistance in each line after rating population`s vitality as 5 levels (1 - resistant to 9 - susceptible)

(Fig. 1a). In each population, plants hard to find symptoms of bakanae disease were considered as showing resistance (score 1 and 3) whereas plants showed severe irreversible symptoms and died plants are classified as susceptible plant (score 9). Meanwhile, plants which had mildest symptoms were classified as moderately resistant plant (score 5 and 7) (Fig. 1b). To make their phenotype as numeric data, the resistance of each accession was calculated as (sum of individuals * resistant score; resistance 1, moderate 0.5, susceptible 0)/germinated individuals. The estimated proportion of healthy plants were converted to percentage.

Figure 1. Evaluation of resistance to bakanae disease. (a) 1: resistance-9: sensitive. (b) Categoryzing resistant, moderately-resistant, susceptible.

Validation of the QTL markers

We performed genotype screening of reported primer (Table 1) with 24 accessions which showed strong resistance (Table 2)

Table 1 . Sequences of screening resistant genotype to bakanae disease.

Marker	Sequence	Reference
1625IND	F	AAACAAGTTGGTTGGCGAGCTAC	Cheon et al. (2019)
	R	AGATTACGCCTTGGAACCTGTTA
1675IND	F	TTTCTACTAAGTCACGTAGCATGCTCC
	R	ATGTTCGTCGTATGCATAGCCAAAC

Table 2 . Some agricultural traits of 24 rice landraces with strong resistant to bakanae disease.

No.	Name	IT no.	Headingdate	Culm length	Grain length	Grain width	Endosperm type	Bakanae resistance(%)
1	Taegujo	k026144	08월 15일	109	6.4	3.3	Normal	91.3
2	Guwangdo	IT005044	08월 29일	124	6.2	3.4	Normal	94.8
3	Weonsanchalbyeo	IT151696	08월 16일	78	6.6	3.4	Waxy	94
4	Jjokjebichal	IT010631	09월 07일	101	7.7	3.5	Waxy	90
5	Hongdo	IT009118	08월 13일	100	7	3.4	Normal	92.6
6	Joslbichal	IT155896	08월 27일	90	6.5	3.2	Normal	85.7
7	Daejichal	IT155895	09월 08일	90	6.6	3.5	Normal	91.1
8	Guhwangdo	IT005068	08월 16일	92	7.4	3.3	Normal	87.9
9	Hyoseongjaeraejong	IT009221	08월 13일	85	7.6	3.1	Normal	87
10	Gangweondo	IT004770	08월 11일	78	6.1	3.4	Waxy	94.6
11	Daesona	k026156	08월 15일	91	6.5	4	Waxy	87
12	Chanarak	IT008732	08월 26일	100	6.5	3.6	Waxy	86.5
13	Akkudichal	k026159	08월 29일	106	7.1	3.3	Waxy	100
14	Baekcheon	IT006385	08월 02일	90	7	3.6	Normal	92.6
15	Ssalbyeo	IT006578	08월 23일	109	6.1	3.2	Normal	93.3
16	Sukna	IT007274	08월 25일	112	6.3	3.2	Normal	91.4
17	Cheonjeungdo	IT008804	08월 27일	125	6.7	3.6	Normal	91.4
18	Annamjo	IT007464	08월 24일	100	6.8	3.2	Waxy	94.2
19	Gakssina	k026169	08월 04일	83	6.6	3.3	Waxy	93.8
20	Kangnungdo	k026171	09월 02일	102	6.8	3.3	Waxy	96.7
21	Jinhwa	IT008725	08월 29일	106	6.1	3.4	Waxy	88.3
22	Jeokseongna	k026175	08월 26일	110	6.5	3.2	Waxy	91.1
23	Sukna	IT007270	08월 29일	109	6.1	3.3	Waxy	92.6
24	Yongcheon	IT007747	08월 15일	120	7.2	3.4	Waxy	88.5

and control group to identify their genotype and whether it is possible to use the marker for selecting resistant resources from Korean landrace group. The marker used in this experiment is Indel marker from Nampyeong related to qFfR1 which is located on 87.9-91.7 cM in chromosome 1. Because this QTL share same position with other QTL reported from different accessions belong to other ecotype, it is expected that it will work in broad range of genetic resources (Hur et al. 2015; Fiyaz et al. 2016; Ji et al. 2018).

