Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 3.

Table. 3.

Primer sequences used for Miseq analysis.

Name Sequence (5’-3’)
NbPDS_Miseq_1F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACGCTAATTTTTCTCATAGTGT Poo11
NbPDS_Miseq_1F-1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACNGCTAATTTTTCTCATAGTGT
NbPDS_Miseq_1F-2 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACNNGCTAATTTTTCTCATAGTGT
NbPDS_Miseq_1F-3 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACNNNGCTAATTTTTCTCATAGTGT
NbPDS_Miseq_2F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATGCTAATTTTTCTCATAGTGT Pool2
NbPDS_Miseq_2F-1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATNGCTAATTTTTCTCATAGTGT
NbPDS_Miseq_2F-2 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATNNGCTAATTTTTCTCATAGTGT
NbPDS_Miseq_2F-3 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATNNNGCTAATTTTTCTCATAGTGT
NbPDS_Miseq_1R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGAATGGCAAGATATACAT Common primer
NbPDS_Miseq_1R-1 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNCTGAATGGCAAGATATACAT
NbPDS_Miseq_1R-2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNCTGAATGGCAAGATATACAT
NbPDS_Miseq_1R-3 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNCTGAATGGCAAGATATACAT
Plant Breed. Biotech. 2022;10:186-96 https://doi.org/10.9787/PBB.2022.10.3.186
© 2022 Plant Breed. Biotech.