search for




 

Molecular Markers for Selecting Diverse Disease Resistances in Tomato Breeding Programs
Plant Breeding and Biotechnology 2015;3:308-322
Published online November 30, 2015
© 2015 Korean Society of Breeding Science.

Je Min Lee1, Chang-Sik Oh2, and Inhwa Yeam3,4

1Department of Horticultural Science, Kyungpook National University, Daegu 41566, Korea, 2Department of Horticultural Biotechnology, College of Life Science, Kyung Hee University, Yongin 17104, Korea, 3Department of Horticulture and Breeding, Andong National University, Andong 36729, Korea, 4Institute of Agricultural Science and Technology, Andong National University, Andong 36729, Korea
Corresponding author: Inhwa Yeam, iyeam@andong.ac.kr, Tel: +82-54-820-5513, Fax: +82-54-820-5785
Received October 20, 2015; Revised November 10, 2015; Accepted November 11, 2015.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Tomato (Solanum lycopersicum L.) is an economically important crop worldwide. In addition, tomato serves as an excellent model system for plant genetics and biology, including fruit biology, abiotic stress tolerance, and plant-microbe interactions. Development and practical use of molecular markers have been actively pursued in molecular breeding programs for tomato, especially for disease resistance to allow selection of a single resistance gene and combination of multiple resistance genes. Due to insufficient genetic variation in cultivated tomatoes, various wild relatives of tomato have been investigated and utilized as disease resistance sources. In order to pursue the resistance provided by these wild relatives in developing new tomato varieties, molecular markers have been developed and intensively utilized in tomato breeding programs. In this review, we summarize the currently available molecular markers that confer resistance against major tomato diseases, including Tomato yellow leaf curl virus (TYLCV), Tomato spotted wilt virus (TSWV), Tomato mosaic virus (ToMV), verticillium wilt, fusarium wilt, late blight caused by Phytophthora infestans, leaf mold caused by Cladosporium fulvum, root-knot caused by Meloidogyne spp., bacterial spot caused by Xanthomonas spp., and bacterial speck caused by Pseudomonas syringae. The provided marker information is expected to contribute to development of marker-assisted selection for disease resistance and to exploration of novel genetic sources for a tomato breeding program.

Keywords : Disease resistance, Marker-assisted breeding, SNP, Gene-based marker, Tomato breeding
INTRODUCTION

Tomato (Solanum lycopersicum L.) is an economically important crop worldwide, and it has been estimated that 5 million hectares of tomatoes are grown annually worldwide, producing more than 160 million tons of tomatoes (Food and Agriculture Organization 2013). Tomato also serves as an excellent academic model system for plant genetics and biology, especially for studying fruit biology, abiotic stress tolerance, and plant-microbe interactions. Development and practical use of molecular markers have been actively pursued in molecular breeding programs for tomato (Martin et al. 1993; Tanksley et al. 1995). Marker-assisted selection (MAS) and marker-assisted breeding (MAB) has been widely and successfully deployed in tomato breeding programs, especially for disease resistance, which allows selection of a single resistance gene and combination of multiple resistance genes (Foolad and Sharma 2005; Arens et al. 2010).

Various technological advancements have accelerated the investigation of the whole genome and genetic loci of interest. Single nucleotide polymorphisms (SNPs) are among the most common types of genetic variation and have been widely utilized in genomics for genome mapping, phylogenetic analysis, association studies, and tagging genes of interest (Jehan and Lakhanpaul 2006; Caicedo et al. 2007). Numerous verified SNPs have been successfully used to develop tomato cultivars for public and commercial use (Yang et al. 2004; Labate and Baldo 2005). Practical DNA markers can be applied in multiple types of breeding programs such as cultivar identification, parental line selection, and selection of progenies in segregating populations (Yeam et al. 2005; Lagudah et al. 2009). The release of the tomato genome sequence has expedited characterization of SNPs, allowing SNPs to be the most effective and useful genetic markers in modern tomato breeding programs (Tomato genome consortium 2012). Use of gene-based markers, which have increased due to the emergence of high-quality genome sequence information, is clearly advantageous for increasing the accuracy of MAS compared with utilization of markers generated based on DNA polymorphisms located adjacent to the gene of interest (Salgotra et al. 2014).

Despite decades of intensive efforts in disease resistance tomato breeding programs, a large number of diseases still threaten tomato production industries. Major diseases that challenge tomato production include Tomato yellow leaf curl virus (TYLCV), Tomato spotted wilt virus (TSWV), Tomato mosaic virus (ToMV), verticillium wilt caused by Verticillium spp., fusarium wilt caused by Fusarium oxysporum, late blight caused by Phytophthora infestans, leaf mold caused by Cladosporium fulvum, root-knot caused by Meloidogyne spp., bacterial spot caused by Xanthomonas spp., and bacterial speck caused by Pseudomonas syringae. Due to the intensive breeding efforts aimed at improving economically valuable traits, cultivated tomatoes have little variation in their gene pool. Hence, various wild relatives, including S. pimpinellifolium, S. pennellii, S. habrochaites, S. peruvianum, and S. chilense, have been investigated for use as disease resistance sources (Peirce 1971; Stevens et al. 1991; Zamir et al. 1994; Diwan et al. 1999). To pursue the resistance provided by these wild relatives in developing new tomato varieties, molecular markers have been developed and utilized in tomato breeding programs. In this review, we summarize the currently available molecular markers that confer resistance against each of the indicated diseases.

Tomato yellow leaf curl virus (TYLCV) resistance

Tomato yellow leaf curl virus (TYLCV), which is transmitted by the whitefly (Bemisia tabaci), is one of the most serious threats to tomato production worldwide. In Korea, TYLCV incidence was first reported in Tong- Young, Gyoengsangnamdo in 2008 and has spread rapidly throughout the country (Lee et al. 2010). TYLCV, which is a member of the genus Begomovirus within the family Geminiviridae, is a DNA virus with a genome of approximately 2.7?2.8 kb (Cohen and Harpaz 1964; Delatte et al. 2005). Several sources of TYLCV disease resistance have been identified among wild tomato species. Two major resistance loci on chromosome 6 were originated from S. chilense: Ty1 from “LA1969” and Ty3 from “LA1932” and “LA2779” (Zamir et al. 1994; Agrama and Scott 2006; Ji et al. 2007). Recently, a gene responsible for Ty1 resistance was identified as a DFDGD-class RNA-dependent RNA polymerase and was demonstrated to be allelic with Ty3 resistance (Verlaan et al. 2013). Ty2 resistance originated from S. habrochaites “B6013” and was recently mapped to a 300-kb interval on chromosome 11 (Hanson et al. 2000; Ji et al. 2009a; Yang et al. 2014). Ty4 was identified on chromosome 3 as an additional resistance locus in Ty3-carrying S. chilense “LA1932” and “LA2779” (Ji et al. 2009b). A recessive resistance locus located on chromosome 4, termed ty5, was identified in S. peruvianum (Friedmann et al. 1998; Anbinder et al. 2009). Recently, a gene responsible for ty5 resistance has been identified as a Pelo gene, which is the messenger RNA surveillance factor Pelota implicated in the ribosome recycling phase of protein synthesis (Lapidot et al. 2015). Furthermore, Ty6 on chromosome 10 appears to be a recessive resistance gene and has been additionally identified in Ty3-carrying S. chilense “LA2779” (Scott et al. 2015).

