search for




 

Identification of Korean Ginseng (Panax ginseng) Cultivars Using Simple Sequence Repeat Markers
Plant Breeding and Biotechnology 2016;4:71-78
Published online February 28, 2016
© 2016 Korean Society of Breeding Science.

Yurry Um1, Mei-Lan Jin1, Ok-Tae Kim1, Young-Chang Kim1, Seong-Cheol Kim1, Seon-Woo Cha1, Ki-Wha Chung2, Serim Kim3, Chan-Moon Chung3, and Yi Lee3,*

1Department of Herbal Crop Research, National Institute of Horticultural and Herbal Science, Rural Development Administration, Eumseong 27709, Korea, 2Department of Biological Science, Kongju National University, Gongju 32588, Korea, 3Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
Correspondence to: Yi Lee, leeyi22@cbnu.ac.kr, Tel: +82-43-261-3373, Fax: +82-43-261-3373
Received January 26, 2016; Revised January 26, 2016; Accepted January 28, 2016.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Panax ginseng has been one of the most important herbal medicines used in Eastern Asia. Recently, various molecular markers have been developed to authenticate Panax species, but these markers cannot differentiate the exact varieties or variants of Korean ginseng cultivars. In this study, six cultivars of Korean ginseng (Chunpoong, Yunpoong, Gopoong, Gumpoong, Jakyung, and Hwangsook), P. quinquefolius, and P. notoginseng were differentiated by simple sequence repeat (SSR) marker development. Specific primer sets were designed for the 54 candidate sequences containing SSRs that were predicted. Finally, eight polymorphic SSR loci were developed. DNA fragment analysis was performed using fluorescence-labelled primers for the amplicons. Reproducibility tests were carried out using multiple samples of Korean ginseng cultivars and Panax species. Eight primer sets (PgSSR07, PgSSR08, PgSSR09, PgSSR17, PgSSR37, PgSSR40, PgSSR51, and PgSSR53) showing polymorphism were used for phylogenetic relationship analysis. Consequently, six Korean ginseng cultivars (Chunpoong, Yunpoong, Gopoong, Gumpoong, Jakyung, and Hwangsook), P. quinquefolius, and P. notoginseng could be identified using the combination of SSR markers discovered.

Keywords : Panax, Korean ginseng cultivars, SSR markers, DNA fragment analysis, Phylogenetic relationship
INTRODUCTION

Korean ginseng (Panax ginseng, C.A. Meyer) is an herbaceous perennial plant of the genus Panax (Araliaceae). Korean ginseng is a plant that grows only in the Far East areas, as in Asia, China, Manchuria, and Russia (Woo et al. 2004). The main physiologically active components of ginseng are saponins, phenols, polyacetylenes, alkaloids, and polysaccharides (Lee et al. 2008). These components act on the central nervous, cardiovascular, endocrine, and immune systems, and are recently reported to have antioxidant and anti-stress effects (Nam et al. 2005).

In general, the Panax genus is divided into nine species: P. ginseng, P. notoginseng, P. quinquefolius, P. japonicus, P. pseudoginseng, P. assamicus, P. sokpayensis, P. sikkimensis, and P. bipinnatifidus (Sharma and Pandit 2009). However, the number of Panax species is unclear because several scholars define the same species differently. Many studies identify plants species and varieties using morphological, cytological, anatomical, physiological, and ecological methods (Woo et al. 2004; Yu et al. 2009; Jee et al. 2014; Bai et al. 2015; Kim et al. 2015). Using such morphological characteristics to distinguish among varieties can lead to confusion because expression may be the result of a combination of genetics and environment (Jo et al. 2013). Furthermore, molecular techniques have added another level of classification through study of DNA (Lim and Choi 1990; Lim et al. 1993; Hon et al. 2003). In order to identify the plant species, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNAs (RAPD), amplified fragment length polymorphism (AFLP), and simple sequence repeat (SSR) were used (Powell et al. 1996). SSR markers, or microsatellites, are abundantly dispersed within the genome and have been widely used as genetic markers. SSR markers are very useful for a spectrum of genetic and breeding applications because of their reproducibility, co-dominant inheritance, multi-allelic nature, and genome coverage (Powell et al. 1996; Kim et al. 2007; Silva et al. 2013).

