Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 3.

Table. 3.

List of primer and probe sequences used in HRM assay of SNPs.

HRM Marker Primer (5’-3’)
Forward Reverse Probea)
CMo-A01P AGTCTTCAGTGCCAACGGTGATTC ATGGGTTTTGGAGGAGATTCTTATC AGATTGGCAGGCAAACCATGAGCAT
CMo-A02P ATTGCCAAAATGCCATTAAGTAAGC GTTGTAGTTTTAGCTGCTGCTCTCA CTGCAAATCTTACCTCTGAGGTGTTT
CMo-A03P ATTATAGAACATGATATGCTGCCCAC TCCCTTACGCTATCACTTGTTTGTTAA ACATTCACAAATCTCAGCATCATCC
CMo-A04P GTCCACCAACCCATTATGCTTTGAA AAGAGGCAATAGTGGAAGAACTTG AGCAAGGTGGAGAGGATTGTTTCCA
CMo-A05P TGAGCAGCTCTTCAACCTCTTCGAA TGCTGCAGTTTCAAATTGGGTTTCA AGGAATGTACCAGCAGCGCCGAGA
CMo-A06P AGCAGCAATGTTGGCAGTGGCAAA TTCCCATGTTGACCTCAATGTCCT AAGGCACCAATGCCTAAACCTCGCA
CMo-A07P GATGAAGTTTCTTCAAGAACTAGTCC GACATAGTTAATGATTTCGTCTAGCA TCACATCAATTCGCTCGATTAAAGTT
CMo-A08P TTGAAGTCCATGCAGCCCTTGTT CTGTTCTTCAGCCTCAATGTGGAT AGACCATTTCTCTCCCTCAATCACT
CMo-A09P TGAAACTGTGTAAACTGGCTGCTCT CATGTTGGATTTAAGAAATGGAAGAAG TTCAAGAGGAATTGGGTCTGAAGAA
CMo-A10P CAATTGGAGAAAGGGTTTCGCG AGCAGCAGCGGAATGAAGTTGA TTGAAGAACTCGATTCCCTCGAGAG
CMo-A11P CTTATATGTGCATGGAGAAACGGC CATGAGAGAAATGATGAAAGGACAG TCCCTAAAACCTTAACCTCTTTCAG
CMo-A12P GCGGTTGTTACTCATATAATGAGAAG GAGCATCTGCAGCAAGTTCTCTC TGTTTTCCCTTTGTTTGGGGTTGTT
CMo-A13P GAGGTTGCACATCGGCTAGGT CTGCAGCAAGACCTATAGGATTTGA GAGAAGAGGCTTGATCCACAAAGTT
CMo-A14P ATGTCAAATAAATCTGTCTCGACGC TGGAATGGATAATCTAGAGCTACAG TCTGGAAATGCCGAACTTTTGATACT
CMo-A15P CGGCATTGTCGAGAGATATCGA ATCGTGAAGAACTCCATAATGGCT ACCGATAAGCTTCGCATTCCTGTTG
CMo-A16P TGTACTTTCATGGAAGCTGGCGTT TGACGGTTCGGAGGTTGGAGA TACGGAAGATGTGCAAAGACGCCAT
CMo-A17P GTGATATAATTCCAGTAATTTGCAGC TTGCCCATTCTATTGCAGCTATAG TTCATCCTACGCCCATCGGTTCAT
CMo-A18P TCTTGATCTCTTCCATTCTGGATC GATGAAGCAAGCGAAATTGCTACA TCTACGTCTTATATAGATTCTGACACG
CMo-A19P GCAGCTATCTAAGAAGGCTAAATATC ATGATTCGAAGAAACTGCCGAATTAGT TCCTTCTTTGGTTGGTGCAATGTGC
CMo-A20P CCGAAACTCAACGTCAAATAATGTG ACGGAGAGCGAAGGGCTAAATTT TCAAGTCTTTTCCCCACCATCCAAT
CMo-A21P TGATTGCGAAATAGTCTTTCGTTGC TCTTGTTCAGCGTTCGAGTATCGA GACTCGACGACGGTCACGATGA
CMo-A22P TGCTTATCAGAGTGGCATTTATTCTG GAGCTTAGTAAGAATGGTGATTAGAAC AGACATACCGTCCTGTACAGTAAGA
CMo-A23P GAAGCTTACAAACGGGTATGCAGA ATATGTAGTGTTCTTGATAGTGTTAAT GTGACAAAGACGCTGCCATTGTCTT
CMo-A24P CTCACTTAAGAGGATCCAGGGTG TGCCTTGAACACCAATGTTGCCTT CATGACAGCATGAAAAGCATTCTCTG
CMo-A25P TACGAGTCGCATTTCTTGACCG ACGAAGTTAGCACAGTAATAGTCATC TTAGGTCATTTCTGACTTTGATGCTAG
CMo-A26P CTGTCAACTGTTTGAATACTCGGG GTACCTAACAGTTGAAGAATCTCCA TGGACCAGAAATGCAAGAAATGGAG
CMo-A27P CATGTGAGCTGCTGTGGACGATT ACAAGCGAAAGACTTCATAGCAGATAT AGGAATAGATCTAAGCTGAATGGCT

a)Bold indicates SNP.

Plant Breed. Biotech. 2022;10:163-73 https://doi.org/10.9787/PBB.2022.10.3.163
© 2022 Plant Breed. Biotech.