search for




 

Genetic Analysis of Anthocyanin Pigmentation in Sterile Lemma and Apiculus in Rice
Plant Breed. Biotech. 2020;8:378-388
Published online December 1, 2020
© 2020 Korean Society of Breeding Science.

Woo-Jin Kim, Cheryl Adeva, Hyun-Sook Lee, Yun-A Jeon, Kyu-Chan Shim, Sang-Nag Ahn*

Department of Agronomy, Chungnam National University, Daejeon 34134, South Korea
Corresponding author: Sang-Nag Ahn, ahnsn@cnu.ac.kr, Tel: +82-42-821-5728, Fax: +82-42-822-2631
These authors contributed equally.
Received October 16, 2020; Revised October 21, 2020; Accepted October 22, 2020.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Genetic analysis of genes that regulate the color pigmentation of sterile lemma and apiculus has been conducted. “Josaengjado” has small and round grains with purple leaf, sterile lemma and apiculus. In the F2 population from a cross between Josaengjado and Daeribbyeo 1, 246 and 182 plants exhibited purple and straw-white sterile lemma, respectively. It fitted a 9:7 segregation ratio indicating that two complementary genes control the pigmentation in sterile lemma and apiculus. Genetic analysis was performed using the F2:3 and KASP (Kompetitive Allele-Specific PCR) markers. Genes for the coloration of leaf sheath, ligule, sterile lemma, and apiculus were detected on chromosomes 1 and 6. Sequence comparison showed a single nucleotide substitution C (Josaengjado) to A (Daeribbyeo 1) in the second exon of the Rd gene on chromosome 1 leading to a premature stop in Daeribbyeo 1. In C1, a 3-bp deletion in the second exon was detected in Daeribbyeo 1. Haplotype analysis was performed in the Rd and C1 genes of the 78 rice accessions. 78 accessions were divided into 14 groups. A total of 11 and 1 mutation sites were detected in OsC1 and Rd, respectively. The haplotype analysis also confirmed that two complementary genes, Rd and OsC1 are necessary to express anthocyanin pigmentation in sterile lemma and apiculus. To our knowledge, this is the first report to identify genes for the coloration of sterile lemma in rice.
Keywords : Sterile lemma color, Apiculus color, KASP marker, Rice
INTRODUCTION

Pigmentation in plant organs is prevalent in wild rice, but the phenotype shows variation in cultivated rice (Li and Chen 1993; Saitoh et al. 2004). Various colors such as black hull, red pericarp, purple awn, purple apiculus and purple leaf margin are observed in wild rice, while most cultivars have already lost color in plant organs in the domestication process (Sun et al. 2018). Flavonoid derivatives including anthocyanins, are responsible for a wide range of biological functions including pigmentation pat-terns, protection against UV radiation, signal molecules in plant-microbial interactions, and plant defense reactions (Saitoh et al. 2004; Lin-Wang et al. 2010).

Studies of anthocyanin pigmentation have been extensively carried out over the last half-century. In rice, previous genetic studies revealed that two genes, C and A are fundamental in regulating anthocyanin pigments (Takahashi 1957). Structural and functional genes associated with anthocyanin biosynthesis in rice have been well characterized, but several regulatory genes are also involved in the biosynthetic pathway (Furukawa et al. 2007; Kim et al. 2011; Shao et al. 2013; Oikawa et al. 2015).

Pigmentation in the apiculus and sterile lemma was controlled by one basic gene and three complementary genes, respectively (Siddiq et al. 1986). C, the essential gene for anthocyanin biosynthesis located on rice chromosome 6 regulates red and purple of apiculus (Reddy 1996; Fan et al. 2008). The segregation ratio of purple and green fitted 3:1 in the 430 F2 plants of the “SSSL W23-07-6-02-14” with purple apiculus and “HJX74” with green apiculus. The Pa-6 gene was detected through fine mapping (Liu et al. 2012). Entire OsC gene and its full-length cDNA cloned from Japonica landrace “Lijiangxintuanheigu” (LTH) with red apiculus and purple stigma were transformed into japonica cultivar Kitaake with colorless apiculus and stigmas, all transformants had red apiculus but non-colored stigmas indicating that OsC alone modulates anthocyanin pigmentation in the apiculus and represented a functional C gene (Zhao et al. 2016). The apiculus, the remnant of the awn maintains its color in many cultivars and seems not to have undergone artificial selection throughout domestication (Choudhury et al. 2014). Thus, evaluating the sequence variation of related genes that underlie apiculus staining can be a good approach to the study of plant pigmentation.

