search for




 

Breeding Hybrid Rice with Genes Resistant to Diseases and Insects Using Marker-Assisted Selection and Evaluation of Biological Assay
Plant Breed. Biotech. 2019;7:272-286
Published online September 1, 2019
© 2019 Korean Society of Breeding Science.

Me-Sun Kim1, Sothea Ouk1, Kuk-Hyun Jung2, Yoohan Song1, Le Van Trang1, Ju-Young Yang1, Yong-Gu Cho1*

1Department of Crop Science, Chungbuk National University, Cheongju 28644, Korea
2Department of Central Area Crop Science, National Institute of Crop Science, RDA, Suwon 16429, Korea
Corresponding author: *Yong-Gu Cho, ygcho@cbnu.ac.kr, Tel: +82-43-261-2514, Fax: +82-43-273-1598
Received August 14, 2019; Revised August 21, 2019; Accepted August 21, 2019.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Developing elite hybrid rice varieties is one important objective of rice breeding programs. Several genes related to male sterilities, restores, and pollinators have been identified through map-based gene cloning within natural variations of rice. These identified genes are good targets for introducing genetic traits in molecular breeding. This study was conducted to breed elite hybrid lines with major genes related to hybrid traits and disease/insect resistance in 240 genetic resources and F1 hybrid combinations of rice. Molecular markers were reset for three major hybrid genes (S5, Rf3, Rf4) and thirteen disease/insect resistant genes (rice bacterial blight resistance genes Xa3, Xa4, xa5, Xa7, xa13, Xa21; blast resistance genes Pita, Pib, Pi5, Pii; brown planthopper resistant genes Bph18(t) and tungro virus resistance gene tsv1). Genotypes were then analyzed using molecular marker-assisted selection (MAS). Biological assay was then performed at the Red River Delta region in Vietnam using eleven F1 hybrid combinations and two control vatieties. Results showed that nine F1 hybrid combinations were highly resistant to rice bacterial blight and blast. Finally, eight F1 hybrid rice varieties with resistance to disease/insect were selected from eleven F1 hybrid combinations. Their characteristics such as agricultural traits and yields were then investigated. These F1 hybrid rice varieties developed with major genes related to hybrid traits and disease/insect resistant genes could be useful for hybrid breeding programs to achieve high yield with biotic and abiotic resistance.

Keywords : Hybrid rice, Restorer line, Marker-assisted selection, Disease resistance, Insect resistance
INTRODUCTION

Rice (Oryza sativa L.) is one of the most important crops in the world. It has been estimated that more than 414 million metric tons (MT) of milled rice are consumed in developing countries in 2018 (Ikeda-Kawakatsu et al. 2012). According to USDA’s Economic Research Service (USDA-ERS), rice consumption in Africa is expected to reach 3,500 tons by 2028. Thus, it is essential to enhance rice productivity (Thome et al. 2018). Most heterosis researches of F1 hybrid rice have been focused on yield increase or related genes. Hybrid rice area is expanding in major rice-producting countries in Asia. Most of hybrid rice varieties have high yield and resistance to disease and insect such as bacterial blight, blast, and brown planthopper (Viet 2008; Dyah et al. 2013). Since 1970s, China has been conducting hybrid rice research, commercialization, and cultivation in 18 million hectares, comprising more than fifty percent of total national rice area. Meanwhile, hybrid rice varieties have yield increases of more than 30% compared to their parental inbred lines in Vietnam (FAORAP 2014).

Hybrid rice can be produced using either a three-line or a two-line system. The former is derived from cytoplasmic male sterility (CMS) while the latter is derived from genic male sterility (GMS). Well-known GMS materials are photo-period-sensitive genic male sterile rice (PGMS) and temperature-sensitive genic male sterile rice (TGMS). The female parent of three-line hybrid rice is a GMS line and the male parent is a restorer line (Li et al. 2007; Lee et al. 2011; Jo and Kim 2016). To breed various CGMS and restorer lines with backgrounds of Korean japonica rice varieties, CGMS line BT-CMS was crossed with restorer line AR-3 (Seo and Song 1993). In CMS line, one or more nuclear genes known as restorer-of-fertility (Rf) genes can suppress the expression of aberrant mitochondrial CMS genes and restore viable pollen production (Chase 2007). The CMS/Rf system has been an indispensable resource for commercial hybrid seed production (Lin and Yuan 1980; Chen and Liu 2014; Bohra et al. 2016). Jing et al. (2001) have found that Rf4 locus in IR24 is flanked by RM171 (OSR33) and RM228 on the long arm of chromosome 10. Rf3 is mapped on chromosome 1 and linked to RM1 about 1.9 cM (Zhang et al. 1996; He et al. 2002; Balaji et al. 2012). Wide compatibility gene S5 is known as one of the loci that can enhance wide compatibility during crossing made between indica and japonica lines. When sequences of indica (S5i) and japonica (S5j) are compared, two SNPs are identified in the coding region located at 1,010 bp [C/A] and 1,604 bp [C/T] downstream of the start codon (Ouyang et al. 2009; Sundaram et al. 2010).

Crop yield losses are caused by diseases and insect pests of tropical and temperate rice cultivation area in Asia, including bacterial blight (50–80%), blast (50–85%), tungro virus (5–10%), and brown planthopper (60%) (Park et al. 2011; Shin et al. 2011; Fujita et al. 2013). About thirty major bacterial blight resistance genes have been identified in rice of many countries. Bacterial blight R-genes are distributed across 9 of 12 chromosomes in rice (none on chromosome 1, 9, or 10). More than eight bacterial blight R-genes are intensively clustered on chromosome 11 (Jin et al. 2007; Cheema et al. 2008; Xia et al. 2012; Zhang et al. 2015). Approximately 350 quantitative trait loci (QTLs) for resistance to rice blast have been identified and 23 of them have been molecularly characterized (Yang et al. 2009; Liu et al. 2010). Tungro virus resistance in Ultri Merah has been found to be under the control of a recessive gene (tsv1) (Lee et al. 2010). The gene was mapped on chromosome 7 where a gene encoding initiation factor (eIF4G) was strongly associated with tungro virus resistance (Lee et al. 2010). Rice brown planthopper resistance gene Bph18(t) was identified by SSR marker RM463 and STR marker S15552 in an indica introgression line (Myint et al. 2012). It expresses strong resistance to brown planthopper biotype of Korea (Myint et al. 2012).

Marker-assisted selection (MAS) has become an important approach to develop new varieties with genes related to disease/insect resistance. It also accelerates the application of marker-assisted backcross (MAB) (Lau et al. 2015; Suh et al. 2015; Franz et al. 2016; Hu et al. 2016).

The objective of this study was to identify F1 hybrid rice with hybrid traits and genes related to disease/insect resistance using MAS and phenotypic selection for improving grain yield of F1 hybrid rice and developing excellent variety of hybrid rice for export.

MATERIALS AND METHODS

Plan meterials

We used a rice panel comprised of 240 genetic resources and F1 hybrid combinations (Table 1) provided by National Institute of Crop Science, Rural Development Administration (RDA), Republic of Korea. F1 hybrid combinations were selected using MAS. They were applied for screening disease/insect resistance in the rice field of the Red River Delta region in Vietnam.

DNA extraction

Total genomic DNA was extracted from fresh leaves of two-week-old rice seedlings using TissueLyser II system (QIAGEN, UK) with modified Cetyl Trimethyl Ammonium Bromide (CTAB) method as described previously by Cho et. al. (2007). DNA concentration was quantified using a spectrophotometer (NanoDropTM One, Thermo Fisher Scientific, USA). DNA solution was then diluted to a working concentration with distilled water and stored at −20°C until use.