DNA markers for these TYLCV resistance genes are listed in Table 1. Since Ty1 and Ty3 were independently identified from different tomato accessions, different DNA markers that were closely linked to Ty1 or Ty3 were used in tomato breeding programs. However, it was recently confirmed that these two are in allelic relationship at a single locus (Verlaan et al. 2013; Caro et al. 2015). Resistance spectra and levels conferred by Ty1 and Ty3 are currently under investigation. In the case of Ty2 resistance, a sequence characterized amplified regions (SCAR) marker, T0302, was used reliably for the selection. However, it was recently mapped to a 300-kb interval on chromosome 11, gene identification that would allow development of gene-based marker is in progress (Wolters et al. 2015). A gene-based derived-cleaved amplified polymorphic sequences (dCAPS) marker for ty5 (Table 1) was developed based on the information given by Lapidot et al. (2015).

Tomato spotted wilt virus (TSWV) resistance

TSWV is a negative RNA virus belonging to the genus Tospovirus within the family Bunyaviridae. TSWV is effectively transmitted by thrips, and disease symptoms include bronzing, curling, necrotic spots and streaks, and stunting of stems and leaves (German et al. 1992). The wide host range of TSWV covers several hundred species in both monocotyledons and dicotyledons worldwide (Pappu et al. 2009). Tomato chlorotic spot virus (TCSV) and groundnut ringspot virus (GRSV), which are closely related to TSWV, also cause damage in the tomato production (Brommonschenkel et al. 2000).

Sources that are resistant to Tospoviruses have been found in diverse cultivars of S. lycopersicum (Saidi 2008). Some resistance genes for TSWV have also been identified in S. habrochaites (previously L. hirsutum “PI127826” and “LA1353”) and in S. habrochaites var. glabratum (“PI134417” and “LA1223”). To date, eight TSWV resistance genes (Sw1a, Sw1b, sw2, sw3, sw4, Sw-5, Sw-6, and Sw-7) have been reported (Finlay 1953; Price et al. 2007; Saidi and Warade 2008). Among these TSWV resistance genes, Sw-5 is the one that has been intensively studied and has been actively utilized in developing TSWV-resistant tomato varieties. Sw-5 resistance was characterized in S. peruvianum on chromosome 9 (Van Zijl et al. 1985; Stevens et al. 1991) and is known to confer a broad resistance against Tospoviruses, including TSWV, TCSV, and GRSV (Boiteux and Giordano 1993). The Sw-5 protein consists of a coiled-coil (CC) domain, a nucleotide-binding adapter (NB), and a leucine-rich repeat (LRR) domain (Spassova et al. 2001). Gene-based markers for Sw-5 are listed in Table 2. Markers for Sw-5 can be chosen and applied to the breeding programs, depending on the detection method of the user’s choice.

Tomato mosaic virus (ToMV) resistance

ToMV, which belongs to the genus Tobamovirus within the family Virgaviridae, has a positive sense RNA genome. Two resistance genes, Tm-1 and Tm-2, that confer resistance against ToMV have been introgressed to cultivated tomatoes. The Tm-1 gene, which displays semi-dominant inheritance, was originally identified from S. habrochites “PI126445” (Pelham 1966; Watanabe et al. 1987). Tm-1 protein does not share any functional domain with previously known resistance (R) proteins but physically binds to and functionally inhibits the replication proteins of ToMV (Ishibashi et al. 2007). The Tm-2 resistance gene was characterized in S. peruvianum and found to confer a higher level of resistance compared to that conferred by Tm-1. The Tm-2 and the Tm-22 resistance genes are considered to be allelic (Pelham 1966; Young and Tanksley 1989), and the Tm-22 resistance gene is more durable than the Tm-2 resistance gene (Fraser 1990). Consequently, Tm-22 is both practically and economically important and thus is employed as a ToMV resistance source in tomato breeding programs. Both Tm-2 and Tm-22 encode a member of the coiled-coil/nucleotide binding-ARC/LRR protein class of plant resistance (R) genes (Lanfermeijer et al. 2003). The Tm-22 and Tm-2 open reading frames only differ by seven nucleotides, resulting in four amino acid differences at the protein level. Two of these differences are located in the nucleotide-binding site, and two are located in the LRR domain (Lanfermeijer et al. 2005). ToMV allele-specific DNA markers derived from these above mentioned gene sequences are listed in Table 3.

Verticillium wilt resistance

Tomato verticillium wilt, which is also called vascular wilt disease, is a soil-born fungal disease caused by Verticillium dahliae and V. alboatrum, which are also responsible for the vascular wilt disease in over 200 dicotyledonous species (Fradin and Thomma 2006). A single dominant gene on chromosome 9, Ve, was reported to confer effective resistance against V. alboatrum race 1 (Schaible et al. 1951; Diwan et al. 1999). The Ve locus contains two closely linked, inversely oriented genes, Ve1 and Ve2, and the resistance spectrums of these resistance genes have been determined (Kawchuk et al. 2001; Fradin et al. 2009). Ve1 resistance is conferred by the extracellular LRR receptor-like protein class of disease resistance proteins (Kawchuk et al. 2001), which appear critical for switching on effector-triggered immunity in the host plant. Various allele-specific molecular markers for Ve1 and Ve2 have been reported (Table 4; Acciarri et al. 2007; Kuklev et al. 2009; Jung et al. 2015). Among the DNA variations between the Ve1 resistance allele and the ve1 susceptibility allele, a single-bp deletion, TCA/T-A at nucleotide position 1,220, results in a premature stop codon in the ve1 susceptibility allele, which is subsequently linked with loss of function and disease resistance (Kawchuk et al. 2001; Jung et al. 2015). Therefore, the gene-based CAPS marker derived from the single-bp deletion listed in Table 4 can be considered as a functional marker for the Ve1 resistance locus.

Fusarium wilt resistance

The fungus Fusarium oxysporum causes devastating wilt diseases in many important crops, and specifically, F. oxysporum f. sp. Lycopersici (Fol) causes fusarium wilt of tomato. Three races of Fol, race 1, 2, and 3, have been identified (Bohn and Tucker 1939; Grattidge and O’Brien 1982). Resistance against Fol has been characterized in multiple wild species of tomato. The I gene was identified in the wild tomato S. pimpinellifolium accession “PI79532” and confers resistance against Fol race 1 (Bohn and Tucker 1939). The I-2 gene, which confers resistance to Fol race 2, was identified in an S. lycopersicum × S. pimpinellifolium hybrid “PI126915”, and this gene encodes a coiled coil, nucleotide-binding (CC-NB)-LRR resistance protein (Stall and Walter 1965; Simons et al. 1998). I-3 resistance to Fol race 3 was identified in S. pennellii “LA716” (Scott and Jones 1989) and encodes an S-receptor-like kinase (SRLK) protein (Lim et al. 2008; Catanzariti et al. 2015). Furthermore, the I-7 resistance gene, which confers resistance to Fol race 1, 2, and 3, was identified in S. pennellii “PI414773” and encodes typical extracellular LRR receptor-like protein (LRR-RLP) (Lim et al. 2006; Gonzalez-Cendales et al. 2015). DNA markers for these resistance genes are listed in Table 5, and most of these markers are gene-based markers.