The pigment characteristics of rice seeds are responsible for the accumulation of anthocyanins and proanthocyanins (PAs) synthesis, the secondary metabolites belonging to the kind of flavonoids that are derived from the common phenylpropanoid pathway (Koes et al. 2005; Grotewold 2006; Lim and Ha 2013). In PAs synthesis of rice, the Rc gene has been confirmed as a regulatory gene which encodes a bHLH DNA-binding protein. Mutations in the Rc gene have been demonstrated in common rice strains with a white-colored pericarp (Sweeney et al. 2006; Furukawa et al. 2007). The activity of the Rc from the red rice-type can be possibly disrupted by 14-bp deletion (Lim and Ha 2013). Two single nucleotide substitutions at two sites of the 1st and 2nd exons of the Rd gene had been observed in white rice (Nakai et al. 1998). A single nucleotide substitution (C→A) of the 2nd exon in the Rd gene sequence generates a premature stop codon in white rice compared to the pigmented rice cultivars (Lim and Ha 2013). In addition, 2-bp insertion was observed in the OsB1 gene in the plant showing white and red pericarp. This mutation causes frameshift in the C-terminus, leading to early termination and regulating protein function (Wang and Shu 2007; Lim and Ha 2013).

According to the C–S–A gene system, rice hull pigmentation was controlled by the interaction of genes rather than by a single gene. C1 and A1 collectively determine the color variation, whereas S1 diversifies the pigmentation at tissues. The C1 operates as a switch in controlling color production when C1 is expressed alone; it produces brown color in the apiculus, but in combination with A1, produces purple color in apiculus. When C1 and S1 are expressed, brown is observed on the hull, and purple is observed on the hull if C1, A1 and S1 are expressed. Several genes have been identified to color the various organs of plants, including apiculus, pericarp and hull (Sun et al. 2018).

In rice, a pair of sterile lemmas constitutes the spikelet along with a terminal fertile floret and two rudimentary glumes and represents vestigial glume of two lateral florets (Ikeda et al. 2007; Gao et al. 2010; Hong et al. 2010; Kobayashi et al. 2010; Ren et al. 2013). Recently, several genes have been cloned, which helped to elucidate the origin of the sterile lemma including LONG STERILE LEMMA (G1) (Yoshida et al. 2009) and OsMADS34, an important regulator of the identity of sterile lemma (Gao et al. 2010; Kobayashi et al. 2010). However, studies on the pigmentation in sterile lemma are rare. Since Siddiq et al. (1986) reported that three complementary genes control pigmentation of sterile lemma, no genetic study has been conducted.

The present study was performed to detect and characterize genes that regulate pigmentation of sterile lemma and apiculus. Genetic analysis was performed using F2:3 populations from a cross between “Daeribbyeo 1” and “Josaengjado”, and the genetic map was constructed using Kompetitive Allele-Specific PCR (KASP) markers. Haplo-type analysis was performed using rice accession to confirm the genes to regulate color of sterile lemma and apiculus.

MATERIALS AND METHODS

Plant materials

Two temperate japonica cultivars, ‘Josaengjado’ (a fe-male parent) with purple leaf, leaf sheath, sterile lemma, and apiculus and ‘Daeribbyeo 1’ (a male parent) with green leaf, leaf sheath, sterile lemma, and apiculus were crossed to develop F2 and F3 progenies for genetic analysis (Fig. 1). The F2 population (428 F2 plants) was grown at the experiment station of Chungnam National University, Daejeon, Korea during the summer of 2018, and 120 F3 lines were randomly selected and grown in 2019. The germinated seeds were sown on the 12th of April and 30-day-old seedlings were transplanted with 15 × 30 cm intervals.

Figure 1. Morphological characteristics of Daeribbyeo 1 (D), Josaengjado (J), and F2 plants. Josaengjado shows abnormal gross morphologies, such as dwarfism, shortened internodes, small-rounded seeds, and erect leaves compared with Daeribbyeo 1.

For haplotype analysis, the sequences of 78 Asian cul-tivated rice accessions (Oryza sativa L.) from the KRICE_CORE at Kongju National University were compared (Kim et al. 2016); the accessions included 31 temperate japonica, 13 tropical japonica, 28 indica, 3 aus, 1 admixture, and 2 aromatic (Supplementary Table S1). The KRICE_CORE set plants were grown in the experimental field at Chung-cheongnam-do Agricultural Research and Extension Ser-vices (CNARES) in 2018.