Genotyping

Polymerase chain reaction (PCR) was performed using gene-specific primers reported in previous studies (Song et al. 2016) and developed precisely in this study (Table 2).

Control varieties were used to compare the size and presence/absence of amplicon between resistant and susceptible lines (Table 3). Approximately 40 ng of genomic DNA was used in a 20 μL PCR reaction containing 2 μL of primer pairs (10 pmol/μL), 2.0 μL of 10 × PCR buffer, 1.6 μL of dNTP (2.5 mM), and 0.2 μL of Taq DNA polymerase (5 unit/μL; Promega, USA). The reaction mixture was subjected to the following PCR conditions: initial denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55–60°C for 30 seconds, and extension at 72°C for 45–60 seconds, and a final extension step at 72°C for 10 minutes. PCR amplified products of genes related to hybrid traits (S5, Rf4), bacterial blight (Xa3, Xa7, xa13, and Xa21), blast (Pib, Pita, Pi5, and Pii), and tungro virus (tsv1) resistant genes were separated on 1.5–2.0% agarose gel and stained with ethidium bromide. PCR amplified products of Rf3, Xa4, and xa5 were run on a fragment capillary gel electrophoresis system (Fragment analyzer, USA). Fragments were sized and scored using PROSize 2.0 software (Fragment analyzer, USA). Amplification of Bph18(t) was performed on an EcoTM Real-Time PCR System (Illumina, San Diego, CA, USA) according to the user guide manual. Allele callings of amplified fragments of hybrid lines and control varieties were based on their respective resistance and susceptible controls.

Evaluation of disease and insect resistance responses

Resistance to disease and insect was assessed during summer season (2018) in an experimental field at Haihau District, Namdinh Province, Vietnam. To evaluate bacterial blight, rice blast, and brown planthopper resistance, we selected F1 hybrid lines (Table 4) and control varieties with hybrid related genes. A randomized complete block design with three replicates was used. Eleven F1 hybrid lines and control varieties were sown on February 15, 2018 and transplanted a week later. Plot size was 1 m × 1 m. Row to row and plant to plant spacing were 20 cm × 20 cm. Three varieties, namely TN1, B40, and Tetep, were used as control varieties to compare resistant and susceptible lines. Disease/insect pest outbreaks and damages in the filed were screened three times (April 3, April 24, and May 4) to determine degree of resistance and susceptibility. Levels of resistance were bioassayed with a standard seed-box screening test (rice brown planthopper), sequential planting and nursery screening test (rice blast), and inoculation screening under a net house (bacterial blight) according to IRRI protocol for accurate determination.

Investigation of agronomic traits and yields

Investigation of agronomic traits and yields was performed during rainy season at the same place as bioassay. A randomized complete block design with three replicates was used and eight F1 hybrid combinations and two control varieties were transplanted on June 29, 2018. Plot size was 4.8 m2. Row to row and plant to plant spacing were 20 cm × 20 cm. IIA838 and BC15 were used as control varieties to compare agronomic traits and yield performance. Measurement of plant height, tiller number, heading date, and ripening conditions was conducted during cultivation period. Yields were investigated from October 8 to October 18.

RESULTS

Development of F1 hybrid combinations with genes related to hybrid traits and disease/insect resistance using MAS

A total of 240 genetic resources and F1 hybrid combinations were genotyped using PCR-based markers related to hybrid traits and disease/insect resistance genes based on fragment size differences and presence/absence (Figs. 1, 2).

We examined the genotype of S5 gene with Indel markers targeting sequences flanking the 136-bp deletion and SNP markers converting SNPs between indica and japonica alleles into PCR-based allele specific markers. S5-Indel amplified a 281-bp fragment with 136-bp deletion of intron in 18 hybrid breeding lines (Entry No. 111–128 in Table 1) with wide-compatibility. The restorer of fertility gene Rf3 was detected in 176 and 216 hybrid lines using microsatellite marker RF3-5 and RF3-10, respectively. The major gene Rf4 was amplified in 96 and 125 hybrid lines using RF4-14 and M19280, respectively (Supplementary Table S1).

We determined the presence of bacterial blight resistance genes (Xa3, Xa4, xa5, Xa7, xa13, Xa21), blast resistance genes (Pita, Pib, Pi5, Pii), a brown planthopper resistance gene (Bph18(t)), and a tungro virus resistance gene (tsv1) in genetic resources and F1 hybrid combinations (Supplementary Table S2). Among 240 genetic resources and F1 hybrid combinations, bacterial blight genes Xa3, Xa4, xa5, Xa7, xa13, Xa21 were found in 20, 32, 36, 10, 3, and 4 F1 hybrid combinations, respectively, while most lines (226 genetic resources) were detected to carry Pib. We further surveyed the distribution of resistant genes to brown planthopper using High Resolution Melt (HRM) markers in hybrid rice breeding lines. Bph18(t) was present in 24.1% of total genetic resources and F1 hybrid combinations (Fig. 3A). Distribution of different gene combination varied greatly among lines. Number of lines with three genes was found to be the highest (27.4%), followed by two-gene-containing lines (25%) and four-gene-containg lines (20.4%). Seven resistance genes combination, Xa4 + Xa5 + Pi-ta + Pib + Pi5 + Bph18(t) + tsv1, was identified in indica variety ‘Rumpe’ (Fig. 3B, Supplementary Table S3).

Selection of F1 hybrid combinations for disease/insect resistance in bioassay

In this study, we selected eleven F1 combinations having S5+Rf3+Rf4 related to hybrid traits among 240 genetic resources and F1 hybrid combinations. Field screening was performed to identify lines resistant to bacterial blight, blast, and brown planthopper. Eight F1 hybrid combinations excluding KR0695H, KR0696H, and KR1444H showed resistance to bacterial blight. Meanwhile, in ten F1 hybrid combinations excluding KR1487H, blast resistance genes were integrated with more than three other resistance genes. F1 hybrid combinations containing brown planthopper and tungro virus resistance genes had fewer than two combinations. A F1 hybrid combination, KR2116H, had the most resistance genes among eleven F1 combinations (Table 5).

To evaluate resistance to bacterial blight, blast, and brown planthopper, we performed field screen with the selected eleven F1 combinations and control varieties in the Red Rever Delta region, Vietnam. F1 hybrid combination KR1994H without a resistance gene of rice brown planthopper showed resistance to rice brown planthopper at 6 days after treatment compared to BTP 33 (resistant variety) but showed medium sensitivity to rice brown planthopper at 8 days after treatment. Most of F1 hybrid combinations (except KR1994H) with two or most blast resistance genes were found to have very strong resistance to blast fungus. F1 hybrid combination KR0203H showed the same level of resistance to bacterial blight as OM 1490 (susceptible variety). Eleven F1 combinations were found to have strong resistance to bacterial blight (Table 6).

Evaluation of agronomic traits and yields of selected F1 hybrid combinations

We developed eight F1 hybrid combinations selected from eleven F1 combinations that accumulated genes related to hybrid traits and disease/insect resistance genes by genetic analysis and bioassay (Table 7). Their agronimic traits were compared with control varieties. Heading date was the earilest in a control variety, IIA838 (May 12), while it was the latest in F1 hybrid combinations KR1454H (May 19) and KR1354H (May 19). Heading days of KR0695H, KR0696H, KR1497H, and KR2116H were the same (May 15). Regarding plant height, KR0695H (122.6 cm) and KR0696H (122.9 cm) were the highest while KR1497H (111.6 cm) was the shortest. Panicle length of KR1354H (31.1 cm) was the longest, followed by that of KR0203H (29.4 cm) and KR2116H (29.0 cm). Panicle lengths of control varieties and F1 hybrid combinations were slimilar (within 27–28 cm). Percent ripened grain was the hightest in KR1498H (88.5%) but the lowest in KR0695H (65.2%). Thousand grain weights of KR0203H (27.0 g) and KR0696H (27.0 g) were heavier than other F1 combinations. KR0695H (11.8 Ton/ha) showed the hightest yield of rough rice among the eight F1 combinations selected. KR1455H (9.6 Ton/ha) had lower yield while the rest had yield of 10–11 Ton/ha (Table 7). F1 hybrid combinations KR0695H (11.8 Ton/ha) and KR0696 (11.1 Ton/ha) showed the highest yield as seen in Fig. 4.