Recently, researchers reported the development of ginseng SSR markers and genetic analysis among national collection species (Park et al. 2009), genetic diversity analysis between wood-cultivated ginseng and field-cultivated ginseng (Jo et al. 2009), as well as identification of P. ginseng and P. notoginseng (Ahn et al. 2009). Besides, many researchers have tried to identify ginseng species and varieties using SSR markers (Kim et al. 2007; Ma et al. 2007; Nguyen et al. 2010; Bang et al. 2011a, 2011b). SSR markers are important for several types of research, including the assessment of genetic diversity, development of genetic maps, comparative genomics, marker-assisted selection, and other plant breeding fields. However, there are few studies on genetic polymorphism analyses of domestic cultivars using SSR markers. These studies were inconclusive because the ginseng genome is very large (3.12 billion base pairs) and there are many recently developed varieties. Therefore, the development of more markers is necessary for molecular breeding and variety identification.

The aim of this research was to develop SSR markers from Korean ginseng cultivars and differentiate the P. ginseng cultivars and Panax species. The SSR markers were identified from the database which was constructed using an enriched SSR library and the polymorphism of the markers was investigated using DNA fragment analysis.

MATERIALS AND METHODS

Plant materials and DNA extraction

This study was carried out with 115 Panax accessions grown in Korea. Panax samples used in this study were Korean ginseng cultivars (17 Chunpoong, 22 Yunpoong, 15 Gopoong, 10 Gumpoong, 23 Jakyung, and 20 Hwangsook) collected from various local fields in Goesan and Suwon, Korea. Moreover, 5 P. quinquefolius and 3 P. notoginseng were obtained from KT&G cooperation company (Daejeon, Korea) and National Institute of Horticultural and Herbal Science (Eumseong, Korea), respectively (Table 1). One hundred mg of fresh leaves were used for genomic DNA extraction using TissueLyser (Qiagen, Düsseldorf, Germany) and the DNeasy plant DNA isolation kit (Qiagen GmbH, Hilden, Germany).

SSR detection and specific primer design

A total of 3,773 DNA sequences of P. ginseng were collected through downloading of 2,549 genome survey sequences from the National Center for Biotechnology Information (NCBI) database and 1,224 microsatellite-enriched library (MEL) sequences from the data collected by Kim et al. (2007). Putative Panax MEL sequences were analyzed by the SSR identification tool ( http://www.gramene.org/db/markers/ssrtool) program. Primer pairs flanking the SSRs were designed using the Primer3 program (Koressaar and Remm, 2007; Untergrasser et al. 2012) with a length of 18 to 25 bp, amplification product size of 100 to 500 bp, annealing temperature (Tm) ranging from 54°C to 60°C, and GC content between 40% and 60%.

Polymerase chain reaction (PCR) amplification and data analysis

Twenty μl of PCR mixture contained 10 pmole primers (fluorescence-labeled primer), 10 ng of genomic DNA, 0.1 mM dNTP, 0.2 units Taq DNA polymerase (RBC Bioscience, New Taipei City, Taiwan) and 10× Taq polymerase buffer using a T-gradient Thermoblock PCR system (Biometra, Göttingen, Germany) for 35 cycles. The initial cycle was pre-denaturation for 5 minutes at 94°C, denaturation for 30 seconds at 94°C, annealing for 1 minute at 59°C, and extension for 1 minute at 72°C (for the final cycle, 5 minutes added). Electrophoresis was performed using a 10% polyacrylamide gel. Polymorphic bands were visualized by gel staining using Gelstar (Lonza Inc., Rockland, ME, USA) and photographed under UV Transilluminator (CoreBio System Co., Seoul, Korea). Polymorphic amplicons visualized on polyacrylamide gels were separated in agarose gel electrophoresis. To verify the accuracy of ginseng SSR polymorphisms, the forward primer was labeled and tested on 6 Korean ginseng cultivars, P. quinquefolius and P. notoginseng. DNA fragment profile data were demonstrated by the SSR markers PgSSR08 and PgSSR51 using NED-labelled primers; PgSSR09 and PgSSR37 using FAM-labelled primers; PgSSR07 and PgSSR40 using VIC-labelled primers; and PgSSR17 and PgSSR53 using PET-labelled primers. Then, we preformed capillary electrophoresis using an ABI3730xl DNA analyzer with GeneScan-500LIZ size standard (Applied Biosystems, Foster City, CA, USA). Based on the resulting data, allele sizes were measured in terms of the numbers of alleles, gene diversity, and polymorphic information content (PIC), using PowerMarker software ver. 3.23 (Liu and Muse 2005). Coefficients of genetic similarity for the eight species used in this study were calculated using the SIMQUAL program (NTSYS-pc, ver. 2.10; Mogea 1999). A neighbor-joining dendrogram was constructed based on a genetic similarity matrix created in the SHAN clustering program from NTSYSpc using the unweighted pair group method with arithmetic mean algorithm.

