Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 1.

Table. 1.

Primer sequences used for amplification in this study.

Name Sequence (5’-3’) Purpose
NB(12)PDS-F GTGGGTGAAGGCTAATTTTTCTCATAGTGT NbPDS target amplification
NB(12)PDS-R GAGTGACGGCAAAAATAGTTCAAAACAAACTAGT NbPDS target amplification
PVX. Cas9/721F TGGTTTCGATTCTCCTACCG PVX-Cas9 amplification
PVX. Cas9/721R ATCAGCCCTTGAATCACCAC PVX-Cas9 amplification
1pds-F1 AAACAAGTCCAATTTGGTTTTAGAGCTAGAAATA NbPDS sgRNA1 cloning
2pds-F1 ATAAGCTGAATTACCTGTTTTAGAGCTAGAAAT NbPDS sgRNA2 cloning
1pds-F2 ATGCACGCGTGCAGAAACAAGTCCAATTTG NbPDS sgRNA1 cloning
2pds-F2 ATGCACGCGTAAAGATAAGCTGAATTACCT NbPDS sgRNA2 cloning
sgRNA-Sal1-R CGGCGGTCGACTGGGTCTAGAAAAAAAGCA pPVX-Cas9 cloning
tRNA-Sal1-R GCATGTCGACTGGGTCTAGAAAAAATGCTTCCGGCGGGGCT pPVX PDS vector construction
CP. NR-R_SEQ ACGGGCTGTACTAAAGAAATCCCCA Sequence confirmation
Plant Breed. Biotech. 2022;10:186-96 https://doi.org/10.9787/PBB.2022.10.3.186
© 2022 Plant Breed. Biotech.