Evaluation phenotype of color

In 2018 and 2019, the color of each plant in the F2 and F3 for the sterile lemma color (SC) and apiculus color (AC) was measured at 5-10 days after heading. The color was distinguished by representing purple and straw-white. In the F3 population, 10-15 plants per line were evaluated to check the segregation of the phenotype.

DNA extraction and PCR analysis

Genomic DNA was extracted from the fresh leaves of parents and F2 plants derived from Daeribbyeo 1 × Josaengjado cross. A total volume of 15 uL reaction mixture was composed of the 1 uL (10 ng/μL) of template DNA, 1.5 μL dNTP (2.5 μM each), 1.5 μL 10 × PCR buffer (10 μM Tris-HCl pH 8.3, 50 μM KCl, 1.5 μM MgCl2, 0.1% Gelatin), Forward + Reverse primer 1 μL (10 pmol each), Taq polymerase 0.25 μL (5 Unit/μL) and 8.75 μL triple distilled water. The PCR conditions were as follows: de-naturing at 94℃ for 2 minutes, followed by 34 cycles of 94℃ for 20 seconds, 58℃ for 15 seconds, and 72℃ for 30 seconds.

For substitution mapping to define the location of the genes, we used SSR markers located within the target region from the Gramene database (www.gramene.org, McCouch et al. 2002). A cleaved amplified polymorphic sequence (CAPS) marker was used to identifying the Rd gene. CAPS marker for the Rd gene was used to amplify DNA fragments, and these PCR products were digested with the TaqI restriction enzyme (Lim and Ha 2013).

Construction of genetic map, QTL analysis and sequence analysis

Genetic map was developed using the Kompetitive Allele-Specific PCR (KASP) markers. KASP amplifications and allelic discriminations were performed using the Nexar system (LGC Douglas Scientific, Alexandria, USA) at the Seed Industry Promotion Center of the Foundation of Agricultural Technology Commercialization and Transfer at Gimje, Korea (Cheon et al. 2018). Of the 506 markers, 127 polymorphic markers (25%) showed polymorphism and 89 markers were selected to construct the map. 120 F2 plants were genotyped using 89 markers.

Linkage analysis was conducted using the Kosambi function of Mapmaker/EXP 3.0 software (Lander et al. 1987). QTL analysis was performed by composite interval mapping (CIM) using the QTL Cartographer (Wang et al. 2007). CIM analysis was conducted with a forward and backward method using model 6 with a 10 cM window size (Lee et al. 2012). The log-likelihood (LOD) threshold significance level (P < 0.05) about agronomic traits was calculated by computing 1,000 permutations and set to 3 as the LOD threshold significant level (P < 0.05) about color traits. Gene sequencing reactions were performed by an external company (www.solgent.com).

Rd gene was amplified into three sections using the primers Rd-1F (5ʹ-GTTAGGCAGTACAAGTGTGTGTAG-3ʹ), Rd-1R (5ʹ-TAGGAGCACGTGTAAAGGTAAGAT-3ʹ Chin et al. 2016), Rd-2F (5ʹ-TAGGAACAACGATCCTC CACGTA-3ʹ), Rd-2R (5ʹ-GAGCTTCCACGACGAGAA GTG-3ʹ), Rd-3F (5ʹ-GCAAGTGATAATTGTGGTGGCA-3ʹ) and Rd-3R (5ʹ-TCAACACTCATTTGACCAACGC-3ʹ). C1 gene was also amplified into three sections using the primers C1-1F (5ʹ-AAGTACAGCGCAAAAGTGGTAGA-3ʹ), C1-1R (5ʹ-AGCGTTAGCCAGCTTCAAAT-3ʹ), C1-2F (5ʹ-ATTTGGAGCTATTTGGTACTGTCG-3ʹ), C1-2R (5ʹ-TTCACGGTCGTGGAAGAAGAA-3ʹ), C1-3F (5ʹ-GGG CCGAACAGACAATGAAATC-3ʹ) and C1-3R (5ʹ-TTA TATACGGAAACCCGCAACTG-3ʹ).

RESULTS

Phenotypic variation of the parents and 120 F2 plants

The phenotypic differences between Daeribbyeo 1 and Josaengjado are shown (Fig. 1). Two parents also showed significant differences including plant height. The color was observed on the leaf, leaf sheath, ligule, sterile lemma, and apiculus in Josaengjado, not Daeribbyeo 1. In 2018, 246 and 182 individuals exhibited purple sterile lemma and straw-white sterile lemma, respectively. Also, 220 and 208 individuals showed purple apiculus and straw-white api-culus, respectively (Table 1). They fit a 9:7 segregation ratio indicating the action of two complementary genes. In 2019, the same segregation ratio was observed confirming that two genes regulate the color of the sterile lemma and the apiculus.

