Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 1.

Table. 1.

List of primers used in this study.

Category Gene Forward primer Reverse primer PCR product (bp)
Ion pump ACA9 5’-GCAGGCTTAAGCATTCTTGG-3’ 5’-TTCTTGCGTTGAACTCGTTG-3’ 120
Receptor LIP1 5’-TGAAACAAACGCAACTGCTC-3’ 5’-CGTGATCTCTACCGCTGTCA-3’ 149
LIP2 5’-GAGCTTATCACGGGTCGAAG-3’ 5’-GATGCTTCCTCTTGCACACA-3’ 200
ANX1 5’-GAGGCGACTCTCACACATCA-3’ 5’-CAATGACGTTGGAATCATCG-3’ 192
ANX2 5’-GCAGGCTTAAGCATTCTTGG-3’ 5’-GCAGGCTTAAGCATTCTTGG-3’ 146
MDIS1 5’-ATGGGCGTCAAAGTATCTGG-3’ 5’-GGTCTTTGGCTTTCGTCAAG-3’ 138
PRK1 5’-GGATTTAGCGAGTTGGGTGA-3’ 5’-TCTTCTCCACAGCCTGTCCT-3’ 182
Attractant LURE1.1 5’-CCTTTCGATCCACGTTCACT-3’ 5’-GCAACGACAAAGTTTTCTTTCAA-3’ 135
RALF4 5’-CATTGGCTACGATGCTCTCA-3’ 5’-CATCCACGCCTGTAAGGATT-3’ 108
CLE45 5’-ACGCGTTCTCGAGGAAGTTA-3’ 5’-GGCTGAGCTTTGTTGTGGAT-3’ 141
Activator AUN1 5’-GAGGCCATCAGGTAGTGGAA-3’ 5’-ACCGGCATTGTCAAACTCTC-3’ 104
LRX10 5’-CGGACAAGGTGATTCATGTG-3’ 5’-ACTGGACGGCTAATCACCAC-3’ 129
MYB97 5’-GCTTCTTGACTGGGGAAGTG-3’ 5’-TGGCAAGTTGTTGGTGTCAT-3’ 139
ROP1 5’-TTCAGTGCCAATGTTGTGGT-3’ 5’-TGCTCCACGGTAACTCAGTG-3’ 108
Meiosis gene DUO1 5’-TGGTTTGGTTGAGGAAGAGG-3’ 5’-AGCGAAAGGCTGATGCTCTA-3’ 133
CENH3 5’-AGAGATTCGCCATTTCCAGA-3’ 5’-AGCTTCAGCTGTCCAACGAT-3’ 124
CENPC 5’-TCTTACGCATGAGGGGAAAC-3’ 5’-TCGAGCGGTCTCGACTTAAT-3’ 111
CTF7 5’-TTTTAAGGGTTGGCAGAACG-3’ 5’- GTTTCTGTGTGCAGGGGAAT -3’ 100
OSD1 5’-TGGCCGAGTTATTGAGATCC-3’ 5’-GCTTGAATCCCACAGATGGT-3’ 119
Hormone related gene COI1 5’-CTTCCGCCTTGTCTTACTCG-3’ 5’-GTTAAGCCGCCTTGTCTCAG-3’ 132
BRI1 5’-ACGAGCGGCTTCTTGTGTAT-3’ 5’-GCCGTGTGGACCAGTTTAGT-3’ 102
Plant Breed. Biotech. 2022;10:49-61 https://doi.org/10.9787/PBB.2022.10.1.49
© 2022 Plant Breed. Biotech.