RESULTS

Abundance and distribution of SSRs

A total of 3,773 sequences were collected and used for the finding of SSRs, defined as di-to octa-nucleotide motifs. Thus, 1,283 sequences (34% of the total sequences) contained SSRs and a total of 13,769 in silico SSR markers were identified. The observed frequencies of di-, tri-, tetra-, penta-, hexa-, hepta-, and octa-nucleotide repeats were 60.1% (n=8,279), 27.8% (n=3,832), 7.8% (n=1,070), 2.7% (n=371), 1.1% (n=153), 0.3% (n=48), and 0.1% (n=16), respectively (Table 2).

Among the dinucleotide repeats, (AT/AT)n and (TA/TA)n were the most abundant repeat motifs and represented 20.0% and 17.2% of dinucleotides, respectively. Among the trinucleotide repeats, (ATA/TAT)n and (TAA/TTA)n were most abundant, with each accounting for approximately 10% of the trinucleotides. Among the tetranucleotide repeats, (AAAT/ATTT)n and (TAAA/TTTA)n were most abundant, with each accounting for approximately 6% of the tetranucleotides (Table 3).

Gel electrophoresis of SSR motifs and DNA fragment analysis

Fifty-four putative SSR markers were validated for polymorphic markers. The allelic structures of the markers were determined from DNA band patterns from Gelstar stained 10% polyacrylamide gels (data not shown). Finally, eight markers—PgSSR07, PgSSR08, PgSSR09, PgSSR17, PgSSR37, PgSSR40, PgSSR51, and PgSSR53—amplified polymorphic PCR product bands among Korean ginseng cultivars. The products were analyzed using the DNA fragment analysis method.

A total of eight SSR loci showed polymorphism, producing a total of 33 alleles among the eight Panax species. The observed number of alleles ranged from three (PgSSR07, PgSSR09, PgSSR17, PgSSR40, and PgSSR53) to eight (PgSSR51), with an average of 4.13 alleles per locus. The genetic diversity of each locus ranged from 0.13 (PgSSR53) to 0.78 (PgSSR51), with an average of 0.45. In addition, the heterozygosity values ranged from 0.07 (PgSSR53) to 0.59 (PgSSR08 and PgSSR09), with an average of 0.32. PIC values were calculated for each polymorphic marker using the method of Roldán-Ruiz et al. (2000). For all accessions, PIC values ranged from 0.13 (PgSSR53) to 0.76 (PgSSR51), with an average of 0.42 (Table 4).

The NTSYSpc software calculated the genetic distances among ginseng cultivars. The eight cultivars were divided into three groups: I, II, and III (Fig. 1). The six Korean ginseng cultivars were divided into two groups. Group I contained Chunpoong, Yunpoong, Gopoong, and Jakyung. Group II contained two cultivars, Gumpoong and Hwangsook. Group III contained P. quinquefolius and P. notoginseng.

DISCUSSION

P. ginseng is one of the most important medicinal plants in Korea. Several cultivars that have different characteristics have been developed. For instance, Yunpoong is a cultivar that produces a higher yield than other cultivars and Chunpoong has good root shape and is suitable for red ginseng production (Lee 2002). Thus, molecular markers are needed to identify the cultivars for optimum utilization and further breeding. Previous researchers have developed various molecular markers—RAPD (Um et al. 2001; Cui et al. 2003; Shim et al. 2003; Lim et al. 2007), RFLP (Yang and Kim 2003), AFLP (Ha et al. 2002; Choi et al. 2008), STS (Bang et al. 2010), and SSR (Bang et al. 2011a, 2011b)—for identification of ginseng cultivars. But, it was not sufficient to identify all the Korean ginseng cultivars.