DISCUSSION

Plant breeding based on MAS has become an important approach to ensure the development of crop varieties with durable resistance to diseases and insects and to accelerate the application of MAB (Lau et al. 2015; Hu et al. 2016). In this study, we conducted screening of hybrid traits and genes related to disease/insect resistance using molecular MAS. We also performed field screening of responses to diseases and insects for developing F1 hybrid rice varieties with high yield.

Three hybrid genes (S5, Rf3, Rf4) and thirteen disease/insect resistance genes (bacterial blight resistance genes, Xa3, Xa4, xa5, Xa7, xa13, Xa21; blast disease resistance genes, Pi-ta, Pib, Pi5, Pii; a leafhopper resistance gene, Bph; tungro virus resistance gene, tsv1) were analyzed for 240 genetic resources and F1 hybrid combinations using molecular marker analysis. Most of these genetic resources showed correlation with S5, Rf3, and Rf4 genes. The total number of combinations with diease/insect resistance genes was 72. All possible combinations were made by a maximum of seven resistance genes. The seven resistance gene combination, Xa4 + Xa5 + Pi-ta + Pib + Pi5 + Bph18(t) + tsv1, was identified in indica variety. Eleven F1 combinations that accumulated useful genes related to hybrid traits were selected and used for field screening at the Red River Delta, Vietnam. As a result, they exhibited high resistance to bacterial blight and blast diseases. Nine F1 combinations that accumuated F1 hybrid genes, S5, Rf3, and Rf4, and biotic stress resistance genes for bacterial blight, blast, and brown planthopper resistance were also integrated. Agronomic traits were compared with control varieties and the productivity of F1 combinations was analyzed. KR1498H (88.5%) showed the highest in percent ripened grain, but KR0695H (65.2%) was the lowest. Thousand grain weights of KR0203H (27.0 g) and KR0696H (27.0 g) were heavier than those of other F1 combinations. Among the eight selected hybrid combinations, KR0695H (11.8 Ton/ha) and KR0696 (11.1 Ton/ha) showed the hightest rough rice yield (Fig. 4). These two hybrid rice combinations showed higher yield than those of Suweon Hybrid 1 (8.34 Ton/ha) and Suweon Hybrid 2 (7.34 Ton/ha) bred in Korea in 1990s and also much higher than those of ICGHR 2 (6.99 Ton/ha) and Hao uu 19 (6.75 Ton/ha) grown in Vietnam, implying that these two hybrid variety candidates would be competitive for future export.

Recently, damages by diseases and pests have increased due to climate change. As a result, rice production is falling into an unstable state. Accordingly, developing new varieties with high yield and durable resistance to disease and pest is indespensible. Philippines and China have developed varieties that integrate two, three, or more than four resistance genes using MAS. For example, Xa21 resistance gene has been integrated into IR72, showing a widespread resistance (Tu et al. 1998; Singh et al. 2011). In South Korea, breeders have also developed countermeasures against mutant strain K3a by breeding a resistance variety Jinbaek which integrates Xa3 and xa5 genes (Kim et al. 2009; Shin et al. 2011). These varieties have diversified single-resistance genes and integrated main genes for stabilizing yield and durability of rice varieties.

The current direction of plant breeding is to select resistance lines by using molecular markers. By using molecular markers for selection, it can reduce the effort of screening resistance genes. Stable resistance genotypes can be selected at early generation so that its resistance can remain longer (Peleman and Voort 2003). However, to confirm whether genes inserted or accumulated by MAS show resistance or not, it is nessary to screen selected plants by inoculation or in the field. To develop resistance varieties with useful genes and resistant genes into practically cultivated varieties, comprehensive considerations are needed through selection of phenotypes of various agronomic traits in the breeding process.

In this study, eight F1 combinations were superior F1 combinations that expressed useful genes with complex disease and pest resistance. This result could be useful for breeding F1 hybrid varieties with complex biotic resistance genes for future export.

Supplementary Information
ACKNOWLEDGEMENTS

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Golden Seed Project funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) (213009-05-3-WT211).

Figures
Fig. 1. PCR products for genotyping with each marker linked to disease and insect resistance in breeding lines. S5, Rf4, Pita, Pib, Pii, and Pi5 show band patterns on agarose gel electrophoresis; Rf3 indicates size differentiation by fragment analyzer gel electrophoresis. L, R, S indicates ladder marker, resistant, and susceptible control variety, respectively.
Fig. 2. PCR products for genotyping with each marker linked to hybried related genes and blast resistance genes in breeding lines. Xa3, Xa7, xa13, and Xa21 show band patterns on gel electrophoresis; xa4, xa5, and tsv1 indicate size differentiation by fragment analyzer gel electrophoresis. Bph18(t) shows HRM curve profiles of 240 genetic resources and F1 hybrid combinations. L, R, S indicates ladder marker, resistant, and susceptible control variety, respectively.
Fig. 3. (A) Frequency distribution of disease and insect resistant genes among 240 genetic resources and F1 hybrid combinations, and (B) Frequency of rice lines having different numbers of resistant genes.
Fig. 4. Panicle type and growth performance of F1 hybrid combinations, KR0695H, and KR0696H. (A) Panicle length and morphologies of KR0695H and KR0696H; (B) Growth performance of KR0695H and KR0696H at Hai Hau field in Vietnam.
Tables

List of 240 genetic resources and hybrid rice combinations used in this study.