Evaluation of bakanae disease resistance

Korean rice landrace group which consists of temperate japonica type mainly, could be used as material for developing resistant varieties in Korea by crossing with elite varieties. In this study, we could identify 44 lines involved in highest resistance score. Especially, there were 17 lines which showed resistance rate over 90%. By comparing different traits of these resources, it would be possible to utilize them as material of resistant varieties (Table 2). However, since Korean rice landraces had been tested only one time, it would be need more precise confirmation. Moreover, to develop stable varieties which can show resistance constantly in various conditions, additional study on landrace resources to identify resistant gene and its mechanism of resistant resource would be required too. To utilize bakanae resistant resource in Korea where normally cultivate temperate japonica type varieties, using accessions belong to temperate japonica type would be recommended. Moreover, to maintain agriculturally useful features like short height and higher grain weight, using bred resource in Korea rather than weedy rice or introduced rice would be recommended too. Thus, the result suggested highly strong 3 acessions (‘IT010631’, ‘IT009118’ and ‘IT009221’. to be used in breeding program. The temperate japonica accessions which showed resistance to bakanae disease included not only Korean accession but also accessions from other countries like China too. Besides, Jeju collections which showed resistance would not be adequate for developing varieties since they are weedy rice. Meanwhile, although ‘Milyang 88’, ‘Namseon 126’, ‘Suweon 159’ have not highly resistant trait, they have better adaptability to Korean agriculture because they are bred line from Korea. To develop useful bakanae resistant varieties efficiently, using these resources as material with existing elite varieties could be a good way.

Validation of the QTL markers

Markers what we used in this study is related to qBK1, qBK1.1 and qFfR1 (Table 1). Although these QTLs are discovered from different accessions, they share same position and it support a possibility that the putative gene works in different genetic resources (Hur et al. 2015; Fiyaz et al. 2016; Ji et al. 2018). However, the marker related to them showed discordance with observed traits in Korean rice landrace group which is different with any of accessions that have been used for deriving QTL before (Table 2, Fig. 2).

Figure 2. Results from genotype screen of 24 resistant accessions with (a) 1625IND and (b) 1675IND. M: 100bp ladder, IP; ILPUM, SG; SHINGWANG, 1: Taegujo, 2: Guwangdo, 3: Weonsanchalbyeo, 4: Jjokjebichal, 5: Hongdo, 6: Joslbichal, 7: Daejichal, 8: Guhwangdo, 9: Hyoseongjaeraejong, 10: Gangweondo, 11: Daesona, 12: Chanarak, 13: Akkudichal, 14: Baekcheon, 15: Ssalbyeo, 16: Sukna, 17: Cheonjeungdo, 18: Annamjo, 19: Gakssina, 20: Kangnungdo, 21: Jinhwa, 22: Jeokseongna, 23: Sukna, 24: Yongcheon.

We could identify 3 accessions which showed same genotype with ‘Shingwang’. Compare to other accessions which showed genotype of ‘Ilpum’, these accessions didn’t have significant different bakanae resistance. In the 16 accessions which showed resistance over 90%, only 2 accessions were observed as containing resistant genotype. Moreover, mean resistance of ‘Ilpum’ type accession is lower than ‘Shingwang type’s. This result support that there would be other putative gene related to bakanae resistance and landraces could be novel genetic material for bakanae resistant varieties. Additionally, it would be needed to analysis on their unveiled genes.

This research was funded by Rural Development Administration, grant number PJ01579403.