In this study, we collected 3,773 P. ginseng sequences from GSS and MEL databases. The selected primer sets were labeled with fluorescence at the 5′ end of the forward primer for DNA fragment analysis. The DNA fragment analysis method with different fluorescent colors made it easy to analyze the genetic diversity. Especially for the similar-sized PCR products, labeling using different colors made it possible to analyze several markers at the same time. This method is cost- and time-effective for large-sized samples. We used four colors of fluorescent dyes, FAM, NED, PET, and VIC. The product size of PgSSR09 and PgSSR17 was very similar, but it was possible to identify the markers because we used different colored dyes for each marker. Korean ginseng cultivars have very similar genotypes, therefore many markers are needed to differentiate the cultivars. Thus, we performed genotyping using eight SSR markers and DNA fragment analysis.

A dendrogram was constructed using the DNA fragment analysis data. The correlation coefficients between the cultivars were calculated from the genetic distance matrices based on PgSSR07, PgSSR08, PgSSR09, PgSSR17, PgSSR37, PgSSR40, PgSSR51, and PgSSR53 alleles. The correlation coefficients within the I, II, and III groups were 0.77, 0.87, and 0.70, respectively. The correlation coefficients between groups I+II and III was estimated as 0.56 and the coefficient between groups I and II was 0.67. The low correlation coefficiency of the third combination indicates that alleles could come from all of the three genomes instead of only one or two genomes, so that genetic relationships between varieties can be accurately evaluated (Zhang et al. 2002).

Korean ginseng cultivars grouped together. Jakyung and Hwangsook have been cultivated as domestic varieties in Korea for a long time. Chunpoong, Yunpoong, and Gopoong were developed from Jakyung by selective breeding and Gumpoong was developed from Hwangsook by selective breeding. From the results, Chunpoong, Yunpoong, and Gopoong were grouped with Jakyung; and Gumpoong was grouped with Hwangsook. Therefore, dendrogram results are consistent with the history of Korean ginseng cultivars and Panax species. The traditional ginseng classification was based on morphology, so we generated molecular data to establish the Panax species lineage. Some researchers have published molecular markers for the identification of Panax species (Choi et al. 2011; Bang et al. 2012). But there is no report on the DNA fragment analysis method. For this reason, this study provides a very efficient method for classification study and shows the results of marker application using molecular markers in Panax species.

Consequently, our result is a case study demonstrating that SSR markers developed from GSS and MEL sequences of P. ginseng could be used for genetic studies in Panax species and Korean ginseng cultivars. These markers could be used for further research on cultivar development with molecular breeding techniques and conservation of the genetic diversity of the species in the genus. Moreover, the markers could be useful for genetic mapping and eventual marker-assisted selection in the crop. The use of next-generation sequencing will enable more rapid and efficient development of SSR markers.

ACKNOWLEDGEMENTS

This work was carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ01102202)”, Rural Development Administration, Republic of Korea.

Figures
Fig. 1. Dendrograms showing genetic similarities among eight cultivars of ginseng, constructed using the Panax ginseng cultivars and Panax species similarity coefficient based on eight SSR markers (unweighted pair group method with arithmetic mean algorithm). Cultivars in Chunpoong (C), Yunpoong (Y), Gopoong (GO), Gumpoong (GU), Jakyung (J), Hwangsook (H), P. quinquefolius (PQ), P. notoginseng (PN). Group I contained C, Y, GO, and J. Group II contained GU and H. Group III contained P. quinquefolius and P. notoginseng.
Tables

Source of the Panax species and Panax ginseng cultivars used in this study.

SpeciesCultivarAccessionNo. of sample
P. ginsengChunpoongKT&Gz)17
YunpoongKT&G22
GopoongLocal15
GumpoongLocal10
JakyungjongKT&G23
HwangsookjongLocal20
P. quinquefoliusNIHHS5
P. notoginsengNIHHS3

z)KT&G: name of a Korean ginseng corporation, NIHHS: National Institute of Horticultural and Herbal Science.


Frequencies of microsatellite repeat types in the Panax ginseng sequence collections.

Repeat typeSimple sequence repeat
Di-nucleotide8,279 (60.1)
Tri-nucleotide3,832 (27.8)
Tetra-nucleotide1,070 (7.8)
Penta-nucleotide371 (2.7)
Hexa-nucleotide153 (1.1)
Hepta-nucleotide48 (0.3)
Octa-nucleotide16 (0.1)
Total13,769 (100.0)

Values are presented as number (%).


