Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 2.

Table. 2.

Primer sequences of single nucleotide amplified polymorphism (SNAP) markers.

SNP Primer ID Target alleles Common primer (5′ → 3′) Allele-specific primers (5′ → 3′) Expected product size (bp)
AX-90360753 Set 1G G TTCTTTTTGGTCCAATCCTA CCATCAAGAACAAGAGAAGATACAC 202
Set 1A A CCATCAAGAACAAGAGAAGATACAT
Set 2G G GATAATGTTCAAGGCTGGTC CATCAAGAACAAGAGAAGATACAC 137
Set 2A A CATCAAGAACAAGAGAAGATACGT
AX-90337768 Set 3G G GGTTTATCTGTGCGTGAAAT TCTGTCCTATAACTGATCTCCTTGCC 199
Set 3A A TCTGTCCTATAACTGATCTCCTTGCT
Set 4G G CATACAGGTTCCTTCCTTTG CTGTCCTATAACTGATCTCCTTGCC 300
Set 4A A CTGTCCTATAACTGATCTCCTTGCT
AX-90385376z) Set 5G G GAAATGTCAAAAAGGCTGTC AAATGTAATTAAAAAGTCAGGAAAG 129
Set 5A A AAATGTAATTAAAAAGTCAGGAAAA
Set 6G G TGGGAGTTTTAATTCTGCAT AATGTAATTAAAAAGTCAGGAAAG 265
Set 6A A AATGTAATTAAAAAGTCAGGAAAA

z)For this SNP, primers were designed based on the reverse complementary sequence.

Plant Breed. Biotech. 2021;9:164-9 https://doi.org/10.9787/PBB.2021.9.2.164
© 2021 Plant Breed. Biotech.