Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 2.

Table. 2.

Sequences of gene primers used in this study, and information about the roles of encoded proteins in the salt tolerance of sorghum.

Gene type Genes Forward (5’-3’) Reverse (5’-3’) Name/reported genes
Heat shock protein Sb07g028370 TCTGCACTGATCACCGTCTC GAACGTACCCTTACCGACGA 25.3 kDa heat shock protein, chloroplastic (Precursor) (Johnson et al. 2014)
Sb01g040030 GACGGCAACATCCTTCAGAT GCTTCTTGACGTCCTCCTTG 17.9 kDa class I heat shock protein (Johnson et al. 2014)
Sb04g006890 ATGGCTTTAGCTCGCCTGT AAATCTGTCTCCGGGGCTAC 23.6 kDa heat shock protein, mitochondrial (Zhang et al. 2019)
Sb04g035130 ACCGTGTGCTGGTGATGAA CTGCACGGACTTGGTCTTCT 18.6 kDa class III heat shock protein (Zhang et al. 2019)
Sb01g021170 AGTGGTGCCACTTCACCAA GGCACCTGGATGTAGAGCAT 16.6 kDa heat shock protein (Schnable et al. 2011)
Aquaporin Sb04g032900 CAACAACCTCCGCTACAACA AAGGTGATGATGATCTCGAAC Aquaporin TIP2-1 (Zhang et al. 2019)
Sb04g037800 CAACAACCTCCGCTACAACA AAGGTGATGATGATCTCGAAC Aquaporin PIP1-5 (Liu et al. 2014)
Sb0012s010440 TTCCTCTACGTGACGGTGCT CAGTAGACGAGCGCGAAGAT Aquaporin PIP2-2 (Guo et al. 2016)
Sb07g003270 ATCCCCATGCAGTGAAAGAG TTGCCACCATGTAGATCCAA Aquaporin NIP3-2 (Almodares and Hadi 2009)
Sb05g007520 CGTCCATGAACCCAGCTAAT CCCTAAAAATCCATCCAGCA Aquaporin SIP1-1 (Almodares and Hadi 2009)
ROS scavenging system Sb02g000490 CTTCCACGATTTCACCGTCT TGACGACGTTGCACTTTCTC Peroxidase 1 (Precursor) (Mizuno et al. 2018)
Sb10g030840 ACCCAAAGACCAATTTGCAG CCCTCCATGTGCCTGTAGTT Catalase isozyme 1 (Li et al. 2020)
Sb03g045840 CATTCTGGAGGACCTCTTCG CGGCTTGGTAAGCTTGTTCT Probable glutathione S-transferase (Bandara et al. 2019)
Sb04g030050 TCTTCCGTAACAAGCCCATC CGGTGGATGATGTAGACGTG Thioredoxin reductase NTRB (Forghani et al. 2018)
Sb03g010900 GCATTCTGGCAAACCTGATT TTCCCGAGACTTCTGAGCAT TPR repeat-containing thioredoxin TTL1 (Ndimba 2017)
Transcription factor Sb01g044410 CGGCTACGACGATAGATTGG CTGCAGCTGGAGAATCTGTG Ethylene-responsive transcription factor RAP2-4 (Yan et al. 2013)
Sb03g030750 CTAGCGACGACTGATCACCA GCCTGGTTGTAGCCGATTAG NAC domain-containing protein 8 (Handakumbura 2014)
Sb03g005480 CTTGAGCAGCACCAGCATAG AAGCTCGATCGGTTCATCAT Transcription factor ASG4 (Saha et al. 2019)
Sb10g007090 GAGGTGGCAAAACTCAAGGA CTTTGCCTTTGGTCCATGTT bZIP transcription factor TRAB1 (Yang et al. 2017)
Sb08g018580 TGGAGGACACACATGAGGAA CCCTTGAGGATGCTTGTGAT MYB59 [Zea mays] (Muthamilarasan et al. 2014)
Plant Breed. Biotech. 2022;10:128-38 https://doi.org/10.9787/PBB.2022.10.2.128
© 2022 Plant Breed. Biotech.