Late blight resistance

Late blight (LB) in tomato is caused by Phytophthora infestans, which also causes devastating LB in the potato. Although LB resistance in the potato has been extensively studied and more than 60 resistance genes have been characterized and/or located on the genetic map (Rodewald and Trognitz 2013), a few race-specific LB resistance loci have been characterized in the tomato. Two race-specific resistance genes, Ph1 and Ph2, from S. pimpinellifolium were mapped to chromosome 7 and 10, respectively (Peirce 1971; Moreau et al. 1998; Foolad et al. 2008). Another resistance gene from S. pimpinellifolium “L3708”, Ph3, which is the most effective LB resistance gene among the known genetic sources, confers incomplete resistance against a wide range of P. infestans isolates (Black et al. 1996; Kim and Mutschler 2006; Zhang et al. 2013). The Ph3 gene on chromosome 9 encodes a coiled-coil nucleotide-binding (NBS)-LRR (Zhang et al. 2014). Ph4 on chromosome 2 was discovered in S. habrochaites LA1033 (Kole et al. 2006), and Ph5-1 and Ph5-2, which were discovered from a novel resistance source S. pimpinellifolium “PSLP153”, are located on chromosome 1 and 10, respectively (Merk et al. 2012; Merk and Foolad 2012). DNA markers for the major LB resistance genes, Ph2 and Ph3, are listed in Table 6. In case of Ph3, a gene-based SCAR marker was developed based on two 11 bp deletions separated by 56 bp that generate a premature stop codon in the ph3 susceptible genotype. Therefore, the gene-based SCAR marker can be considered as a functional marker for the Ph3 resistance locus. In addition to these single dominant resistance genes, quantitative trait loci (QTL) that confer resistance to LB have also been identified in S. habrochaites and S. penellii (Brouwer and St Clair 2004; Smart et al. 2007; Li et al. 2011; Cai et al. 2012).

Leaf mold resistance

Leaf mold of tomato, which is caused by the fungus Cladosporium fulvum, is a worldwide problem in greenhouse conditions, particularly in areas with high humidity and moderate temperatures (Rivas and Thomas 2005). The genes conferring resistance against C. fulvum, the Cf genes, have been introduced into commercially grown tomato cultivars (Rivas and Thomas 2005). Among the multiple Cf resistance genes that originate from wild species, Cf-2, Cf-4, Cf-4E, Cf-5, and Cf-9 genes have been most intensively studied (Jones et al. 1994; Dixon et al. 1996; Thomas et al. 1997; Dixon et al. 1998; Takken et al. 1999). The Cf genes encode membrane-anchored proteins that are largely composed of extracellular LRRs (Rivas and Thomas 2005). Although the Cf genes share a high degree of homology, each Cf gene differs in its specificity for recognizing distinct fungal effectors. The Cf genes, Cf-2, Cf-4, Cf-4E, Cf-5, and Cf-9, trigger a race-specific hypersensitive response (HR) upon plant invasion by C. fulvum that secrets the avirulence factors Avr2, Avr4, Avr4E, Avr5, and Avr9, respectively (Jones et al. 1994; Dixon et al. 1996; Thomas et al. 1997; Dixon et al. 1998; Takken et al. 1999). Both Cf-4 from S. habrochaites and Cf-9 from S. pimpinellifolium are located at the same locus on chromosome 1 in an array of five paralogs (Parniske et al. 1997). Cf-2 from S. pimpinellifolium and Cf-5 from the landrace of S. lycopersicum (formerly L. esculentum var. cerasiforme) are located in a complex locus on chromosome 6 and consist of seven Cf-2/Cf-5 gene family homologs, which vary in LRR copy number from 25 to 38 (Dixon et al. 1998). A DNA marker for Cf-9 resistance gene is listed in Table 7. Although the genes that encode Cf-2, Cf-4, Cf-4E, Cf-5, and Cf-9 have been cloned and characterized decades ago, precise MAS in differentiating each Cf gene has been plagued by technical difficulties, due to the existence of the gene families and complex chimeric sequences.

Root-knot nematode (RKN) resistance

RKNs of the genus Meloidogyne cause major economic damage to crops around the world (Williamson and Hussey 1996). These nematodes penetrate the roots and migrate to the vascular cylinder, resulting in the formation of root-knots, which affect nutrient partitioning and water uptake in the plant (Roberts and May 1986). A single, dominant gene, Mi-1, which originated in S. peruvianum “PI128657”, was introgressed into modern tomato varieties (Castagnone-Sereno et al. 1994). Mi-1 encodes a CC-NBS-LRR with a nucleotide-binding site and a LRR region and confers resistance to three of the most damaging species of RKN: M. incognita, M. arenaria, and M. javanica. Moreover, this gene also confers resistance to potato aphid and whitefly (Milligan et al. 1998; Rossi et al. 1998; Vos et al. 1998). The Mi-1 locus consists of two clusters with three and four copies of Mi gene homologs (Seah et al. 2007). Mi-1.2, but not the other homologs, has been suggested to be a functional resistance gene (Milligan et al. 1998). Other genetic determinants of RKN resistance that have been identified in S. peruvianum accessions include major/minor QTLs: Mi-4 linked with Mi-1 on chromosome 6, Mi-3 and Mi-5 on chromosome 12, Mi-9 on chromosome 6, Mi-2 linked to Mi-8, and Mi-6 linked to Mi-7 (Veremis et al. 2000; Ammiraju et al. 2003). The practical use of these resistance loci, however, has not yet been investigated thoroughly. Allele specific markers for Mi-1 resistance are listed in Table 8.

Bacterial spot resistance

Bacterial spot of tomato, which is caused by a gram-negative bacterium Xanthomonas campestris pv. vesicatoria (Xcv), is one of the most destructive diseases both in the greenhouse and in the field, particularly in warm and humid environments (Jones et al. 1998). Recently, Xcv has been re-classified and divided into four distinct species (X. euvesicatoria, X. vesicatoria, X. gardneri, and X. perforans), which differ in their distribution, metabolic properties, and effector repertoires (Potnis et al. 2011). Five races (T1 to T5) of Xcv are recognized by different host genotypes. Xcv, which causes bacterial spot disease in both pepper and tomato, has been extensively studied. Effector-triggered immunity conferred by single dominant loci, including Xv3 and Xv4 (also known as RXopJ4), are mechanisms of HR resistance. Xv3 found in S. lycopersicum “H7981” and S. pimpinellifolium (accessions “PI126932” and “PI128216”) triggers HR resistance to T3 strains via recognition of the effector avrXv3 (Wang et al. 2011). A single locus Rx-4 on chromosome 11 (accession “PI128216”) also confers HR resistance to T3 strains; however, the degree of resistance is significantly affected by the genetic background (Robbins et al. 2009). Studies on Xv3 and Rx-4 indicated that these two genes are closely linked genes that react to the same bacterial effector or alleles of the same locus (Wang et al. 2011). Xv4 (RXopJ4) on chromosome 3 is a dominant resistance locus that originated from S. pennellii “LA716”, and Xv4 recognizes the Xcv effector XopJ4 of T4 strains (Astua-Monge et al. 2000). Rx-1 (chromosome 1), Rx-2 (chromosome 1), and Rx-3 (chromosome 5) that are responsible for HR-inducing resistance against Xcv T1 strains were identified in S. lycopersicum (accession “H7998”; Scott and Jones 1989); however, only Rx-3 appears to be effective in conferring field resistance. Bs4 on chromosome 5, which encodes a NB-LRR protein, recognizes the Xcv effector AvrBs4 (Schornack et al. 2004). A number of DNA markers for each Xcv resistance gene are summarized in Table 9. QTL that contribute Xcv resistance have been identified in S. lycopersicum “PI114490” (Hutton et al. 2010). In addition, the Bs2 resistance gene identified in a pepper species is very effective against bacterial spot in transgenic tomato plants (Tai et al. 1999).