Table 1 . Segregations of two morphological traits in the F2 population.

TraitPurpleStraw-whiteExpected ratioChi-squareP
Sterile lemma color20182461829:70.010.92
20191391010.020.90
Apiculus color20182202089:70.150.70
20191391010.020.90


QTL analysis in the F2 populations

A genetic linkage map was constructed using 120 F2 plants and 89 polymorphic KASP markers distributed over 12 chromosomes covering a total length of 1458.3 cM with an average distance of 16.3 cM (Fig. 2). For sterile lemma color, two QTLs were detected on chromosomes 1 and 6. qSC1 for sterile lemma color was located between KJ01079 and KJ01103 with qSC6 between KJ06011 and KJ06027. The LOD score ranged from 6.77 to 9.76 (Table 2). The qSC1 accounted for 39.93% and qSC6 accounted for 65.38% of the phenotypic variance. ‘Josaengjado’ alleles underlying all these QTLs showed positive additive effects contributing to the coloration of the sterile lemma. For apiculus color, two QTLs were detected on chromosomes 1 and 6. qAC1 was located between KJ01079 and KJ01103, and qAC6 was located between KJ06011 and KJ06027. The qSC1 and qAC1, and qSC6 and qAC6 were detected in the same region on chromosome 1 and 6, respectively. The LOD score ranged from 6.83 to 11.02 (Table 2). Like qSC, Josaengjado alleles underlying all these QTLs showed positive additive effects.

Table 2 . Characteristics of QTLs for morphological traits in the F2 population.

TraitQTLChr.Marker intervalz)LODR2 (%)y)Additive effectx)Candidate genew)
Sterile lemma colorqSC11KJ01079/KJ01087/KJ011036.7739.930.95Rd
qSC66KJ06011/KJ060279.7665.381.27C1
Apiculus colorqAC11KJ01079/KJ01087/KJ011036.8341.050.94Rd
qAC66KJ06011/KJ0602711.0267.451.30C1

z)The nearest KASP marker to the QTL isunderlined.

y)The proportion of the phenotypic variance explained by the nearest marker of QTL.

x)The estimated effect of replacing Daeribbyeo 1 alleles by Josaengjado alleles.

w)Chromosomal location of each QTL was compared to genes in previous studies.


Figure 2. Construction of a genetic map using 89 KASP markers with 120 F2 plants from a cross between Daeribbyeo 1 and Josaengjado. Right sides of each chromosome indicate the name of each marker, the left sides of each chromosome indicate the region of QTLs, and black box means the nearest regions of QTLs, respectively. The genetic distance, measured in centimorgans (cMs). Linkage analysis was performed using Mapmaker/EXP 3.0 software. QTL analysis was performed by simple internal mapping using QTL Cartographer software.

These results imply that qSC1 and qAC1 might be allelic to Rd gene controlling pericarp color with qSC6 and qAC6 allelic to C1 gene regulating apiculus color.

Substitution mapping of qSC and qAC

For the substitution mapping of qSC1, qAC1, qSC6 and qAC6, 16 F3 lines with different chromosome segments within the region on chromosomes 1 and 6 were selected (Fig. 3). Four F3 lines (CN11, CN72, CN114, CN29) were homozygous for Josaengjado in the qSC1 and qAC1 region flanked by KASP marker KJ01079 and SSR marker RM11390, and homozygous for Daeribbyeo 1 in the qSC6 and qAC6 region defined by KASP marker KJ06011 and SSR marker RM19552. Both sterile lemma and apiculus color were not observed in both F2 and F3 lines. Furthermore, 4 F3 lines (CN9, CN82, CN56, and CN2) were homozygous for Daerribyeo 1 in the qSC1 and qAC1 region defined by KASP marker KJ01079 and SSR marker RM11390, and homozygous for Josaengjado across the qSC6 and qAC6 region defined by KASP marker KJ06011 and SSR marker RM19552. Color phenotypes in these lines were not observed in both sterile lemma and apiculus in both F2 and F3 lines. On the other hand, two F3 lines (CN74, CN59) were homozygous for Josaengjado in the region between KASP marker KJ01079 and SSR marker RM11390, homozygous for Daeribbyeo 1 in the region defined between KASP marker KJ06011 and SSR marker RM19552. These two lines showed both purple sterile lemma and apiculus observed in both F2 and F3. Another two F3 lines (CN38 and CN30) were heterozygous in the qSC1 and qAC1 region, and homozygous for Josaengjado in the qSC6 and qAC6 region. These lines showed segregation for color and colorless sterile lemma and apiculus at F3 (Supplementary Fig. S1).