Entry No.DesignationCross/OriginRemarkSource
19019ChinaRestorer811001
2Basmati 370IndiaAromatic rice811005
3ChiherangCambodiaLocal variety811007
4CigeulisCambodiaLocal variety811009
5CiliwungCambodiaLocal variety811011
6FFZ1ChinaLocal variety811017
7Giza178EgyptLocal variety811019
8HHZ12-SAL2-Y3-Y1ChinaBreeding line811025
9HHZ12-SAL8-Y1-Y2ChinaBreeding line811027
10IR05N412IR72875-94-3-3-2/IR73707-45-3-2-3Breeding line, IRRI811029
11IR05N412IR72875-94-3-3-2/IR73707-45-3-2-3Breeding line, IRRI811030
12IR06A145IR02A127/JANAKIBreeding line, IRRI811031
13IR09N538IRRI 132/PR 30138-35-2//IR04N114Breeding line, IRRI811033
14IR10A267IR02A483/IRBB 60-1Breeding line, IRRI811035
15IR10N305-1IRRIBreeding line, IRRI811037
16IR78581-12-3-2-2-1IRRIBreeding line, IRRI811041
17IR98070-kB13-1-2-2-1-1-1IR72903-131-1-2-3R/IR72998-78-1-3-2 RRestorer811047
18IR98070-kB14-1-2-3-1-4-1IR72903-131-1-2-3R/IR72998-78-1-3-2 RRestorer811051
19IR98102-kB9-1-1-1-1-1-1IR65622-151-2-2-2R/IR73885-1-4-3-2-1-10RRestorer811055
20IR98102-kB9-1-1-3-1-1-B2-1IR65622-151-2-2-2R/IR73885-1-4-3-2-1-10RRestorer811059
21IR98229-9-2-1-k1-1-6-1-1IR08A138/IR72998-93-3-3-2RRestorer811060
22IR98229-24-1-1-k1-1-1-1-1IR08A138/IR72998-93-3-3-2RRestorer811062
23IR98241-24-2-1-k1-1-1-1IR06N172/IR86612-38-2-2-1-1-1-1-1Breeding line, IRRI811068
24IR101872-46-1-K1-1-2-1MingHui63/IR86590-22-2-2-1-3-1-1-1Breeding line, IRRI811078
25L24ChinaLocal variety811084
26NSIC 238PhilippinesLocal variety811094
27KR3RMY3R(SSLR-12, Myanma Col. 2012)Local variety811096
28OM52VietnamLocal variety811098
29TLR353VietnamLocal variety811102
30TLR363VietnamLocal variety811104
31Vietnam collection 1VietnamLocal variety811106
32WEED TOLERANT RICE 1-1IRRIBreeding line, IRRI811108
33Zhong419ChinaLocal variety811110
346527UnknownLocal variety811113
35Com. Collection 3Com Col. (Cambodia Col. 2015)Local variety811114
36HHZ1-Y4-Y1HUANG-HUA-ZHAN*2/YUE-XIANG-ZHANBreeding line, China811120
37HUA564ChinaBreeding line811122
38IR02A127IR00A107/IR62243-41-1-3-3Breeding line, IRRI811124
39IR05N359IR72158-11-5-2-3/Ir72903-121-2-1-2Breeding line, IRRI811126
40IR06A181IR71718-59-1-2-3/IR72Breeding line, IRRI811128
41IR08N136IR72967-12-2-3/PR 31090-33-2-1Breeding line, IRRI811130
42IR10K153HR 24580-15-1/IR03K105Breeding line, IRRI811132
43IR11A303IR04A427/IR72875-94-3-3-2Breeding line, IRRI811134
44IR11A334IR04A427/IRRI 115Breeding line, IRRI811136
45Japonica 1PhilippinesLocal variety811138
46SACG4IRRILocal variety811150
47SAGC-02IRRILocal variety811152
48ZH1ChinaLocal variety811156
49HHZ11-Y10-DT3-Y3ChinaBreeding line811158
50HHZ5-DT1-DT1ChinaBreeding line811160
51HHZ5-SAL12-DT3-Y2ChinaBreeding line811162
52HHZ5-SAL8-DT2-SAL1ChinaBreeding line811164
53HHZ8-SAL14-SAL1-SUB1ChinaBreeding line811166
54HHZ8-SAL6-SAL3-SAL1ChinaBreeding line811168
55HHZ8-SAL6-SAL3-Y1ChinaBreeding line811170
56HHZ8-SAL6-SAL3-Y2HUANG-HUA-ZHAN*2/PHALGUNABreeding line811172
57IR06M150MEM BERANO/PADI ABANG GOGOBreeding line, IRRI811174
58IR72 (IR72)IR19661-9-2-3-3/IR15795-199-3-3//IR9129-209-2-2-2-1Advanced variety, IRRI811178
59TeqingChinaLocal variety811180
60TME80518TME 80518Local variety811182
61KR2RMR2R(Myanma Col. 2012)Restorer811184
62A 69-1IRRIBreeding line811186
63BR 28-SalTolBangladeshBreeding line811188
64ChulsaCambodiaLocal variety811190
65IR04A395IRRIBreeding line811192
66IR07A234NSIC RC 138/IRRI 123Breeding line811194
67IR10A 227IR01A154/IR72870-19-2-2-3//Irri 123Breeding line811196
68IR65482-4-136IRRIBreeding line811198
69AN 424627IRRILocal variety811200
70BR 26BangladeshLocal variety811202
71Daerip H-R11-2-1-1-178/Daelipbyeo F1Breeding line811204
72IR64 Sub1IRRIBreeding line811206
73IR68897H-B24-B-1-1-2IRRIBreeding line811208
74IR09A228PR29232-B-17-2-1-1/IR 64Breeding line,811210
75J.P.5-IR946-2-2-2/IR1635-1FIRRIBreeding line811212
76IR97727-82-1-2-2IRRIBreeding line811214
77IR98073-3-1-1-K1-1IR72903-131-1-2-3R/IR85485-106-B-B-1-1-1-1Breeding line811216
78IR98107-kB3-1-1-2-1-1IR71604-4-1-4-4-4-2-2-2R/IR65622-151-2-2-2RBreeding line811218
79IR98108-kB13-1-2-3-1-2-1IRRIBreeding line811220
80IR98161-2-1-1-k2-2-2IR86409-3-1-1-1-1-1/IRBB66Breeding line811222
81IR98194-9-2-1-k1-1-1IRRIBreeding line811224
82IR101861-7-1-K1-1-1MingHui63/IR03A550Breeding line811226
83IRRI 102IR4215-301-2-2-6/BG90-2//IR19661-131-1-2Advanced variety, IRRI811234
84Jasponica Bulk Aroma4-1PhilippinesBreeding line811236
85Jasponica Bulk Aroma5-1PhilippinesBreeding line811238
86KCD1IRRILocal variety811240
87MY1H-R23-3-1-1-1-1MY 1 A/RBreeding line811242
88MY1H-R23-3-2-1-1-1MY 1 A/RBreeding line811244
89NSIC 222PhilippinesLocal variety811246
90OM100411VietnamLocal variety811248
91OM10375VietnamLocal variety811250
92OM4900VietnamLocal variety811252
93OM7347VietnamLocal variety811254
94OM8108VietnamLocal variety811256
95OMCS 2012VietnamLocal variety811258
96Pearl riceH-R28-3-2-1-1IRRIBreeding line811260
97Pearl riceH-R52-2-1-1-1IRRIBreeding line811262
98PHB73H-R9-2-1-1-1IRRIBreeding line811264
99Phka RomeatCambodiaLocal variety811266
100Phka RumchangCambodiaLocal variety811268
101Phka RumchekCambodiaLocal variety811270
102Phka RumdengCambodiaLocal variety811272
103Phka RumduolCambodiaLocal variety811274
104PopoulCambodiaLocal variety811276
105RumpeCambodiaLocal variety811278
106S430ChinaLocal variety811280
107San pidaoCambodiaLocal variety811283
108TH82H-R2-1-1-1-1-1VietnamBreeding line811284
109TLR405Vietnam-811286
110TLR407Vietnam-811288
111WC467-2-1-1-1-2-2-1-1(Milyang154/Norin PL9//Milyang154)/Milyang154Breeding line811290
112WC467-2-3-2-1-2-1-1-1(Milyang154/Norin PL9//Milyang154)/Milyang154Breeding line811292
113WC468-2-1-3-1-2-3-1-1(Milyang154/Norin PL9//Milyang154)/Milyang154Breeding line811294
114WC488-6-1-1-2-1-1-1-1(Milyang23//Norin PL9/Dular///Milyang23)/Milyang23Breeding line811296
115WC488-6-1-1-2-1-3-1-1(Milyang23//Norin PL9/Dular///Milyang23)/Milyang23Breeding line811298
116WC495-1-1-1-1-2-3-1-1(Milyang160//Norin PL9/Dular///Areumbyeo)/AreumbyeoBreeding line811300
117WC509-4-1-2-1-2-3-1-1(Jangsungbyeo/Dular//Jangsungbyeo)/JangsungbyeoBreeding line811302
118WC540-2-1-3-1-1-1-1-1(Milyang160/CPSLO 17//Areumbyeo)/AreumbyeoBreeding line811304
119WC540-2-1-3-1-2-2-1-1(Milyang160/CPSLO 17//Areumbyeo)/AreumbyeoBreeding line811308
120WC540-2-3-3-1-2-3-1-1(Milyang160/CPSLO 17//Areumbyeo)/AreumbyeoBreeding line811312
121WC549-1-1-2-1-1-1-1-1(Yongmunbyeo/CPSLO 17//Yongmunbyeo)/YongmunbyeoBreeding line811314
122WC570-2-1-3-1-1-1-1-1(Samgangbyeo//Dular/Samgangbyeo///Samgangbyeo)/SamganbyeoBreeding line811316