Bacterial speck resistance

Bacterial speck disease in tomato is caused by Pseudomonas syringae pv. tomato. The resistance gene, Pto, which is a member of a small gene family encoding cytoplasmic serine/threonine protein kinases, is the first disease resistance gene characterized in plants (Martin et al. 1993). The molecular mechanisms of Pto resistance have been intensively studied. Indeed, the Pto kinase recognizes and physically interacts with the bacterial effectors AvrPto and AvrPtoB (Tang et al. 1996; Shan et al. 2000; Kim et al. 2002). Prf, an NBS?LRR gene located within a cluster of five Pto homologs, is also required for resistance to P. syringae pv. tomato (Salmeron et al. 1996). Among the five Pto homologs that are tightly clustered and exhibit different functions, PtoE is the gene responsible for conferring resistance to bacterial speck in tomato (Kim et al. 2002; Abramovitch et al. 2006). A gene-based CAPS marker for Pto resistance is summarized in Table 10. A recent study revealed that several QTLs in S. habrochites “LA1777” are involved in bacterial speck resistance; bsRr1-1 on chromosome 1, bsRr1-2 on chromosome 2, bsRr1-12a and bsRr1-12b on chromosome 12 (Thapa et al. 2015).

CONCLUSIONS

Due to the economic and academic importance of tomato, the genetics and molecular mechanisms of disease resistance to a variety of diseases have been intensively investigated, and the results have contributed to MAS in tomato breeding programs. In addition, extensive use of wild relatives of tomato rather than cultivated tomatoes as resistance sources required the use of molecular markers in order to track the resistance provided by these wild relatives and transfer such resistance to developing new tomato varieties. In this review, we summarized the currently available molecular markers that confer resistance to the major tomato diseases, including TYLCV, TSWV, ToMV, verticillium wilt, fusarium wilt, late blight, leaf mold, root-knot disease, bacterial spot, and bacterial speck. The provided marker information is expected to contribute to advancing MAS for disease resistance and to exploration of novel genetic sources for tomato breeding programs.

Tables

DNA markers for selecting resistant tomatoes against TYLCV.

Resistant locus (chromosome)Marker informationReferences
Ty1/3 (ch 6)F: ATGAAGACAAAAACTGCTTC
R: TCAGGGTTTCACTTCTATGAAT (SspI, BglII, or TaqI)
CAPS (gene-based)Jung et al. 2015
Ty1 (ch 6)TAA TCC GTC GTT ACC TCT CCT
CGGATGACTTCAATAGCAATGA3′ (TaqI)
CAPS (closely linked)Hoogstraten et al. 2005
Ty3 (ch 6)P6-25
F: GGTAGTGGAAATGATGCTGCTC
R: GCTCTGCCTATTGTCCCATATATAACC
SCAR (closely linked)Ji et al. 2007
Ty2 (ch 11)T0302
F: TGG CTC ATC CTG AAG CTG ATA GCG C
R: AGT GTA CAT CCT TGC CAT TGA CT
SCARYang et al. 2014
Ty4 (ch 3)C2_At4g17300 (AflI)
F: ATTTAACCGTGTCTGGGCAACTCAATGG
R: GCTCACTTTGCAAATCACATCCCCATTTCACC
C2_At5g60160 (NlaIII)
F: TTCTCGCGGCCTTTTCTCCTC
R: TCGTGATCGCAAACATATACTCGC
CAPSJi et al. 2009
ty5 (ch 4)F: TTCAAGTCCTTCTTCAAC
R: ATAGATTTAAACAACAATTATAGAGATAAAAAAGTTACCTGT (RsaI)
dCAPS (gene-based)Lapidot et al. 2015; In this study

DNA markers for a TSWV resistance gene Sw5 on chromosome 9.

Resistant locusMarker informationReferences
Sw5Sw5-2
F: AATTAGGTTCTTGAAGCCCATCT
R: TTCCGCATCAGCCAATAGTGT
SCAR (gene-based)Dianese et al. 2010
Sw5b
F: CGGAACCTGTAACTTGACTG
R: GAGCTCTCATCCATTTTCCG
SCAR (gene-based)Shi et al. 2011
Sw5b-SNP1
F: GAGAGAGTTATTACAAGAT
R: TTTCTCCTCAACATGTCGGC
SNPShi et al. 2011
Sw5b-SNP2
F: GGTATGGGATGACTTAAGGC
R: ACCCACTTCTTCAAGTCGAG
SNPShi et al. 2011
Sw5b-SNP
F: TTATTGTTTCTCGCTTTGATGTTCG
R: GAACCTGTAACTTGACTGAAAATATC
HRM* (gene-based)Lee et al. In press

HRM: high-resolution melting analysis used for SNP detection.


DNA markers for selecting ToMV resistance genes, Tm1 and Tm22.

Resistant locusMarker informationReferences
Tm1CCACTGTATGATTTCTGCTAGTGAA
AGCTTTAACAAATATAAGAATAAAGAC
GCAAGCTAAGGTTTACATATATGCC
SCAR (gene-based)Ishibashi et al. 2007
Tm22F: GAGTTCTTCCGTTCAAATCCTAAGCTTGAGAAG
R: CTACTACACTCACGTTGCTGTGATGCAC
CAPS (gene-based)Lanfermeijer et al. 2003
Lanfermeijer et al. 2005
SCN131000 (AccI)
F: AGCGTCACTCCATACTTGGAATAA
R: AGCGTCACTCAAAATGTACCCAAA
CAPS (linked marker)Sobir et al. 2000

DNA markers for selecting verticilium wilt resistance gene Ve on chromosome 9.

Resistant locusMarker informationReferences
VeF: CCATGAACAGATGTGACTTGTGTG
VeR1:AAGTTTCTTATTTTTCCTTCTCC
veR2:CTCTTAGGATTTTTGACGTGATA
SCAR (linked marker, 0.6 cM)Kawchuk et al. 1998
F: CGAACTTGAC TACATTGACC CTG
R: CAGTCTTGAAAGGTTGCTCAGCC (XbaI)
CAPS (gene-based)Jung et al. 2015

DNA markers for selecting resistant tomatoes against Fusarium wilt.

Resistant locus (chromosome)Marker informationReferences
I1 (ch 11)At2
F: CGAATCTGTATATTACATCCGTCGT
R: GGTGAATACCGATCATAGTCGAG
SCARArens et al. 2010
I2 (ch 11)Z1063
F: ATTTGAAAGCGTGGTATTGC
R: CTTAAACTCACCATTAAATC
SCARArens et al. 2010
I3 (ch 7)P7-43DF1/R1
F: GGTAAAGAGATGCGATGATTATGTGGAG
R: GTCTTTACCACAGGAACTTTATCACC
SCARBarillas et al. 2008
I7 (ch 8)Solyc08g077740 (AgeI)
F: AAGAAGTTCCCTTCTTCCCTTA
R: GGAATAACCAAGGGGGTGTT
CAPS (gene-based)Gonzalez-Cendales et al. 2015

DNA markers for selecting late blight resistance genes Ph2 and Ph3.

Resistant locus (chromosome)Marker informationReferences
Ph2 (ch 10)dTG63 (HinfI)
F: CTACTCTTTCTATGCAATTTGAATTG
R: AATAATTTTCAACCATAGAATGATT
CAPSPanthee et al. 2012
Ph3 (ch 9)F: TCG ATC GTA TGT AGA CGA TG
R: AGG CAA ATC TTG AAG AAG CA (MspI)
CAPS (gene-based)Jung et al. 2015
F: CTACTCGTGCAAGAAGGTAC
R: TCCACATCACCTGCCAGTTG
SCAR (gene-based)Jung et al. 2015

DNA markers for selecting leaf mold resistance gene Cf-9 on chromosome 1.

Resistant locusMarker informationReferences
Cf-9F: TGGGAATTTACCCGAAAGAA
R: CCCAATCATTCAGTGCGTTA
SCAR (gene-based)Truong et al. 2011

Allele specific markers at the root-knot nematodes resistance locus Mi-1.