Abundant SSR motives in the Panax ginseng database. Motifs accounting for 4.9% or more of each repeat type are included*.

VariableSSR motif
AC/GT990 (12.0)
AG/CT1,240 (15.0)
AT/AT1,655 (20.0)
CA/TG1,403 (16.9)
GA/TC1,340 (16.2)
TA/TA1,428 (17.2)
AGA/TCT192 (5.0)
ATA/TAT419 (10.9)
TTG/CAA215 (5.6)
GAA/TTC220 (5.7)
TAA/TTA377 (9.8)
TCA/TGA189 (4.9)
AAAT/ATTT65 (6.0)
TAAA/TTTA62 (5.7)

Values are presented as number (%).

*SSR: simple sequence repeat.


Characteristics of 8 SSR markers including GenBank accession, repeat motif, primer sequence, allele size range, number of alleles, genetic diversity, heterozygosity, and PIC among 8 cultivars of Panax species*.

Marker IDGenBank accessionRepeat motifForward primer (5′→3′)Allele size range (bp)No. of alleleGenetic diversity (h)HeterozygosityPIC
PgSSR07GU565701(GAA)18VIC-ATGGAAGTGGTTTGTGTTGG
AGGAGACCATGAAGGATTCG
204–27630.340.260.32
PgSSR08EF531909(GAAA)6NED-CCTGCTGGAGATTGAAGTCAT
GTTGGAATGCTTCAGCAGAT
180–20750.610.590.55
PgSSR09GU565702(AG)13FAM-TGGATGATTTCGACATTTCTG
CCGTTCAACTAACCCCAAAC
164–20430.510.590.42
PgSSR17BZ957342(GGAACC)3PET-ATCAGAACCGGAACTGGAAC
CTGAATTACCGAACCGAACC
103–11830.210.080.20
PgSSR37EF140892(ATG)7(CTGATG)2FAM-AATCAGAAACAAAGAAAGCTAAAAC
CTCTCTCATCTCTCTCTCTTCC
100–12250.730.360.69
PgSSR40EF140893(ATAG)2VIC-GTAGTAGTAGTAAAACTTTGCTAACG
ATTTACAACTCTCTTCTTCCTCTAC
125–16230.320.280.28
PgSSR51EF140899(AAG)9NED-GGAGGTGATTGATGTAGTGGAATCC
GGCTCTCCTATACTCACTATTTCCC
299–33080.780.340.76
PgSSR53EF140900(CTCCTTT)4PET-CTACACGCTTTTTCATAGCTTACA
TGTCTGCATAAAAGAGTTCGAGGC
185–19430.130.070.13
Average4.130.450.320.42

*SSR: simple sequence repeat, PIC: polymorphic information content.