123WC634-1-1-2-1-2-1-1-1(Yongjubyeo//N22/Yongjubyeo)/YongjubyeoBreeding line811320
124WC647-1-1-1-1-1-2-1-1Ilpumbyeo/IR65600-96-1-2-2//Ilpumbyeo)/IlpumbyeoBreeding line811324
125WC962-1-2-1-1-1-102428-97-2/Areumbyeo//3*YeonghaebyeoBreeding line811328
126WC964-1-1-2-1-3-1-1-1Sambaekbyeo/02428-97-1//3*SambaekbyeoBreeding line811332
127WC972-3-3-1-1-1-102428/3*YongmunbyeoBreeding line811334
128WC972-4-2-1-3-2-102428/3*YongmunbyeoBreeding line811340
129Corn riceChinaLocal variety811375
130Restorer 1-1UnknownBreeding line811377
131Restorer 2-1UnknownBreeding line811379
132Restorer 3-1UnknownBreeding line811381
133Indonesia col. 1(2016)Indonesia Col. (Cambodia Col. 2016)Local variety811383
134Indonesia col. 2(2016)Indonesia Col. (Cambodia Col. 2016)Local variety811385
135HYT 116H-3-1-3-2-1-1HYT 116 HBreeding line811391
136HYT 116H-17-2-1-1-2-1HYT 116 HBreeding line811395
137HYT 116H-31-2-3-1-1-1HYT 116 HBreeding line811397
138HYT 116H-46-1-1-1-1-1HYT 116 HBreeding line811401
139HYT 116H-50-1-1-2-1-1HYT 116 HBreeding line811405
140HYT 119H-18-2-2-2-1-1HYT 119 HBreeding line811407
141HYT 119H-18-3-2-2-2-2HYT 119 HBreeding line811411
142HYT 119H-21-1-3-2-2-1HYT 119 HBreeding line811414
143HYT 123H-13-3-3-1-2-1HYT 123HBreeding line811416
144HYT 124H-3-3-1-1-2-1HYT 124HBreeding line811420
145HYT 128H-8-2-2-2-2-1HYT 128HBreeding line811426
146HYT 128H-11-2-1-1-2-1HYT 128HBreeding line811428
147HYT 130H-3-2-3-1-1-1HYT 130HBreeding line811432
148CASH 1H-1-2-3-1-1-1CASH 1HBreeding line811434
149CASH 1H-4-3-2-1-1-1CASH 1HBreeding line811440
150CASH 1H-34-2-2-2-1-1CASH 1HBreeding line811444
151Hipa Jatim 1H-5-2-2-3-2-1Hipa Jatim 1 HBreeding line811446
152IR68897H-94 B-1-3-3-1-1IR68897HBreeding line811448
153IR101922-BK-KB-2-2-1Maybelle/PSBRC80Breeding line811452
154IR101922-BK-KB-6-1-1Maybelle/PSBRC80Breeding line811456
155IR101923-BK-KB-1-2-1IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1Breeding line811458
156IR101923-BK-KB-3-2-1IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1Breeding line811460
157IR101923-BK-KB-4-2-1IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1Breeding line811462
158IR101923-BK-KB-4-3-1IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1Breeding line811464
159IR101923-BK-KB-7-1-1IR86427-29-6-1-3-1-1-1-1/IR86508-4-2-3-2-1-1-2-1Breeding line811466
160IR101924-BK-KB-2-3-1IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1Breeding line811468
161IR101924-BK-KB-7-2-1IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1Breeding line811470
162IR101924-BK-KB-10-2-1IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1Breeding line811472
163IR101924-BK-KB-11-3-1IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1Breeding line811474
164IR101924-BK-KB-14-1-1IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1Breeding line811476
165IR101924-BK-KB-14-2-1IR86427-29-6-1-3-1-1-1-1/IR86519-12-1-3-1-1-1-1-1Breeding line811478
166IR101933-BK-KB-2-1-1IR86505-6-4-3-1-1-1-1-1/MingHui63Breeding line811480
167IR101937-BK-KB-3-2-1IR86505-6-4-3-1-1-1-1-1/IR86612-26-1-1-1-1-2-1-1Breeding line811482
168IR101937-BK-KB-9-3-1IR86505-6-4-3-1-1-1-1-1/IR86612-26-1-1-1-1-2-1-1Breeding line811484
169KR0301-B-12-1-1-1OM 052/NSIC RC 238Breeding line811485
170KR0302-B-5-2-2-1OM 052/Minghui 63Breeding line811490
171KR0302-B-5-3-1-1OM 052/Minghui 63Breeding line811492
172KR0302-B-14-2-1-1OM 052/Minghui 63Breeding line811496
173KR0302-B-17-1-3-1OM 052/Minghui 63Breeding line811498
174KR0302-B-10-2-1-1OM 052/Minghui 63Breeding line811500
175KR0302-B-10-2-2-1OM 052/Minghui 63Breeding line811502
176KR0302-B-13-1-1-1OM 052/Minghui 63Breeding line811506
177GR19-1-8-2-2-12A/3m164Breeding line811510
178GR20-1-3-1-1-12A/3m170Breeding line811512
179PHB 73H-1-2-3-1-2-1PHB 73Breeding line811514
180PHB 73H-18-2-2-3-1-1PHB 73Breeding line811522
181Matibay H-5-3-1-1-1-1MatibayBreeding line811526
182ABp H-20-2-1-1-1-1Arize Bigante plusHBreeding line811532
183ABp H-29-2-1-1-2-1Arize Bigante plusHBreeding line811538
184ABp H-33-2-3-2-1-1Arize Bigante plusHBreeding line811540
185Hipa Jatim 2H-1-3-3-1-2-1Hipa Jatim 2 HBreeding line811542
186HYT 106H-17-2-1-2-1-1HYT 106HBreeding line811544
187HYT 106H-17-2-2-3-2-1HYT 106HBreeding line811548
188HYT 106H-17-2-3-1-2-1HYT 106HBreeding line811551
189HYT 106H-17-3-1-1-1-1HYT 106HBreeding line811559
190HYT 106H-17-3-2-3-2-1HYT 106HBreeding line811563
191HYT 108H-10-2-3-1-3-1HYT 108HBreeding line811565
192Jasponica-4-1-1-2-2-1SH 9Breeding line811569
193Jasponica-12-1-1-2-3-1SH 9Breeding line811575
194Jasponica-14-3-1-1-1-1SH 9Breeding line811577
195Jasponica-15-1-1-1-1-1SH 9Breeding line811583
196Jasponica-26-1-1-1-3-1SH 9Breeding line811585
197Jasponica-29-3-1-1-2-1SH 9Breeding line811587
198Jasponica-40-3-1-1-2-1SH 9Breeding line811599
199IR24IRRIAdvanced variety811601
200IRBB1IRRIBacterial Blight811603
201IRBB3IRRIBacterial Blight811605
202IRBB7IRRIBacterial Blight811607
203IRBB13IRRIBacterial Blight811609
204IRBB55IRRIBacterial Blight811611
205IRBB59IRRIBacterial Blight811613
206DasanKoreaLocal variety810801
207HanareumKoreaLocal variety810802
208KR0203HKoreaHybrid rice F1810803
209KR0695HKoreaHybrid rice F1810804
210KR0696HKoreaHybrid rice F1810805
211KR1454HKoreaHybrid rice F1810806
212KR1455HKoreaHybrid rice F1810807
213KR1354HKoreaHybrid rice F1810808
214KR1497HKoreaHybrid rice F1810809
215KR1444HKoreaHybrid rice F1810810
216KR1487HKoreaHybrid rice F1810811
217KR1994HKoreaHybrid rice F1810812
218KR2116HKoreaHybrid rice F1810813
219KR2117HKoreaHybrid rice F1810814
220KR 1BKoreaMaintainer812501
221KR 1AKoreaCGMS812503
222KR 2BKoreaMaintainer812526
223KR 2AKoreaCGMS812528
224KR 211BKoreaMaintainer812551
225KR 211AKoreaCGMS812553
226MingHui 63ChinaLocal variety, Restorer812571
227IR75589-31-27-8-33S-5-1IRRIBreeding line, TGMS812608
228IR102100-KB5S2-1-4-1-1-1-1IRRIBreeding line, TGMS812618
229OM052VietnamLocal variety, Restorer812636
230IR102100-KB14-2S2-1-22-2-1-2IRRIBreeding line, TGMS812718
231IR98070-kB14-1-2-3-1-1IRRIBreeding line812736
232IR98229-2-2-1-K1-1-1IRRIBreeding line812756
233IR98229-9-2-1-K1-1-1IRRIBreeding line812771
234IR98229-9-2-1-K1-1-3IRRIBreeding line812776
235IR101861-7-1-K1-1-1IRRIBreeding line812786
236IR98241-24-2-1-k1-1-1IRRIBreeding line812806
237IR98102-kB9-1-1-3-1-1-1IRRIBreeding line812821
238IR102100-KB12S1-1-25-1-1-1-1IRRIBreeding line, TGMS812823
239IR98102-kB21-1-3-1-3-1IRRIBreeding line812836
240IR102452-KB3-1-2-2-1-1IRRIBreeding line812851

