Plant Breeding and Biotechnology

Table. 1. Table 1

Details of the two primers used in the qRT-PCR analysis.

Gene	Protein	NCBI reference ID	Function	Primer sequence
GGAT1	Glutamate-glyoxylate aminotransferase 1	NM_102180.4	Required for ABA and stress-mediated response	Forward: AGGCGGTTTAGGTGCTTAC Reverse: GAGTTCTGGGTCACTTGGATAC
CSD2	Superoxide dismutase [Cu-Zn]	KY471357.1	Destroy reactive radicals produce within the cell (ROS)	Forward: CTCATTCCTCCTTCCTCCAATC Reverse: GCTTTAACGGCGAAGGAAAC