Figure 3. Substitution mapping of the qSC1, qAC1, qSC6, and qAC6 on the chromosome 1 and 6 based on 16 F3 lines and two parents, Daeribbyeo 1 and Josaengjado. White, black, and gray bars indicate homozygous regions for Daeribbyeo 1, Josaengjado alleles and heterozygous, and slashed areas indicate crossing-over regions. The right table indicates phenotypes of each line. Parenthesis means a number of individuals.

These results confirmed that two complementary genes regulate sterile lemma color and apiculus color. Rd gene was located in qSC1 and qAC1 region with OsC1 in qSC6 and qAC6 (Saitoh et al. 2004; Furukawa et al. 2007).

Candidate genes analysis

Comparative analysis of the Rd and OsC1 sequences of Daeribbyeo 1 and Josaengjado was performed. As a result, a 1-bp substitution (C→A) was found in the second exon of Rd of Daeribbyeo 1, which was confirmed by the same mutation (Fig. 4). As with previous studies, a 1-bp substitution appears to prematurely terminate the translation of amino acids and consequently the function of the Rd gene (Lim and Ha 2013). In OsC1 gene of Daeribbyeo 1, a 3-bp deletion (GAG) was detected in Daeribbyeo 1 sequence; position 359-361 compared to Josaengjado. The gene en-coding an R2R3-MYB transcription factor had been re-ported as OsC1 and predicted to be a regulator in the anthocyanin biosynthesis pathway (Saitoh et al. 2004). A 3-bp deletion in the second exon in Daeribbyeo 1 caused the deletion of loss of glutamic acid.

Figure 4. Comparison of nucleotide sequences of Daeribbyeo 1 and Josaengjado at Rd and OsC1 (Nipponbare sequence at OsC1 is included). The black boxes and lines between black boxes indicate exons and introns, respectively. Letters above and below the boxes are sequences of Hwaseong and O. rufipogon, respectively. Non-synonymous nucleotide substitution is indicated in red letter in Daeribbyeo 1 at the Rd gene. A 3-bp deletion in OsC1 was observed in Daeribbyeo 1 and Nipponbare compared to Josaengjado. The sequence of the slashed box in the OsC1 gene of Daeribbyeo 1 is not available because we failed to clone. including the 3rd exon (shown in slashed box).

Haplotype analysis of candidate genes

Haplotype analysis was performed to compare the sequence diversity of rice accessions for Rd and OsC1. SNPs and InDels data of Rd and OsC1 of 78 rice accessions were provided by Kongju University (Kim et al. 2016). Based on the genomic sequence of Rd and OsC1, 78 accessions were divided into 14 types (Table 3). 78 accessions showed two types at Rd with nucleotides A and C. In OsC1, 11 SNPs and deletions were detected that resulted in the change of amino acid. These included at least 11 mutations (H4 to H14) including three deletion regions and 12 SNP regions.

Table 3 . Haplotype analysis of Rd and C1 using the Korean rice core set (KRICE_CORE).

Haplotypez) (phenotype)RdC1TotalSterile lemma and apiculus color
276y)45112227736078679584491810101012JapIndAusAroAdm
H1 (3)CGGCGGAGTCACTGGAACAGCCGG2512 (8)v)5
H2 (3)--------T---11
H3 (3)---------A(P→Q)--11
H4 (1)------‒2 bp-----22
H5 (1)-T (Gx)→W)----------11
H6 (1)--A(Stop)---------11
H7 (1)-------‒10 bp----25220 (2)1
H8 (1)---G(P→R)--------32 (1)
H9 (1)----A(R→Q)-------33
H10 (1)-----‒3 bp------33
H11 (1)----------C(A→P)T33
H12 (1)A(Stop)-----------422
H13 (1)A(Stop)---A(R→Q)-------11
H14 (1)A(Stop)----‒3 bp------55
Amino acidw)PsNsPsNsNsDelDelDelSNsNsS

z)Josaengjado in H1 and Daeribbyeo 1 in H14. In parentheses, 3 indicates purple sterile lemma and apiculus with 1 indicating straw-white sterile lemma and apiculus.

y)Nucleotide position, x)G: glycine, W: tryptophan, P: proline, R: arginine, Q: glutamine, A: alanine, Stop: stop codon. w)Ps: premature stop, Ns: non-synonymous, Del: deletion, S: synonymous. v)In parentheses, the number of lines that show different phenotype expected from the genotype.