References
  1. Ahn, CH, Kim, BB, Yoon, ES, and Choi, YE (2009). Development of microsatellite markers to distinguish south Korean and Chinese ginseng. J Korean Forest Sci. 98, 568-575.
  2. Bai, H, Wang, S, Liu, J, Gao, D, Jiang, Y, and Liu, H (2015). Localization of ginsenosides in Panax ginseng with different age by matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry imaging. J Chromatogr B Analyt Technol Biomed Life Sci.
    Pubmed CrossRef
  3. Bang, KH, Lee, JW, Kim, YC, Kim, DH, Lee, EH, and Jeung, JU (2010). Construction of genomic DNA library of Korean ginseng (Panax ginseng C. A. MEYER) and development of sequence-tagged sites. Biol Pharm Bull. 33, 1579-1588.
    Pubmed CrossRef
  4. Bang, KH, Chung, JW, Kim, YC, Lee, JW, Jo, IH, and Seo, AY (2011a). Development of SSR markers for identification of Korean ginseng (Panax ginseng C. A. Meyer.) cultivars. Korean J Med Crop Sci. 19, 185-190.
    CrossRef
  5. Bang, KH, Jo, IH, Chung, JW, Kim, YC, Lee, JW, and Seo, AY (2011b). Analysis of genetic polymorphism of Korean ginseng cultivars and foreign accessions using SSR markers. Korean J Med Crop Sci. 19, 347-353.
    CrossRef
  6. Bang, KH, Seo, AY, Chung, JW, Kim, YC, Jo, IH, and Kim, JU (2012). Analysis of genetic polymorphism and relationship of Korean ginseng cultivars and breeding lines using EST-SSR marker. Korean J Med Crop Sci. 20, 277-285.
    CrossRef
  7. Choi, HI, Kim, NH, Kim, JH, Choi, BS, Ahn, IO, and Lee, JS (2011). Development of reproducible EST-derived SSR markers and assessment of genetic diversity in Panax ginseng cultivars and related species. J Ginseng Res. 35, 399-412.
    Pubmed KoreaMed CrossRef
  8. Choi, YE, Ahn, CH, Kim, BB, and Yoon, ES (2008). Development of species specific AFLP-derived SCAR marker for authentication of Panax japonicus C.A. MEYER. Biol Pharm Bull. 31, 135-138.
    Pubmed CrossRef
  9. Cui, XM, Lo, CK, Yip, KL, Dong, TT, and Tsim, KW (2003). Authentication of Panax notoginseng by 5S-rRNA spacer domain and random amplified polymorphic DNA (RAPD) analysis. Planta Med. 69, 584-586.
    Pubmed CrossRef
  10. Ha, WY, Shaw, PC, Liu, J, Yau, FC, and Wang, J (2002). Authentication of Panax ginseng and Panax quinquefolius using amplified fragment length polymorphism (AFLP) and directed amplification of minisatellite region DNA (DAMD). J Agric Food Chem. 50, 1871-1875.
    Pubmed CrossRef
  11. Hon, CC, Chow, YC, Zeng, FY, and Leung, FC (2003). Genetic authentication of ginseng and other traditional Chinese medicine. Acta Pharmacol Sin. 24, 841-846.
    Pubmed
  12. Jee, HS, Chang, KH, Park, SH, Kim, KT, and Paik, HD (2014). Morphological characterization, chemical components, and biofunctional activities of Panax ginseng, Panax quinquefolium, and Panax notoginseng roots: A comparative study. Food Rev Int. 30, 91-111.
    CrossRef
  13. Jo, BH, Suh, DS, Cho, EM, Kim, JK, Ryu, GH, and Chung, KW (2009). Characterization of polymorphic microsatellite loci in cultivated and wild Panax ginseng. Genes Genom. 31, 119-127.
    CrossRef
  14. Jo, IH, Bang, KH, Kim, YC, Kim, JU, Shin, MR, and Moon, JY (2013). Analysis of mitochondrial DNA sequence and molecular marker development for identification of Panax species. Korean J Med Crop Sci. 21, 91-96.
    CrossRef
  15. Kim, J, Jo, BH, Lee, KL, Yoon, ES, Ryu, GH, and Chung, KW (2007). Identification of new microsatellite markers in Panax ginseng. Mol Cells. 24, 60-68.
    Pubmed
  16. Kim, YJ, Jang, MG, Zhu, L, Silva, J, Zhu, X, and Sukweenadhi, J (2015). Cytological characterization of anther development in Panax ginseng Meyer. Protoplasma.
    CrossRef
  17. Koressaar, T, and Remm, M (2007). Enhancements and modifications of primer design program Primer3. Bioinformatics. 23, 1289-1291.
    Pubmed CrossRef
  18. Lee, MJ, Kim, EH, and Rhee, DK (2008). Effect of Panax ginseng on stress. J Ginseng Res. 32, 8-14.
    CrossRef
  19. Lee, SS (2002). Characteristics of photosynthesis among new cultivars of ginseng (Panax ginseng C.A. Meyer). J Ginseng Res. 26, 85-88.
