Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 2.

Table. 2.

Description of the SSR loci used in this study (Shahzad et al. 2012; Vaja et al. 2016).

Primer name Sequence AT Expected allele size (bp)
Xcfd-1 ACCAAAGAACTTGCCTGGTG 56 150-230
AAGCCTGACCTAGCCCAAAT
Xcfd-4 TGCTCCGTCTCCGAGTAGAT 56 220-270
GGGAAGGAGAGATGGGAAAC
Xcfd-13 CCACTAACCAAGCTGCCATT 56 180-254
TTTTTGGCATTGATCTGCTG
Xcfd-18 CATCCAACAGCACCAAGAGA 56 150-200
GCTACTACTATTTCATTGCGACCA
Xcfd-46 TGGTGGTATAGTCGTTGGAGC 56 150-175
CCACACACACACACCATCAA
Xcfd-49 TGAGTTCTTCTGGTGAGGCA 56 150-214
GAATCGGTTCACAAGGGAAA
Xcfd-54 TCGTTCCAAAATGCATGAAA 60 170-200
AAGGGCCAGAAATCTGTGTG
Xcfd-183 ACTTGCACTTGCTATACTTACGAA 56 150-179
GTGTGTCGGTGTGTGGAAAG
Xwmc-11 TTGTGATCCTGGTTGTGTTGTGA 56 130-250
CACCCAGCCGTTATATATGTTGA
Xwmc-17 ACCTGCAAGAAATTAGGAACTC 51 150-200
CTAGTGTTTCAAATATGTCGGA
Xwmc-18 CTGGGGCTTGGATCACGTCATT 61 230-280
AGCCATGGACATGGTGTCCTTC
Xwmc-24 GTGAGCAATTTTGATTATACTG 51 150-200
TACCCTGATGCTGTAATATGTG
Xwmc-96 TAGCAGCCATGCTTAGCATCAA 61 250-300
GTTTCAGTCTTTCACGAACACG
Xwmc-110 GCAGATGAGTTGAGTTGGATTG 56 170-200
GTACTTGGAAACTGTGTTTGGG
Xwmc-154 ATGCTCGTCAGTGTCATGTTTG 60 147-200
AAACGGAACCTACCTCACTCTT
Xwmc-405 GTGCGGAAAGAGACGAGGTT 60 218-250
TATGTCCACGTTGGCAGAGG
Xwmc-406 TATGAGGGTCGGATCAATACAA 60 217-250
CGAGTTTACTGCAAACAAATGG
Xwmc-432 ATGACACCAGATCTAGCAC 51 189-235
AATATTGGCATGATTACACA
Xwmc-503 GCAATAGTTCCCGCAAGAAAAG 51 237-300
ATCAACTACCTCCAGATCCCGT
Xgwm-160 TTCAATTCAGTCTTGGCTTGG 60 234-299
CTGCAGGAAAAAAAGTACACCC
Xgwm-493 TTCCCATAACTAAAACCGCG 60 172-212
GGAACATCATTTCTGGACTTTG
Plant Breed. Biotech. 2021;9:185-98 https://doi.org/10.9787/PBB.2021.9.3.185
© 2021 Plant Breed. Biotech.