Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 2.

Table. 2.

NbPDS-sgRNA sequences used in the present study.

Name Sequence (5’-3’)
NbPDS-sgRNA1-tRNA ACGCGTGCAGAAACAAGTCCAATTTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCCCAGGCCTGCTCCCGTAGCTCAGTTGGTTAGAGCGTTGGTCTTATGAGCCGAAGGTCGCGGGTTCGAGCCCCGCCGGAAGCATTTTTTGTCGAC
NbPDS-sgRNA2-tRNA ACGCGTAAAGATAAGCTGAATTACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCCCAGGCCTGCTCCCGTAGCTCAGTTGGTTAGAGCGTTGGTCTTATGAGCCGAAGGTCGCGGGTTCGAGCCCCGCCGGAAGCATTTTTTGTCGAC

Black and red fonts indicate sgRNA and tRNA sequences. Italicized text indicates protospacer sequence, MluI (ACGCGT), StuI (AGGCCT) and SalI (GTCGAC) sites are underlined.

Plant Breed. Biotech. 2022;10:186-96 https://doi.org/10.9787/PBB.2022.10.3.186
© 2022 Plant Breed. Biotech.