Resistant allelesMarker informationReferences
Mi 1 (Rex)F: AACCGTGGACTTTGCTTTGACT
R: TAAGAACAGGGACTCAGAGGATGA (TaqI)
CAPS (closely linked)Hoogstraten et al. 2005
Mi-JF: CTACGGAGGATGCAAATAGAA
R: AATCATTATTGTCACACTTCCCC (NtIII)
CAPS (gene-based)Hoogstraten et al. 2005
Mi-1.2F: TGG AAA AAT GTT GAA TTT CTT TTG
R: GCA TAC TAT ATG GCT TGT TTA CCC
SCAR (gene-based)Seah et al. 2007

DNA markers for selecting bacterial spot disease resistant tomatoes.

Resistant locus (chromosome)Marker informationReferences
Rx-3 (ch 5)Rx3-L1 (BsrBI)
F: CTCCGAGCGAAGAGTCTAGAGTC
R: GAAGGCAAAAGGAAAAGGAGAAGGATGG
CAPSYang et al. 2005
Rx-4 (ch 11)pcc12 (6 bp InDel)
F: TCCACATCAAATGCGTTTCT
R: TTCCAATCCTTTCCATTTCG
InDel (0.07 cM)Pei et al. 2012
Xv3 (ch 11)cLEC-24-C3 (restriction enzyme not indicated)
F: CAGACTGGAGAGTCAAAGGT
R: CCTTGCTGATAATCTGCAAGTTGTTAA
CAPSWang et al. 2011
SL10027
F: GATCCAGTTTCCCTCTTACCG
R: CCATTAGAGCCAAGACGCTC
ASPE*Wang et al. 2011
Bs4 (ch 5)Bs4-A02/B02 (MspI)
F: CTACCATCATCTCTTCAGTACCAACTC
R: GAAATTGGAGGAACCGAGCTCCAG
CAPS (gene-based)Schornack et al. 2004
Bs4-A03/B03 (RsaI)
F: GGGTTGGAGTCCGAAGAGCAGG
R: GACTAACCAACGCAAGTTATTGGACAGG
CAPS (gene-based)Schornack et al. 2004
Xv4=RXopJ4 (ch 3)J350 (HinfI)
F: CTGCTGGAATTGTAATTATTCACG
R: TTGAGCATAAACAGTCCAAAACAT
CAPSSharlach et al. 2013
QTL (ch 11)F: CCTCCAAATCCCAAAACTCT
R: TGTTTCATCCACTATCACGA
SSRHutton et al. 2010

*ASPE: allele specific primer extension.


DNA markers for selecting resistant tomatoes against bacterial speck disease.

Resistant locusMarker informationReferences
PtoF: ATCTACCCACAATGAGCATGAGCTC
R: GTGCATACTCCAGTTTCCAC (RsaI)
CAPS (gene-based)Yang and Francis 2005; Martin et al. 1993