Gene-specific PCR primers and their primer sequences used for analysis of related genes.

TargetGeneMarker nameTypePrimer sequence (5′→3′)Exspected size (bp)Reference
Genes related to hybridS5S5-IndelFwCCTACGTTTGACTGCCTGCCTG281/417Sundaram et al. 2010
RvCTACACGCGGCTTCGGGAAAGC
Indica-specific SNPFwGACAGCAGCATCAACGACTTCC527
RvTCGTCAGTGGGCAAGCAGTAGCTG
Japonica-specific SNPFwACCCTGATATTCTGAGTTACAAGGCATTA325
RvGCTCTTGATGTCCGGTGATACC
Rf3DRRM-RF3-5FwGATGGCACAGCTTCAGAACA120/134Suresh et al. 2012
RvCTAATTCTGGGCGAGCAAAG
DRRM-RF3-10FwTCACCTCTTCCTGCTTCGAC180/195
RvCTCCACCAGTGCAGGTTTTT
Rf4DRCG-RF4-14FwGCAATGCTTGTATTCAGCAAA845/885Tang et al. 2014
RvTCCAGCTGTAAATCCGTCAA
M19280FwATCTGTCCAGACACCATTTTC147/141
RvTCCACTGATGAGTGCATTG
BlastPitaYL155/87FwAGCAGGTTATAAGCTAGGCC1042Jia et al. 2002, 2004
RvCTACCAACAAGTTCATCAAA
YL183/87FwAGCAGGTTATAAGCTAGCTAT
RvCTACCAACAAGTTCATCAAA
PibNSbFwATCAACTCTGCCACAAAATCC629Kwon et al. 2008
RvCCCATATCACCACTTGTTCCCC
Pi5JJ817FwGATATGGTTGAAAAGCTAATCTCA1450Kwon et al. 2008
RvATCATTGTCCTTCATATTCAGAGT
PiiJJ113FwGGATGATGTGATCTGCAGAG484Jeon 2002
RvCTCTTGGTGATCTTTGTTAC
Bacterial blight (BB)Xa3BB3-SusFwCGGAGCGACACAGCTATCAT743Hu et al. 2013
RvCGTGAGGTTCCCTATGGCGATT
BB3-ReFwCCACAATGCCATGTCAGGTGGCATCCCTGCA255Hu et al. 2013
RvAGGTGTTGGAGGATTGGCAT
Xa4RM224FwATCGATCGATCTTCACGAGG150/120McCouch et al. 2002
RvTGCTATAAAAGGCATTCGGG
Xa5RM122FwGCACTGCAACCATCAATGAATC236/232Chen et al. 1997
RvCCTAGGAGAAACTAGCCGTCCA
Xa7M5FwCGATCTTACTGGCTCTGCAACTCTGT294/1170Porter et al. 2013
RvGCATGTCTGTGTCGATTCGTCCGTACGA
Xa13Xa13promFwGGCCATGGCTCAGTGTTTAT1000/520Zhang et al. 1996; Singh et al. 2011
RvGAGCTCCAGCTCTCCAAATG
Xa21pTA248FwAGACGCGGAAGGGTGGTTCCCGGA1000/750Huang et al. 1997
RvAGACGCGGTAATCGAAAGATGAAA
BPHBph18(t)Bph18(t)SNP23CGATGGATTACCCTATCACCT CAAHRMDeveloped in this study
SNP24AACCCTCTGCACACCATCGG
Tungro virustsv1RM6152FwGAATTCACCGCTCTCCAGTC206Lee et al. 2010
RvAGGAGGATCTCCTCCAGGAG

List of control varieties used for identification of resistance genes.

GeneResistant controlsSusceptible controls
Xa3IRBB3IR24
Xa4IRBB4IR24
xa5IRBB5IR24
Xa7IRBB7IR24
xa13IRBB13IR24
Xa21IRBB21IR24
PibIRBL-bLTH
PitaIRBL-ta(K1), IRBL-ta(CT2), IRBL-ta2(Pi)LTH
Pi5, PiiPi3, Pi5(t), PiiLTH
Bph18(t)Anmi, AndaIR24, Ilpum
tsv1Utri merah, N22Nipponbare, TN1

List of eleven hybrid rice breeding lines and their cross combinations used for evaluating agronomic traits and screening disease/insect resistance in the Red River Delta in Vietnam.

F1 entryCross combinationRemark
KR0203HKR2A/Minghui 63CGMS
KR0695HKR1A/OM052CGMS
KR0696HKR2A/OM052CGMS
KR1454HKR1A/MY2R (= KR2R)CGMS
KR1455HKR2A/MY2R (= KR2R)CGMS
KR1354HKR2A/IR98070-KB14-1-2-3-1-1CGMS
KR1497HIR75589-31-27-8-33S/IR98229-9-2-1-k1-1TGMS
KR1444HIR75589-31-27-8-33S/IR102452-KB3-1-2-2-1-1TGMS
KR1487HHYT 108 S8-1-25-2/IR98102-kB9-1-1-3-1-1TGMS
KR1994HIR75589-31-27-8-33S/Minghui 63TGMS
KR2116HIR102100-KB12S2-1-19-1/IR98102-kB21-1-3-1-3-1TGMS

Identification patterns of disease and insect resistant genes in eleven hybrid rice combinations.

EntryBacterial BlightNo. of R genesBlastNo. of R genesBph 18(t)tsv1Total of R genes


Xa3SXa3RXa4xa5Xa7xa13Xa21Pi-taPibPiiPi5
KR0203H++/−0++++3+/−3
KR0695H0++++3+/−3
KR0696H+0+++++4+/−4
KR1454H++1++++34
KR1455H++1++++34
KR1354H+++/−1++++3+/−4
KR1497H++1+++++45
KR1444H+0+++++44
KR1487H++/−0+++22
KR1994H+/−0++++44
KR2116H+++/−+/−1+++++4+6

To get the whole information of 240 genetic resources and hybrid rice combinations, please see Supplementary Table S1.


