Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 1.

Table. 1.

Details of the two primers used in the qRT-PCR analysis.

Gene Protein NCBI reference ID Function Primer sequence
GGAT1 Glutamate-glyoxylate aminotransferase 1 NM_102180.4 Required for ABA and stress-mediated response Forward: AGGCGGTTTAGGTGCTTAC
Reverse: GAGTTCTGGGTCACTTGGATAC
CSD2 Superoxide dismutase [Cu-Zn] KY471357.1 Destroy reactive radicals produce within the cell (ROS) Forward: CTCATTCCTCCTTCCTCCAATC
Reverse: GCTTTAACGGCGAAGGAAAC
Plant Breed. Biotech. 2022;10:62-74 https://doi.org/10.9787/PBB.2022.10.1.62
© 2022 Plant Breed. Biotech.