References
  1. Abramovitch, RB, Anderson, JC, and Martin, GB (2006). Bacterial elicitation and evasion of plant innate immunity. Nat Rev Mol Cell Biol. 7, 601-611.
    Pubmed KoreaMed CrossRef
  2. Agrama, HA, and Scott, JW (2006). Quantitative trait loci for Tomato yellow leaf curl virus and Tomato mottle virus resistance in tomato. J Am Hortic Sci. 131, 267-272.
  3. Ammiraju, JS, Veremis, JC, Huang, X, Roberts, PA, and Kaloshian, I (2003). The heat-stable root-knot nematode resistance gene Mi-9 from Lycopersicon peruvianum is localized on the short arm of chromosome 6. Theor Appl Genet. 106, 478-84.
    Pubmed
  4. Anbinder, I, Reuveni, M, Azari, R, Paran, I, Nahon, S, Shlomo, H, Chen, L, Lapidot, M, and Levin, I (2009). Molecular dissection of Tomato leaf curl virus resistance in tomato line TY172 derived from Solanum peruvianum. Theor Appl Genet. 119, 519-530.
    Pubmed CrossRef
  5. Arens, P, Mansilla, C, Deinum, D, Cavellini, L, Moretti, A, Rolland, S, van der Schoot, H, Calvache, D, Ponz, F, Collonnier, C, Mathis, R, Smilde, D, Caranta, C, and Vosman, B (2010). Development and evaluation of robust molecular markers linked to disease resistance in tomato for distinctness, uniformity and stability testing. Theor Appl Genet. 120, 655-664.
    KoreaMed CrossRef
  6. Astua-Monge, G, Minsavage, GV, Stall, RE, Vallejos, CE, Davis, MJ, and Jones, JB (2000). Xv4-vrxv4: a new gene-for-gene interaction identified between Xanthomonas campestris pv. vesicatoria race T3 and wild tomato relative Lycoper-sicon pennellii. Mol Plant Microbe Interact. 13, 1346-1355.
    Pubmed CrossRef
  7. Barbary, A, Djian-Caporalino, C, Palloix, A, and Castagnone-Sereno, P (2015). Host genetic resistance to root-knot nematodes, Meloidogyne spp., in Solanaceae: from genes to the field. Pest Manag Sci. , .
    Pubmed CrossRef
  8. Barillas, AC, Mejia, L, Sanchez-Perez, A, and Maxwwell, DP (2008). CAPS and SCAR markers for detection of I-3 gene introgression for resistance to Fusarium oxysporum f. sp. lycopersici race 3. Rep Tomato Genet Coop. , 11-17.
  9. Black, LL, Wang, TC, Hanson, PM, and Chen, JT (1996). Late blight resistance in four wild tomato accessions: effectiveness in diverse locations and inheritance of resistance. Phytopathology. 86, S24.
  10. Bohn, G, and Tucker, C (1939). Immunity to Fusarium wilt in the tomato. Science. 89, 603-604.
    Pubmed CrossRef
  11. Boiteux, L, and Giordano, LdB (1993). Genetic basis of resistance against two Tospovirus species in tomato (Lycopersicon esculentum). Euphytica. 71, 151-154.
    CrossRef
  12. Brommonschenkel, SH, Frary, A, Frary, A, and Tanksley, SD (2000). The broad-spectrum tospovirus resistance gene Sw-5 of tomato is a homolog of the root-knot nematode resistance gene Mi. Mol Plant-Microbe Interact. 13, 1130-1138.
    Pubmed CrossRef
  13. Brouwer, DJ, and St Clair, DA (2004). Fine mapping of three quantitative trait loci for late blight resistance in tomato using near isogenic lines (NILs) and sub NILs. Theor Appl Genet. 108, 628-638.
    CrossRef
  14. Cai, G, Restrepo, S, Myers, K, Zuluaga, P, Danies, G, Smart, C, and Fry, W (2013). Gene profiling in partially resistant and susceptible near-isogenic tomatoes in response to late blight in the field. Mol Plant Pathol. 14, 171-184.
    CrossRef
  15. Caicedo, AL, Williamson, SH, and Hernandez, RD (2007). Genome- wide patterns of nucleotide polymorphism in domesticated rice. Plos Genet. 3, 1745-1756.
    Pubmed KoreaMed CrossRef
  16. Caro, M, Verlaan, MG, Juli?n, O, Finkers, R, Wolters, AM, Hutton, SF, Scott, JW, Kormelink, R, Visser, RG, D?ez, MJ, P?rez-de-Castro, A, and Bai, Y (2015). Assessing the genetic variation of Ty-1 and Ty-3 alleles conferring resistance to tomato yellow leaf curl virus in a broad tomato germplasm. Mol Breed. 35, 132.
    KoreaMed CrossRef
  17. Castagnone-Sereno, P, Wajnberg, E, Bongiovanni, M, Leroy, F, and Dalmasso, A (1994). Genetic variation in Meloidogyne incognita virulence against the tomato Mi resistance gene: evidence from isofemale line selection studies. Theor Appl Genet. 88, 749-753.
    Pubmed CrossRef
  18. Catanzariti, AM, Lim, GT, and Jones, DA (2015). The tomato I-3 gene: a novel gene for resistance to Fusarium wilt disease. New Phytol. 207, 106-118.
    Pubmed CrossRef
  19. Cohen, S, and Harpaz, I (1964). Periodic, rather than continual acquisition of a new tomato virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius). Entomol Exp Appl. 7, 155-166.
    CrossRef
  20. Delatte, H, Martin, DP, Naze, F, Golbach, RW, Reynaud, B, eterschmitt, M, and Lett, JM (2005). South West Indian Ocean islands tomato begomovirus populations represent a new major monopartite begomovirus group. J Gen Virol. 86, 1533-1542.
    Pubmed CrossRef
  21. Diwan, N, Fluhr, R, Eshed, Y, Zamir, D, and Tanksley, SD (1999). Mapping of Ve in tomato: a gene conferring resistance to the broadspectrum pathogen, Verticillium dahliae race 1. Theor Appl Genet. 98, 315-319.
    CrossRef
  22. Dixon, MS, Jones, DA, Keddie, JS, Thomas, CM, Harrison, K, and Jones, JDG (1996). The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins. Cell. 84, 451-459.
    Pubmed CrossRef
  23. Dixon, MS, Hatzixanthis, K, Jones, DA, Harrison, K, and Jones, JDG (1998). The tomato Cf-5 disease resistance gene and six homologs show pronounced allelic variation in leucine-rich repeat copy number. Plant Cell. 10, 1915-1925.
    Pubmed KoreaMed CrossRef
  24. Finlay, K (1953). Inheritance of spotted wilt resistance in the tomato II. Five genes controlling spotted wilt resistance in four tomato types. Aust J Biol Sci. 6, 153-163.
    Pubmed
  25. Foolad, MR, Merk, HL, and Ashrafi, H (2008). Genetics, genomics and breeding of late blight and early blight resistance in tomato. Crit Rev Plant Sci. 27, 75-107.
    CrossRef
  26. Foolad, MR, and Panthee, DR (2012). Marker-assisted selection in tomato breeding. Crit Rev Plant Sci. 31, 93-123.
    CrossRef
  27. Foolad, MR, and Sharma, A (2005). Molecular markers as selection tools in tomato breeding. Acta Hort. 695, 225-240.
    CrossRef
  28. Fradin, EF, and Thomma, BPHJ (2006). Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol Plant Pathol. 7, 71-86.
    Pubmed CrossRef
  29. Fradin, EF, Zhang, Z, Juarez Ayala, JC, Castroverde, CD, Nazar, RN, Robb, J, Liu, CM, and Thomma, BP (2009). Genetic dissection of Verticillium wilt resistance mediated by tomato Ve1. Plant Physiol. 150, 320-332.
    Pubmed KoreaMed CrossRef
  30. Fraser, RSS (1990). The genetics of resistance to plant viruses. Annu Rev Phytopathol. 28, 179-200.
    CrossRef
  31. Friedmann, M, Lapidot, M, Cohen, S, and Pilowsky, M (1998). A novel source of resistance to Tomato yellow leaf curl virus exhibiting a symptomless reaction to viral infection. J Am Soc Hortic Sci. 123, 1004-1007.
  32. Gonzalez-Cendales, Y, Catanzariti, AM, Baker, B, Mcgrath, DJ, and Jones, DA (2015). Identification of I-7 expands the repertoire of genes for resistance to Fusarium wilt in tomato to three resistance gene classes. Mol Plant Pathol. , .
    Pubmed CrossRef
  33. German, TL, Ullman, DE, and Moyer, JW (1992). Tospoviruses: diagnosis, molecular biology, phylogeny, and vector relationships. Annu Rev Phytopathol. 30, 315-348.
    Pubmed CrossRef
  34. Grattidge, R, and O’Brien, RG (1982). Occurrence of a third race of Fusarium wilt of tomatoes in Queensland. Plant Dis. 66, 165-166.
    CrossRef
  35. Hanson, PM, Bernacchi, D, Green, S, Tanksley, SD, Muniyappa, V, Padmaja, VM, Padmaja, AS, Chen, H, Kuo, G, Fang, D, and Chen, J (2000). Mapping a Wild Tomato Introgression Associated with Tomato Yellow Leaf Curl Virus Resistance in a Cultivated Tomato Line. J Amer Soc Hort Sci. 125, 15-20.