Relative levels of resistance on hybrid rice combinations and control varieties upon inoculation separately by disease and insect in the Red River Delta region in Vietnam.

Entryz)Brown PlanthopperBlastBacterial Blight



6 DARy)8 DAR28 DAI35 DAIy)42 DAI





ScoreReactionScoreReactionScoreReactionScoreReactionScoreReaction
KR0203H6.0MSx)8.0S0.0HR1.0HR5.0MS
KR0695H7.0S9.0HS0.0HR0.0HR1.0HR
KR0696H6.0MS9.0HS0.0HR0.0HR3.0R
KR1454H5.0MS8.0S0.0HR0.0HR3.0R
KR1455H6.0MS8.0S0.0HR0.0HR3.0R
KR1354H7.0S8.0S1.0HR1.0HR3.0R
KR1497H4.0MR8.0S0.0HR0.0HR1.0HR
KR1444H7.0S9.0HS0.0HR0.0HR3.0R
KR1487H4.0MR9.0HS1.5HR2.0HR3.0R
KR1994H3.0R6.0MS4.0MR5.0MS0.0HR
KR2116H5.0MS9.0HS0.0HR1.0HR1.0HR
BTP 331.0R1.0R------
TN 19.0HS9.0HS------
OM 1490----9.0HS9.0HS5.0MS

z)All of hybrid rice breeding lines, KR0203H to KR2116H, were in generation of F1.

y)DAR: Days after release, DAI: Day after inoculation.

x)HR: Highly resistance, R: Resistance, MR: Medium resistance, MS: Medium susceptible, S: Susceptible, HS: Highly susceptible.


Agronomic traits and yields of F1 hybrid combinations with disease/insect resistantance genes introduced by MAS and control varieties.

EntryHD (mm.dd)GP (day)PH (cm)PL (cm)PET (%)PRG (%)GW (g)Yield (tonne/ha)
KR0203H5.18121114.529.464.878.127.010.1
KR0695H5.15119122.627.574.065.226.511.8
KR0696H5.15119122.927.975.371.827.011.1
KR1454H5.19123118.227.471.768.426.09.7
KR1455H5.18122114.427.472.673.826.49.6
KR1354H5.19126113.631.171.569.926.410.7
KR1497H5.15119111.628.376.288.526.210.0
KR2116H5.15122113.829.083.668.526.110.3
IIA8385.12113118.328.179.390.430.314.6
BC155.16115112.828.169.874.322.19.1

HD: Heading date, GP: Growing period, PH: Plant height, PL: Panicle length, PET: Percent effective tillers, PRG: Percent ripened grain, GW: 1000-grain weight.