    CrossRef
  20. Lim, W, Mudge, KW, and Weston, LA (2007). Utilization of RAPD markers to assess genetic diversity of wild populations of North American ginseng (Panax quinquefolium). Planta Med. 73, 71-76.
    Pubmed CrossRef
  21. Lim, YP, and Choi, KT (1990). The characterization of mitochondrial DNA of Korean ginseng (Panax ginseng C.A. Meyer). Korean J Ginseng Sci. 14, 310-316.
  22. Lim, YP, Shin, CS, Lee, SJ, Youn, YN, and Jo, JS (1993). Survey of proper primer and genetic analysis of Korean ginseng (Panax ginseng C.A. Meyer) variants using the RAPD technique. Korean J Ginseng Sci. 17, 153-158.
  23. Liu, K, and Muse, SV (2005). PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics. 21, 2128-2129.
    Pubmed CrossRef
  24. Ma, KH, Dixit, A, Kim, YC, Lee, DY, Kim, TS, and Cho, EG (2007). Development and characterization of new microsatellite markers for ginseng (Panax ginseng C. A. Meyer). Conserv Genet. 8, 1507-1509.
    CrossRef
  25. Mogea, JP (1999). Relationships and phylogeny of the species of the genus Arenga (Palmae) based on morphology using the polarity method and the NTSYS program. Mem New York Bot Gard. 83, 169-177.
  26. Nam, MH, Kim, SI, Liu, JR, Yang, DC, Lim, YP, and Kwon, KH (2005). Proteomic analysis of Korean ginseng (Panax ginseng C.A. Meyer). J Chromatogr B Analyt Technol Biomed Life Sci. 815, 147-155.
    Pubmed CrossRef
  27. Nguyen, VD, Nirala, R, Choi, SR, Uhm, TS, Yang, TJ, and Ahn, IO (2010). Development and characterization of new microsatellite markers in Panax ginseng C. A. Meyer from BAC end sequences. Conserv Genet. 11, 1223-1225.
    CrossRef
  28. Park, SW, Hyun, YS, and Chung, KW (2009). Genetic polymorphism of microsatellite in Panax ginseng C.A. Meyer. J Ginseng Res. 33, 199-205.
    CrossRef
  29. Powell, W, Machray, GC, and Provan, J (1996). Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1, 215-222.
    CrossRef
  30. Rold?n-Ruiz, I, Dendauw, J, Van Bockstaele, E, Depicker, A, and De Loose, M (2000). AFLP markers reveal high polymorphic rates in ryegrasses (Lolium spp.). Mol Breed. 6, 125-134.
    CrossRef
  31. Sharma, SK, and Pandit, MK (2009). A new species of Panax L. (Araliaceae) from Sikkim Himalaya, India. Syst Bot. 34, 434-438.
    CrossRef
  32. Shim, YH, Choi, JH, Park, CD, Lim, CJ, Cho, JH, and Kim, HJ (2003). Molecular differentiation of Panax species by RAPD analysis. Arch Pharm Res. 26, 601-605.
    Pubmed CrossRef
  33. Silva, PI, Martins, AM, Gouvea, EG, Pessoa-Filho, M, and Ferreira, ME (2013). Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads. BMC Genomics. 14, 17.
    Pubmed KoreaMed CrossRef
  34. Untergasser, A, Cutcutache, I, Koressaar, T, Ye, J, Faircloth, BC, and Remm, M (2012). Primer3: new capabilities and interfaces. Nucleic Acids Res. 40, e115.
    CrossRef
  35. Um, JY, Chung, HS, Kim, MS, Na, HJ, Kwon, HJ, and Kim, JJ (2001). Molecular authentication of Panax ginseng species by RAPD analysis and PCR-RFLP. Biol Pharm Bull. 24, 872-875.
    Pubmed CrossRef
  36. Woo, SY, Lee, DS, and Kim, PG (2004). Growth and eco-physiological characteristics of Panax ginseng grown under three different forest type. J Plant Biol. 47, 230-235.
    CrossRef
  37. Yang, DC, and Kim, MS (2003). DNA analysis of ginseng using PCR-aided RFLP technology. J Ginseng Res. 27, 146-150.
    CrossRef
  38. Yu, RH, Zhao, YJ, Xu, KZ, Zhang, MS, Zhang, ZA, and Chen, ZY (2009). Diurnal changes of photosynthesis in Panax ginseng and Panax quinquefolium under different environmental conditions. J South China Agr Univ. 30, 7-11.
  39. Zhang, XY, Li, CW, Wang, LF, Wang, HM, You, GX, and Dong, YS (2002). An estimation of the minimum number of SSR alleles needed to reveal genetic relationships in wheat varieties. I. Information from large-scale planted varieties and cornerstone breeding parents in Chinese wheat improvement and production. Theor Appl Genet. 106, 112-117.


September 2018, 6 (3)
  • Science Central