H1 type included Josaengjado and most of the lines had purple sterile lemma and apiculus. The color appeared on the sterile lemma and apiculus of the 12 japonica and 5 indica accessions with an exception of 8 japonica accessions. H2 and H3 types showed SNPs in OsC1, and these SNPs did not result in the change of coloration in sterile lemma color and apiculus color. The substitution in H3 was considered not to affect the function. This SNP was also reported in Purpleputtu, which has a colored apiculus (Reddy 1996). H3 was functional without the change in the phenotype in OsC1 (Zheng et al. 2019). H4 type had 2-bp deletion in OsC1 and failed to show coloration. These deletions occurred in the positions of putative base-contacting residues and caused a frameshift (Martin and Paz-Ares 1997). H5, H6, H8, H9, and H11 types had SNPs in OsC1 resulting in the loss of color. Also, H7 type showed straw-shite sterile lemma and apiculus exhibiting the 10-bp deletion in the third exon. Out of 25 accessions, 20 were indica with purple sterile lemma whereas two accessions had straw-colored sterile lemma. H10 had the 3-bp deletion in exon 2, with the straw-white sterile lemma and apiculus. H12 had mutantion in Rd with the wild type allele in OsC1, and no color appeared in sterile lemma and apiculus. In H13 and H14 types, an SNP was observed in Rd with SNP and InDel in OsC1. These results indicate that two genes are complementary for coloration in sterile lemma and apiculus. Although H1 type accessions had purple sterile lemma and apiculus, eight japonica accessions in H1 did not have colored sterile lemma and apiculus. This might be due to the existence of additional mutations in the Rd gene in the eight japonica accessions, and additional study is needed to clarify these results (Nakai et al. 1998).

DISCUSSION

Pigmentation is one of the various phenotypes that are common in wild rice but varied in cultivated rice (Saitoh et al. 2004). Several genes have been reported to regulate anthocyanin pigmentation in leaves, leafsheath, pericarp and hull. However, the study on the color of sterile lemma is rare. In the previous report, the segregation ratio of 2.9:1 (Purple leafsheath:Green leafsheath) indicated that OsC1 was responsible for purple leaf sheath (Chin et al. 2016). In this study, we confirmed that the purple and straw-white apiculus and purple and straw-white sterile lemma segre-gated with a 9:7 ratio, respectively, indicating the involvement of two complementary genes. QTLs analysis and substitution mapping confirmed that one gene detected on chromosome 1 was located between KJ01079 and KJ01103 and the other detected on chromosome 6 was located between KJ06011 and KJ06027. The Rd gene was colocalized with qSC1 and and the OsC1 gene was located in qSC6 and qAC6 sug-gesting that qSC1 is allelic to Rd and qSC6 is allelic to OsC1 (Fig. 2).

In the previous study, two single nucleotide substitutions at two positions of the 1st and 2nd exons of the Rd gene have been previously observed in white rice (Nakai et al. 1998). In this study, only one single nucleotide mutation (C→A) in the 2nd exon of Rd was detected (Fig. 4). Mutations cause premature stop resulting in white rice seed phenotype due to lack of anthocyanin and PA biosynthesis (Lim and Ha 2013). A 3-bp deletion in the second exon at OsC1 caused loss of gene function resulting in glutamic acid (E) deletion (Nakai et al. 1998; Sun et al. 2018).

Haplotype analysis was performed using KRICE_CORE accessions to confirm whether the two complementary genes regulate the sterile lemma and apiculus color in other rice accessions. 78 accessions could be divided into 14 types. Rd has an SNP that leads to a premature stop. In C1, a total of 11 mutation events were identified, including 5 non-synonymous, 2 synonymous, 1 premature stop, and 3 deletions.

Almost all indica had the 10-bp (ACTGGAACAG) deletion and 2-bp (TC) and 3-bp (GAG) deletions were mostly detected in japonica accessions. These seem to indicate that mutations in OsC1 occur independently in indica and japonica. Accessions with wild type alleles at both Rd and C1 have purple sterile lemma and apiculus. It can endorse that pigmentation in the apiculus is observed when Rd and OsC1 are expressed (Sun et al. 2018). Additionally, the results support the conclusion that deletions or substitutions are partially associated with phenotypic changes observed in rice accessions with different C1 alleles (Saitoh et al. 2004; Zheng et al. 2019).

