Plant Breeding and Biotechnology : eISSN 2287-9366 / pISSN 2287-9358

Table. 1.

Table. 1.

Primer sequences and PCR conditions.

Marker name Primer sequence (5'→3') Cycles Tann size Reference
HlMSM_1_F TCAGTCCCTAACGCAACACC 35 60 340
HlMSM_1_R TGTGTTGAAATTGCCGGCTG

HlMSM_17_F TTCTCCTCCGAACCCGTTTC 35 65 326
HlMSM_17_R CCCGCAGCCTCTTTTATTGC

HlMSM_22_F TGCCCGTATCAACAGAAGCG 35 65 199
HlMSM_22_R GTGGCAGCATAGGGGAAGAA

HlMSM_29_F AGGTAGTAATCCCATGCAGCTC 35 65 150
HlMSM_29_R TGCACTTTCACGACCCAAGT

hPb-CONT_F TCATCAGCAGGTGGGTCAGGCA 35 60 400 (Cerenak et al. 2019)
hPb-CONT_R TCCGCACTTCTCTCACAGGCGA

contig18_F TCCTGGTCCCTGCGGAAAGGAA 35 60 569 (Cerenak et al. 2019)
contig18_R AGAGCGCGCCCCTGATAATTGC

Tann: annealing temperature in ℃; size: expected size in base pairs

Plant Breed. Biotech. 2024;12:10-6 https://doi.org/10.9787/PBB.2024.12.10
© 2024 Plant Breed. Biotech.