Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 2.

Table. 2.

List of primer sequences with expected product size and annealing temperatures for specific amplification of Xanthomonas campestris pv. incanae.

Primers Forward (5’-3’) Reverse (5’-3’) Expected size (bp) Annealing temperature (°C)
XCI_1F/R ATGTCGATCCAGCTCAGGTG TCAGGTTGCAGGAGGGCTTGG 495 64
XCI_2F/R CCTTCAGGTCATGCACCATTG ATCCGCATTCTGCCCTCCCCCCT 503 65
XCI_3F/R GCGATGGATACAGTGACTGGAAG CAACTGCAAGGCCGTATCGTA 612 62
XCI_4F/R CAGGCGGCCGATGCGAAGG TGATGTTGAAGAGTGTGCGGAC 604 63
XCI_5F/R CATTCTCGCGGAGCGGCGTCTGC AGCTGCTGAGTTGCCGCGCTCT 665 68
XCI_6F/R TCTGGCTCCCACTATGTGC CGGGATGGATGAGGCTGTCC 468 60
XCI_7F/R GTTCGGACTGGCGCTCTGGC TCTTCATCATCACTAACCCA 303 60
XCI_8F/R GATCATGGTGTCGCCCATG TTAAGCCACTTTGAGCTGCACC 324 60
XCI_9F/R GTGACCCTGCGATACATCGG GGTGCTGCCAAGGCCGGAGC 769 65
XCI_10F/R GGTACTACTGGATGCCAACC TCAGGCCTTCATAAGATTTTG 397 57
XCI_11F/R ATGGATGCCGCTGCCGGTCG GCGGGTAGGTGAGGCCGTCGA 595 65
Plant Breed. Biotech. 2021;9:287-97 https://doi.org/10.9787/PBB.2021.9.4.287
© 2021 Plant Breed. Biotech.