Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 1.

Table. 1.

Sequences of screening resistant genotype to bakanae disease.

Marker Sequence Reference
1625IND F AAACAAGTTGGTTGGCGAGCTAC Cheon et al. (2019)
R AGATTACGCCTTGGAACCTGTTA
1675IND F TTTCTACTAAGTCACGTAGCATGCTCC
R ATGTTCGTCGTATGCATAGCCAAAC
Plant Breed. Biotech. 2021;9:355-9 https://doi.org/10.9787/PBB.2021.9.4.355
© 2021 Plant Breed. Biotech.