Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 3.

Table. 3.

List of SSR primers used for molecular study.

Primer Sequence (5’-3’) Genome detection Fragment size (bp)
DA F: gggttttcgcctcggtctcc A 239
R: actcccctggtgccgctgc
DC F: actccgactccatgtccctca C 625
R: acactcccctggtgcctttca
Plant Breed. Biotech. 2021;9:171-84 https://doi.org/10.9787/PBB.2021.9.3.171
© 2021 Plant Breed. Biotech.