  36. Hutton, SF, Scott, JW, Yang, W, Sim, SC, Francis, DM, and Jones, JB (2010). Identification of QTL associated with resistance to bacterial spot race T4 in tomato. Theor Appl Genet. 121, 1275-1287.
  37. Ishibashi, K, Masuda, K, Naito, S, Meshi, T, and Ishikawa, M (2007). An inhibitor of viral RNA replication is encoded by a plant resistance gene. Proc Natl Acad Sci USA. 104, 13833-13838.
    Pubmed CrossRef
  38. Jehan, T, and Lakhanpaul, S (2006). Single nucleotide polymorphism (SNP)-Methods and applications in plant genetics: A review. Indian J Biotech. 5, 435-459.
    Pubmed KoreaMed CrossRef
  39. Ji, Y, Schuster, DJ, and Scott, JW (2007). Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Mol Breed. 20, 271-284.
  40. Ji, Y, Scott, JW, and Schuster, DJ (2009a). Toward fine mapping of the Tomato yellow leaf curl virus resistance gene Ty-2 on chromosome 11 of tomato. HortScience. 44, 614-618.
    CrossRef
  41. Ji, Y, Scott, JW, Schuster, DJ, and Maxwell, DP (2009b). Molecular mapping of Ty-4, a new Tomato yellow leaf curl virus resistance locus on chromosome 3 of tomato. J Amer Soc Hort Sci. 134, 281-288.
  42. Jones, JB, Stall, RE, and Bouzar, H (1998). Diversity among xanthomonads pathogenic on pepper and tomato. Annu Rev Phytopathol. 36, 41-58.
  43. Jones, DA, Thomas, CM, Hammond-Kosack, KE, Balint-Kurti, PJ, and Jones, JDG (1994). Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science. 266, 789-793.
    CrossRef
  44. Jung, J, Kim, HJ, Lee, JM, Oh, CS, Lee, HJ, and Yeam, I (2015). Gene-based molecular marker system for multiple disease resistances in tomato against Tomato yellow leaf curl virus, late blight, and verticillium wilt. Euphytica. 205, 599-613.
    Pubmed CrossRef
  45. Kawchuk, LM, Hachey, J, Lynch, DR, Kulcsar, F, van Rooijen, G, Waterer, DR, Robertson, A, Kokko, E, Byers, R, Howard, RJ, Fischer, R, and Prufer, D (2001). Tomato Ve disease resistance genes encode cell surface-like receptors. Proc Natl Acad Sci USA. 98, 6511-6515.
    CrossRef
  46. Kim, MJ, and Mutschler, MA (2006). Characterization of late blight resistance derived from Solanum pimpinellifolium L3708 against multiple isolates of the pathogen Phytophthora infestans. J Amer Soc Hort Sci. 131, 637-645.
    Pubmed KoreaMed CrossRef
  47. Kim, YJ, Lin, NC, and Martin, GB (2002). Two distinct Pseudomonas effector proteins interact with the Pto kinase and activate plant immunity. Cell. 109, 589-598.
  48. Kole, C, Ashrafi, H, Lin, G, and Foolad, M 2006. Identification and molecular mapping of a new R gene, Ph-4, conferring resistance to late blight in tomato., Solanaceae Conference, University of Wisconsin, Madison, Abstract 449.
    Pubmed CrossRef
  49. Labate, JA, and Baldo, AM (2005). Tomato SNP discovery by EST mining and resequencing. Mol Breed. 16, 343-349.
  50. Lagudah, ES, Krattinger, SG, Herrera-Foesse, S, Singh, RP, Huerta-Espino, J, Spielmeyer, W, Brown-Guedira, G, Selter, LL, and Keller, B (2009). Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet. 119, 889-898.
    CrossRef
  51. Lanfermeijer, FC, Dijkhuis, J, Sturre, MJ, de Haan, P, and Hille, J (2003). Cloning and characterization of the durable tomato mosaic virus resistance gene Tm-2(2) from Lycopersicon esculentum. Plant Mol Biol. 52, 1037-1049.
    Pubmed CrossRef
  52. Lanfermeijer, FC, Warmink, J, and Hille, J (2005). The products of the broken Tm-2 and the durable Tm-2(2) resistance genes from tomato differ in four amino acids. J Exp Bot. 56, 2925-2933.
    Pubmed CrossRef
  53. Lapidot, M, Karniel, U, Gelbart, D, Fogel, D, Evenor, D, Kutsher, Y, Makhbash, Z, Nahon, S, Shlomo, H, Chen, L, Reuveni, M, and Levin, I (2015). A novel route controlling Begomovirus resistance by the messenger RNA surveillance factor Pelota. PLoS Genet. 11, e1005538.
    Pubmed CrossRef
  54. Lee, H, Song, W, Kwak, HR, Kim, J, Park, J, Auh, CK, Kim, DH, Lee, K, Lee, S, and Choi, HS (2010). Phylogenetic analysis and inflow route of Tomato yellow leaf curl virus (TYLCV) and Bemisia tabaci in Korea. Mol Cells. 30, 467-476.
    Pubmed KoreaMed CrossRef
  55. Lee, HJ, Kim, BY, Bae, C, Kang, WH, Kang, BC, Yeam, I, and Oh, CS (). Development of a single-nucleotide polymorphism marker in the Sw-5b gene conferring disease resistance to Tomato spotted wilt virus in tomato. Kor J Hort Sci Technol. , .
    Pubmed CrossRef
  56. Li, J, Liu, L, Bai, Y, Finkers, R, Wang, F, Du, Y, Yang, Y, Xie, B, Visser, RGF, and van Heusden, AW (2011). Identification and mapping of quantitative resistance to late blight (Phytophthora infestans) in Solanum habrochaites LA1777. Euphytica. 179, 427-437.
  57. Lim, GTT, Wang, GP, Hemming, MN, Basuki, S, McGrath, DJ, Carroll, BJ, and Jones, DA (2006). Mapping the I-3 gene for resistance to Fusarium wilt in tomato: application of an I-3 marker in tomato improvement and progress towards the cloning of I-3. Australas Plant Pathol. 35, 671-680.
    CrossRef
  58. Lim, GTT, Wang, GP, Hemming, MN, McGrath, DJ, and Jones, DA (2008). High resolution genetic and physical mapping of the I-3 region of tomato chromosome 7 reveals almost continuous microsynteny with grape chromosome 12 but interspersed microsynteny with duplications on Arabidopsis chromosomes 1, 2?3. Theor Appl Genet. 118, 57-75.
    CrossRef
  59. Martin, GB, Brommonschenkel, SH, Chunwongse, J, Frary, A, Ganal, MW, Spivey, R, Wu, T, Earle, ED, and Tanksley, SD (1993). Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science. 262, 1432-1436.
    Pubmed CrossRef
  60. Merk, HL, Ashrafi, H, and Foolad, MR (2012). Selective genotyping to identify late blight resistance genes in an accession of the tomato wild species Solanum pimpinellifolium. Euphytica. 187, 63-75.
    Pubmed CrossRef
  61. Merk, HL, and Foolad, MR (2012). Parent-offspring correlation estimate of heritability for late blight resistance conferred by an accession of the tomato wild species Solanum pimpinellifolium. Plant Breeding. 131, 203-210.
    CrossRef
  62. Milligan, SB, Bodeau, J, Yaghoobi, J, Kaloshian, I, Zabel, P, and Williamson, VM (1998). The root knot nematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell. 10, 1307-1319.
    CrossRef
  63. Minsavage, GV, Dahlbeck, D, Whalen, MC, Kearney, B, Bonas, U, Staskawicz, BJ, and Stall, RE (1990). Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv vesicatoria-pepper interactions. Mol Plant-Microbe Interact. 3, 41-47.
    Pubmed KoreaMed CrossRef
  64. Minsavage, GV, Jones, JB, and Stall, RE (1996). Cloning and sequencing of an avirulence gene (avrXv3) isolated from Xanthomonas campestris pv. vesicatoria tomato race 3. (Abstr). Phytopathology. 86, S15.
    CrossRef
  65. Moreau, P, Thoquet, P, Olivier, J, Laterrot, H, and Grimsley, N (1998). Genetic mapping of Ph-2, a single locus controlling partial resistance to Phytophthora infestans in tomato. Mol Plant-Microbe Interact. 11, 259-269.
  66. Panthee, DR, and Foolad, MR (2012). A reexamination of molecular markers for use in marker-assisted breeding in tomato. Euphytica. 184, 165-179.
    CrossRef
  67. Pappu, HR, Jones, RAC, and Jain, RK (2009). Global status of tospovirus epidemics in diverse cropping systems: successes achieved and challenges ahead. Virus Res. 141, 219-236.
    CrossRef
  68. Parniske, M, Hammond-Kosack, KE, Golstein, C, Thomas, CM, Jones, DA, Harrison, K, Wulff, BB, and Jones, JD (1997). Novel disease resistance specificities result from sequence exchange between tandemly repeated genes at the Cf-4/9 locus of tomato. Cell. 91, 821-832.
    Pubmed CrossRef
  69. Pei, C, Wang, H, Zhang, J, Wang, Y, Francis, DM, and Yang, W (2012). Fine mapping and analysis of a candidate gene in tomato accession PI128216 conferring hypersensitive resistance to bacterial spot race T3. Theor Appl Genet. 124, 533-542.