References
  1. Balaji Suresh P, Srikanth B, Hemanth Kishore V, Subhakara Rao I, Vemireddy LR, Dharika N, et al. 2012. Fine mapping of Rf3 and Rf4 fertility restorer loci of WA-CMS of rice (Oryza sativa L.) and validation of the developed marker system for identification of restorer lines. Euphytica. 187: 421-435.
    CrossRef
  2. Bohra A, Jha UC, Adhimoolam P, Bisht D, Singh NP. 2016. Cytoplasmic male sterility (CMS) in hybrid breeding in field crops. Plant Cell Rep. 35: 967-993.
    Pubmed CrossRef
  3. Chase CD. 2007. Cytoplasmic male sterility: a window to the world of plant mitochondrial-nuclear interactions. Trends Genet. 23: 81-90.
    Pubmed CrossRef
  4. Cheema KK, Grewal NK, Vikal Y, Sharma R, Lore JS, Das A, et al. 2008. A novel bacterial blight resistance gene from Oryza nivara mapped to 38kb region on chromosome 4L and transferred to Oryza sativa L. Genet. Res. (Camb). 90: 397-407.
    Pubmed CrossRef
  5. Chen L, Liu Y. 2014. Male sterility and fertility restoration in crops. Annu Rev Plant Bio. 65: 579-606.
    Pubmed CrossRef
  6. Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. 1997. Development of a microsatellite framework map providing genomewide coverage in rice (Oryza sativa L.). Theor Appl Genet. 95: 553-567.
    CrossRef
  7. Dyah RP, Kei M, Bambang HT. 2013. The dynamics of rice production in Indonesia 1961–2009. J Saudi Soc Agric Sci. 12: 27-37.
  8. ., FAORAP 2014. Hybrid rice development in Asia: Assessment of limitations and potential.
  9. Franz MN, Song JY, Ouk S, Rahimi S, Kwon SW, Kang KK, et al. 2016. Current applicable DNA markers for marker assisted breeding in abiotic and biotic stress tolerance in rice (Oryza sativa L.). Plant Breed Biotech. 4: 271-284.
    CrossRef
  10. Fujita D, Kohli A, Horgan FG. 2013. Rice resistance to planthoppers and leafhoppers. Crit Rev Plant Sci. 32: 162-191.
    CrossRef
  11. He GH, Wang WM, Liu GQ, Hou L, Xiao YH, Tang M, et al. 2002. Mapping of two fertility restoring gene for WA cytoplasmic male mterility in Minghui63 using SSR markers. Acta Genet Sin. 29: 798-802.
    Pubmed
  12. Huang N, Angeles ER, Domingo J, Magpantay G, Singh S, Zhang G, et al. 1997. Pyramiding of bacterial blight resistance genes in rice: marker assisted selection using RFLP and PCR. Theor Appl Genet. 95: 313-320.
    CrossRef
  13. Hu J, Xiao C, He Y. 2016. Recent progress on the genetics and molecular breeding of brown planthopper resistance in rice. Rice (N Y). 9: 30.
    Pubmed KoreaMed CrossRef
  14. Hu YJ, Jeung JU, Kim SY, Park HS, Cho JH, Lee JY. 2013. Functional markers for bacterial blight resistance gene Xa3 in rice. Mol Breed. 31: 981-985.
    CrossRef
  15. Ikeda-Kawakatsu K, Maekawa M, Izawa T, Itoh J, Nagato Y. 2012. ABERRANT PANICLE ORGANIZATION 2/RFL, the rice ortholog of Arabidopsis LEAFY, suppresses the transition from inflorescence meristem to floral meristem through interaction with APO1. Plant J. 69: 168-180.
    Pubmed CrossRef
  16. Jeon JS, Chen D, Yi GH, Wang GL, Ronald PC. 2003. Genetic and physical mapping of Pi5(t), a locus associated with broad-spectrum resistance to rice blast. Mol. Genet. Genomics. 269: 280-289.
    Pubmed CrossRef
  17. Jia Y, Wang Z, Singh P. 2002. Development of dominant rice blast Pi-ta resistance gene markers. Crop Sci. 42: 2145-2149.
    CrossRef
  18. Jia Y, Redus M, Wang Z, Rutger JN. 2004. Development of a SNLP marker from the Pi-ta blast resistance gene by tri-primer PCR. Euphytica. 138: 97-105.
    CrossRef
  19. Jin XW, Wang CL, Yang Q, Jiang QX, Fan YL, Liu GC, et al. 2007. Breeding of near-isogenic line CBB30 and molecular mapping of Xa30(t), a new resistance gene to bacterial blight in rice. Sci Agric Sin. 40: 1094-1100.
  20. Jing RC, Li XM, Yi P, Zhu YG. 2001. Mapping fertility-restoring genes of rice WA cytoplasmic male sterility using SSLP markers. Bot Bull Acad Sin. 42: 167-171.
  21. Jo YC, Kim SG. 2016. Efficient F1 variety development using CGMS system in onion (Allium cepa L.). Trends Agric Life Sci. 53: 81-85.
    CrossRef
  22. Kim KY, Shin MS, Kim WJ, Mo YJ, Nam JK, Noh TH, et al. 2009. Effective combination of resistance genes against rice bacterial blight pathogen. Korean J Breed Sci. 41: 244-251.
  23. Kwon SW, Cho YC, Kim YG, Suh JP, Jeung JU, Roh JH. 2008. Development of near-isogenic Japonica rice lines with enhanced resistance to Magnaporthe grisea. Mol Cells. 25: 407-416.
    Pubmed
  24. Lau WC, Rafii MY, Ismail MR, Puteh A, Latif MA, Ramli A. 2015. Review of functional markers for improving cooking, eating, and the nutritional qualities of rice. Front Plant Sci. 6: 832.
    Pubmed KoreaMed CrossRef
  25. Lee JD, Do JW, Han JH, An CG, Kweon OY, Kim YK, et al. 2011. Allelism and molecular marker tests for genic male sterility in paprika cultivars. Korean J Hortic Sci Technol. 29: 130-134.
  26. Lee JH, Muhsin M, Atienza GA, Kwak DY, Kim SM, Leon TB. 2010. Single nucleotide polymorphisms in a gene for translation initiation factor (eIF4G) of rice (Oryza sativa) associated with resistance to Rice tungro spherical virus. Mol Plant Microbe Interact. 23: 29-38.
    Pubmed CrossRef
  27. Li S, Yang D, Zhu Y. 2007. Characterization and use of male sterility in hybrid rice breeding. J Integr Plant Biol. 49: 791-804.
    CrossRef
  28. Lin SC, Yuan LP., International Rice Research Institute 1980. Hybrid rice breeding in China. Innovative approaches to rice breeding. International Rice Research Institute, Manila, Philippines, pp. 35-51.
  29. Liu J, Wang X, Mitchell T, Hu Y, Liu X, Dai L, et al. 2010. Recent progress and understanding of the molecular mechanisms of the rice-Magnaporthe oryzae interaction. Mol Plant Pathol. 11: 419-427.
    Pubmed CrossRef
  30. McCouch SR, Teytelman L, Xu YB, Lobos KB, Clare K, Walton M. 2002. Development and mapping of 2,240 new SSR markers for rice (Oryza sativa L.). DNA Res. 9: 199-207.
    CrossRef
  31. Myint KKM, Fujita D, Matsumura M, Sonoda T, Yoshimura A, Yasui H. 2012. Mapping and pyramiding of two major genes for resistance to the brown planthopper (Nilaparvata lugens [Stål]) in the rice cultivar ADR52. Theor Appl Genet. 124: 495-504.
    Pubmed KoreaMed CrossRef
  32. Ouyang YD, Chen JJ, Ding JH, Zhang QF. 2009. Advances in the understanding of inter-subspecific hybrid sterility and wide compatibility in rice. Sci Bull. 54: 2332-2341.
    CrossRef
  33. Park HS, Kim KY, Shin MS, Noh TH, Ha KY, Baek MG, et al. 2011. Breeding for japonica rice variety with resistance to bacterial blight in Korea. Korean J Breed Sci. 43: 44.
  34. Peleman JD, Voort JR. 2003. Breeding by design. Trends Plant Sci. 8: 330-334.
    Pubmed CrossRef
  35. Porter BW, Chittoor JM, Yano M, Sasaki T. 2003. Development and mapping of markers linked to the rice bacterial blight resistance gene Xa7. Crop Sci. 43: 1484-1492.
    CrossRef
  36. Seo HS, Song YC. 1993. Breeding hybrid rice with good quality and high yield: I. Breeding of cytoplasmic-genetic male sterile and restorer lines with backgrounds of Korean rice varieties. Korean J Crop Sci. 38: 413-417.
  37. Shin MS, Kim KY, Park HS, Ko JK. 2011. Breeding for resistance to bacterial blight in rice. Korean J Breed Sci. 43: 241-251.
  38. Singh AK, Gopala Krishnan S, Singh VP, Prabhu KV, Mohapatra T, Singh NK. 2011. Marker assisted selection: a paradigm shift in Basmati breeding. Indian J Genet Pl Br. 71: 1-9.
  39. Song JY, Ouk S, Nogoy FM, Niño MC, Kwon SW, Ha WG, et al. 2016. Application and utilization of marker assisted selection for biotic stress resistance in hybrid rice (Oryza sativa L.). J Plant Biotechnol. 43: 317-331.
    CrossRef
  40. Suh JP, Cho YC, Won YJ, Ahn EK, Baek MK, Kim MK, et al. 2015. Development of Resistant Gene-Pyramided Japonica Rice for Multiple Biotic Stresses Using Molecular Marker-Assisted Selection. Plant Breed Biotech. 3: 333-345.
    CrossRef
  41. Sundaram RM, Sakthivel K, Hariprasad AS, Ramesha MS, Viraktamath BC, Neeraja CN, et al. 2010. Development and validation of a PCR-based functional marker system for the major wide-compatible gene locus S5 in rice. Mol Breed. 26: 719-727.
    CrossRef
  42. Suresh PB, Srikanth B, Kishore VH, Rao IS, Vemireddy LR, Dharika N, et al. 2010. Fine mapping of Rf3 and Rf4 fertility restorer loci of WA-CMS of rice (Oryza sativa L.) and validation of the developed marker system for identification of restorer lines. Euphytica. 187: 421-435.
    CrossRef
  43. Tang H, Luo D, Zhou D, Zhang Q, Tian D, Zheng X, et al. 2014. The ricer restorer Rf4 for wild-abortive cytoplasmic male sterility encodes a mitochondrial-localized PPR protein that functions in reduction of WA352 transcripts. Mol Plant. 7: 1-4.
    CrossRef
  44. Thome K, Birgit M, Kamron D, Cheryl C. 2018. International Food Security Assessment, 2018–2028, GFA-29. Departmetn of Agriculture, Economic Research Service, U.S.
  45. Tu J, Ona I, Zhang Q, Mew TW, Khush GS, Datta SK. 1998. Transgenic rice variety ‘IR72’ with Xa21 is resistant to bacterial blight. Theor Appl Genet. 97: 31-36.
    CrossRef
  46. Viet NV. 2008. National agricultural research system of Vietnam. Vietnam Academy of Agricultural Sciences, Vietnam.
  47. Xia C, Chen H, Zhu X. 2012. Identification, mapping, isolation of the genes resisting to bacterial blight and application in rice. Mol Plant Breed. 3: 121-131.
  48. Yang Q, Lin F, Wang L, Pan Q. 2009. Identification and mapping of Pi41, a major gene conferring resistance to rice blast in the Oryza sativa subsp. indica reference cultivar, 93-11. Theor Appl Genet. 118: 1027-1034.
    Pubmed CrossRef
  49. Zhang F, Zhuo DL, Huang LY, Wang WS, Xu JL, Vera Cruz C, et al. 2015. Xa39, a novel dominant gene conferring broad-spectrum resistance to Xanthomonas oryzae pv. oryzae in rice. Plant Pathol. 64: 568-575.
    CrossRef
  50. Zhang G, Angeles ER, Abenes MLP, Khush GS. 1996. RAPD and RFLP mapping of the bacterial blight resistance gene Xa-13 in rice. Theor Appl Genet. 93: 65-70.
    Pubmed CrossRef


September 2019, 7 (3)
Full Text(PDF) Free
Supplementary File

Cited By Articles
  • CrossRef (0)

Funding Information
  • Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries
      10.13039/501100003668
     
  • Ministry of Agriculture, Food and Rural Affairs
      10.13039/501100003624
      213009-05-3-WT211

Social Network Service
Services
  • Science Central