SUPPLEMENTARY MATERIALS
PBB-8-378_SuppleF1.pdf PBB-8-378_SuppleT1.xlsx
ACKNOWLEDGEMENTS

This study was financially supported by research fund of Chungnam National University in 2018.

References
  1. Cheon KS, Baek J, Cho YI, Jeong YM, Lee YY, Oh J, et al. 2018. Single nucleotide polymorphism (SNP) discovery and Kompetitive allele-specific PCR (KASP) marker development with Korean Japonica rice varieties. Plant Breed. Biotech. 6: 391-403.
    CrossRef
  2. Chin HS, Wu YP, Hour AL, Hong CY, Lin YR. 2016. Genetic and evolutionary analysis of purple leaf sheath in rice. Rice (N. Y.) 9: 8.
    Pubmed KoreaMed CrossRef
  3. Choudhury BI, Khan ML, Dayanandan S. 2014. Patterns of nucleotide diversity and phenotypes of two domestication related genes (OsC1 and Wx) in indigenous rice varieties in Northeast India. BMC Genet. 15: 71.
    Pubmed KoreaMed CrossRef
  4. Fan FJ, Fan YY, Du JH, Zhuang JY. 2008. Fine mapping of C (Chromogen for anthocyanin) gene in rice. Rice Sci. 15: 1-6.
    CrossRef
  5. Furukawa T, Maekawa M, Oki T, Suda I, Iida S, Shimada H, et al. 2007. The Rc and Rd genes are involved in proanthocyanidin synthesis in rice pericarp. Plant J. 49: 91-102.
    Pubmed CrossRef
  6. Gao X, Liang W, Yin C, Ji S, Wang H, Su X, et al. 2010. The SEPALLATA-like gene OsMADS34 is required for rice inflorescence and spikelet development. Plant Physiol. 153: 728-740.
    Pubmed KoreaMed CrossRef
  7. Grotewold E. 2006. The genetics and biochemistry of floral pigments. Annu. Rev. Plant Biol. 57: 761-780.
    Pubmed CrossRef
  8. Hong L, Qian Q, Zhu K, Tang D, Huang Z, Gao L, et al. 2010. ELE restrains empty glumes from developing into lemmas. J. Genet. Genomics 37: 101-115.
    Pubmed CrossRef
  9. Ikeda K, Ito M, Nagasawa N, Kyozuka J, Nagato Y. 2007. Rice ABERRANT PANICLE ORGANIZATION 1, encoding an F-box protein, regulates meristem fate. Plant J. 51: 1030-1040.
    Pubmed CrossRef
  10. Kim CK, Cho MA, Choi YH, Kim JA, Kim YH, Kim YK, et al. 2011. Identification and characterization of seed-specific transcription factors regulating anthocyanin biosynthesis in black rice. J. Appl. Genet. 52: 161-169.
    Pubmed KoreaMed CrossRef
  11. Kim TS, He Q, Kim KW, Yoon MY, Ra WH, Li FP, et al. 2016. Genome-wide resequencing of KRICE_CORE reveals their potential for future breeding, as well as functional and evolutionary studies in the post-genomic era. BMC Genomics 17: 408.
    Pubmed KoreaMed CrossRef
  12. Kobayashi K, Maekawa M, Miyao A, Hirochika H, Kyozuka J. 2010. PANICLE PHYTOMER2 (PAP2), encoding a SEPALLATA subfamily MADS-box protein, positively controls spikelet meristem identity in rice. Plant Cell Physiol. 51: 47-57.
    Pubmed KoreaMed CrossRef
  13. Koes R, Verweij W, Quattrocchio F. 2005. Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 10: 236-242.
    Pubmed CrossRef
  14. Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, et al. 1987. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1: 174-181.
    Pubmed CrossRef
  15. Lee HS, Sasaki K, Higashitani A, Ahn SN, Sato T. 2012. Mapping and characterization of quantitative trait loci for mesocotyl elongation in rice (Oryza sativa L.). Rice (N. Y.) 5: 13.
    Pubmed KoreaMed CrossRef
  16. Li D, Chen C. 1993. The characteristics of two ecotypes of O. rufipogon in China and ecological investigation. J. Southern Agric. 1: 6-11.
  17. Lim SH, Ha SH. 2013. Marker development for the identification of rice seed color. Plant Biotechnol. Rep. 7: 391-398.
    CrossRef
  18. Lin-Wang K, Bolitho K, Grafton K, Kortstee A, Karunairetnam S, McGhie TK, et al. 2010. An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae. BMC Plant Biol. 10: 50.
