Plant Breeding and Biotechnology : eISSN 2287-9366 / pISSN 2287-9358

Table. 1.

Table. 1.

Primer and probe sequences used for discriminating the resistance vs susceptible genotypes via High Resolution Melting (HRM) assay.

Marker name SNP name Primer (5’-3’) SNPs
Direction Sequence
PMm-HRM-1 SNPR5-119 Forward CAAATAAAGAACCTTCAGTTTGAATGG
Reverse TGAGTTTAACAATTACCAAAATTCATGG
Probe GTTTATCTTTTGCCTCGATGCGAAA T > C
PMm-HRM-2 SNPR5-120 Forward TATTAGATAAGGAATCAGCCCTTCG
Reverse GTTAGCCAAATGCAGATCAAATCAG
Probe TGGATCTGAATGGTTTCCTGAAAC G > A
PMm-HRM-3 SNPR5-121 Forward ATATTAGATAAGGAATCAGCCCTTCG
Reverse CATATCATTTTACATATACCAACCTAGC
Probe TTTCCTGAAACTGGGATTCCGTTTA T > A

Bold and underlined letter indicate SNP position.

Plant Breed. Biotech. 2022;10:272-81 https://doi.org/10.9787/PBB.2022.10.4.272
© 2022 Plant Breed. Biotech.