    Pubmed KoreaMed CrossRef
  19. Liu X, Sun X, Wang W, Ding H, Liu W, Li G, et al. 2012. Fine mapping of Pa-6 gene for purple apiculus in rice. J. Plant Biol. 55: 218-225.
    CrossRef
  20. Martin C, Paz-Ares J. 1997. MYB transcription factors in plants. Trends Genet. 13: 67-73.
    Pubmed CrossRef
  21. McCouch SR, Teytelman L, Xu Y, Lobos KB, Clare K, Walton M, et al. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res. 9: 199-207.
    Pubmed CrossRef
  22. Nakai K, Inagaki Y, Nagata H, Miyazaki C, Iida S. 1998. Mole-cular characterization of the gene for dihydroflavonol 4-reductase of japonica rice varieties. Plant Biotechnol. 15: 221-225.
    CrossRef
  23. Oikawa T, Maeda H, Oguchi T, Yamaguchi T, Tanabe N, Ebana K, et al. 2015. The birth of a black rice gene and its local spread by introgression. Plant Cell 27: 2401-2414.
    Pubmed KoreaMed CrossRef
  24. Reddy AR. 1996. Genetic and molecular analysis of the anthocyanin pigmentation pathway in rice, p. 341-352. In: GS. Khush (Ed). Rice Genetics III, International rice Research Institute, Manila, Philippines.
    CrossRef
  25. Ren D, Li Y, Zhao F, Sang X, Shi J, Wang N, et al. 2013. MULTI-FLORET SPIKELET1, which encodes an AP2/ERF protein, determines spikelet meristem fate and sterile lemma identity in rice. Plant Physiol. 162: 872-884.
    Pubmed KoreaMed CrossRef
  26. Saitoh K, Onishi K, Mikami I, Thidar K, Sano Y. 2004. Allelic diversification at the C (OsC1) locus of wild and cultivated rice: nucleotide changes associated with pheno-types. Genetics 168: 997-1007.
    Pubmed KoreaMed CrossRef
  27. Shao Y, Xu F, Tang F, Bao J. 2013. The temporal and spatial expression pattern of anthocyanin related genes in rice (Oryza sativa L.). J. Nuclear Agr. Sci. 27: 9.
  28. Siddiq EA, Sadananda AR, Zaman FU. 1986. Use of primary trisomic of rice in genetic analysis. Rice Genetics, Proceedings of the International Rice Genetics Symposium. International Rice Research Institute, Manila, Philippines. pp. 185-197.
    CrossRef
  29. Sun X, Zhang Z, Chen C, Wu W, Ren N, Jiang C, et al. 2018. The C-S-A gene system regulates hull pigmentation and reveals evolution of anthocyanin biosynthesis pathway in rice. J. Exp. Bot. 69: 1485-1498.
    Pubmed KoreaMed CrossRef
  30. Sweeney MT, Thomson MJ, Pfeil BE, McCouch S. 2006. Caught red-handed: Rc encodes a basic helix-loop-helix protein conditioning red pericarp in rice. Plant Cell 18: 283-294.
    Pubmed KoreaMed CrossRef
  31. Takahashi ME. 1957. Analysis on apiculus color genes essential to anthocyanin coloration in rice. J. Fac. Agr. Hokkaido Univ. 50: 266-362.
  32. Wang C, Shu Q. 2007. Fine mapping and candidate gene analysis of purple pericarp gene Pb in rice (Oryza sativa L.). Chinese Sci. Bull. 52: 3097-3104.
    CrossRef
  33. Yoshida A, Suzaki T, Tanaka W, Hirano HY. 2009. The homeotic gene long sterile lemma (G1) specifies sterile lemma identity in the rice spikelet. Proc. Natl. Acad. Sci. U. S. A. 106: 20103-20108.
    Pubmed KoreaMed CrossRef
  34. Zhao S, Wang C, Ma J, Wang S, Tian P, Wang J, et al. 2016. Map based cloning and functional analysis of the chromogen gene C in rice (Oryza sativa L.). J. Plant Biol. 59: 496-505.
  35. Zheng J, Wu H, Zhu H, Huang C, Liu C, Chang Y, et al. 2019. Determining factors, regulation system, and domestication of anthocyanin biosynthesis in rice leaves. New Phytol. 223: 705-721.
    Pubmed CrossRef


December 2020, 8 (4)
Full Text(PDF) Free
Supplementary File

Cited By Articles
  • CrossRef (0)

Funding Information

Social Network Service
Services
  • Science Central