    Pubmed CrossRef
  70. Peirce, LC (1971). Linkage tests with Ph conditioning resistance to race 0, Phytophthora infestans. Tomato Genet Coop Rep. 21, 30.
    CrossRef
  71. Pelham, J (1966). Resistance in tomato to Tobacco mosaic virus. Euphytica. 15, 258-267.
  72. Potnis, N, Krasileva, K, Chow, V, Almeida, NF, Patil, PB, Ryan, RP, Sharlach, M, Behlau, F, Dow, JM, Momol, M, White, FF, Preston, JF, Vinatzer, BA, Koebnik, R, Setubal, JC, Norman, DJ, Staskawicz, BJ, and Jones, JB (2011). Comparative genomics reveals diversity among xanthomonads infecting tomato and pepper. BMC Genomics. 12, 146.
    CrossRef
  73. Price, DL, Memmott, FD, Scott, JW, Olson, SM, and Stevens, MR (2007). Identification of molecular markers linked to a new Tomato spotted wilt virus resistance source in tomato. Tomato Genet Coop. 57, 35-36.
    Pubmed KoreaMed CrossRef
  74. Rivas, S, and Thomas, CM (2005). Molecular interactions between tomato and the leaf mold pathogen Cladosporium fulvum. Ann Rev Phytopathol. 43, 395-436.
  75. Robbins, MD, Darrigues, A, Sim, SC, Masud, MA, and Francis, DM (2009). Characterization of hypersensitive resistance to bacterial spot race T3 (Xanthomonas perforans) from tomato accession PI 128216. Phytopathology. 99, 1037-1044.
    CrossRef
  76. Roberts, PA, and May, D (1986). Meloidogyne incognita resistance characteristics in tomato genotypes developed for processing. J Nematol. 18, 353-358.
    Pubmed CrossRef
  77. Rossi, M, Goggin, FL, Milligan, SB, Kaloshian, I, Ullman, DE, and Williamson, VM (1998). The nematode resistance gene Mi of tomato confers resistance against the potato aphid. Proc Natl Acad Sci USA. 95, 9750-9754.
    Pubmed KoreaMed
  78. Saidi, M, and Warade, SD (2008). Tomato breeding for resistance to Tomato spotted wilt virus (TSWV): an overview of conventional and molecular approaches. Czech J Genet Plant Breed. 44, 83-92.
    Pubmed KoreaMed CrossRef
  79. Salgotra, RK, Gupta, BB, and Stewart, CN (2014). From genomics to functional markers in the era of next-generation sequencing. Biotechnol Lett. 36, 417-426.
  80. Salmeron, JM, Oldroyd, JED, Rommens, CMT, Scofield, SR, Kim, HS, Lavelle, DT, Dahlbeck, D, and Staskawicz, BJ (1996). Tomato Prf is a member of the leucine-rich repeat class of plant disease resistance genes and lies embedded within the Pto kinase gene cluster. Cell. 86, 123-133.
    CrossRef
  81. Schaible, L, Cannon, OS, and Waddoups, B (1951). Inheritance of resistance to Verticillium wilt in a tomato cross. Phytopathol. 41, 986-990.
    Pubmed CrossRef
  82. Schornack, S, Ballvora, A, G?rlebeck, D, Peart, J, Baulcombe, D, Ganal, M, Baker, B, Bonas, U, and Lahaye, T (2004). The tomato resistance protein Bs4 is a predicted non-nuclear TIR-NB-LRR protein that mediates defense responses to severely truncated derivatives of AvrBs4 and overexpressed AvrBs3. Plant J. 37, 46-60.
  83. Scott, JW, and Jones, JB (1989). Inheritance of resistance to foliar bacterial spot of tomato incited by Xanthomonas campestris pv. vesicatoria. J Am Soc Hortic Sci. 114, 111-114.
    CrossRef
  84. Scott, JW, Jones, JB, and Somodi, GC (1995). Screening tomato accessions for resistance to Xanthomonas campestris pv. vesicatoria, race T3. HortScience. 30, 579-581.
  85. Scott, JW, and Jones, JP (1989). Monogenic resistance in tomato to Fusarium oxysporum f. sp. lycopersici race 3. Euphytica. 40, 49-53.
  86. Scott, JW, Hutton, SF, and Freeman, JH (2015). Fla. 8638B and Fla. 8624 Tomato Breeding Lines with Begomovirus Resistance Genes ty-5 Plus Ty-6 and Ty-6, respectively. HortScience. 50, 1405-1407.
  87. Seah, S, Williamson, VM, Garcia, BE, Mej?a, L, Salus, MS, Martin, CT, and Maxwell, DP (2007). Evaluation of a co-dominant SCAR marker for detection of the Mi-1 locus for resistance to root-knot nematode in tomato germplasm. Tomato Genet Coop. 57, 37-40.
  88. Shan, L, Thara, VK, Martin, GB, Zhou, JM, and Tang, X (2000). The Pseudomonas AvrPto protein is differentially recognized by tomato and tobacco and is localized to the plant plasma membrane. Plant Cell. 12, 2323-2338.
  89. Shi, A, Vierling, R, Grazzini, R, Chen, P, Caton, H, and Panthee, D (2011). Identification of molecular markers for Sw-5 gene of Tomato spotted wilt virus resistance. Amer J Biotechnol Mol Sci. 1, 8-16.
    CrossRef
  90. Simons, G, Groenendijk, J, Wijbrandi, J, Reijans, M, Groenen, J, Diergaarde, P, Van der Lee, T, Bleeker, M, Onstenk, J, de Both, M, Haring, M, Mes, J, Cornelissen, B, Zabeau, M, and Vos, P (1998). Dissection of the Fusarium I2 gene cluster in tomato reveals six homologs and one active gene copy. Plant Cell. 10, 1055-1068.
    CrossRef
  91. Smart, CD, Tanksley, SD, Mayton, H, and Fry, WE (2007). Resistance to Phytophthora infestans in Lycopersicon pennellii. Plant Dis. 91, 1045-1049.
    Pubmed KoreaMed CrossRef
  92. Sobir, , Ohmori, T, Murata, M, and Motoyoshi, F (2000). Molecular characterization of the SCAR markers tightly linked to the Tm-2 locus of the genus Lycopersicon. Theor Appl Genetics. 101, 64-69.
    CrossRef
  93. Spassova, MI, Prins, TW, Folkertsma, RT, Klein-Lankhorst, RM, Hille, J, Goldbach, RW, and Prins, M (2001). The tomato gene Sw5 is a member of the coiled coil, nucleotide binding, leucine-rich repeat class of plant resistance genes and confers resistance to TSWV in tobacco. Mol Breeding. 7, 151-161.
    CrossRef
  94. Stall, R, and Walter, J (1965). Selection and inheritance of resistance in tomato to isolates of races 1 and 2 of the Fusarium wilt organism. Phytopathology. 55, 1213-1215.
    CrossRef
  95. Stevens, M, Scott, S, and Gergerich, R (1991). Inheritance of a gene for resistance to Tomato spotted wilt virus (TSWV) from Lycopersicon peruvianum Mill. Euphytica. 59, 9-17.
  96. Tai, TH, Dahlbeck, D, Clark, ET, Gajiwala, P, Pasion, R, Whalen, MC, Stall, RE, and Staskawicz, BJ (1999). Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato. Proc Natl Acad Sci USA. 96, 14153-14158.
  97. Takken, FLW, Thomas, CM, Joosten, MHAJ, Golstein, C, Westerink, N, and Hille, J (1999). A second gene at the tomato Cf-4 locus confers resistance to Cladosporium fulvum through recognition of a novel avirulence determinant. Plant J. 20, 279-288.
    Pubmed KoreaMed CrossRef
  98. Tang, X, Frederick, RD, Zhou, J, Halterman, DA, Jia, Y, and Martin, GB (1996). Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science. 274, 2060-2063.
    Pubmed CrossRef
  99. Tanksley, SD, Ganal, MW, and Martin, GB (1995). Chromosome landing: a paradigm for map-based gene cloning in plants with large genomes. Trends Genet. 11, 63-68.
    Pubmed CrossRef
  100. Thapa, SP, Miyao, EM, Michael Davis, R, and Coaker, G (2015). Identification of QTLs controlling resistance to Pseudo-monas syringae pv. tomato race 1 strains from the wild tomato, Solanum habrochaites LA1777. Theor Appl Genet. 128, 681-692.
    Pubmed CrossRef
  101. Thomas, CM, Jones, DA, Parniske, M, Harrison, K, Balint-Kurti, PJ, and Hatzixanthis, K (1997). Characterization of the tomato Cf-4 gene for resistance to Cladosporium fulvum identifies sequences that determine recognitional specificity in Cf-4 and Cf-9. Plant Cell. 9, 2209-2224.
    Pubmed CrossRef
  102. , (2012). The tomato genome sequence provides insights into fleshy fruit evolution. Nature. 485, 635-641.
    CrossRef
  103. Van Zijl, J, Bosch, S, and Coetzee, C (1985). Breeding tomatoes for processing in South Africa. International Symposium on Fruit & Vegetables for Processing 194, Strydom, DK, ed. Cape Town: Acta Horticulturae, pp. 69-76.
    Pubmed KoreaMed CrossRef
  104. Veremis, JC, and Roberts, PA (2000). Diversity of heat-stable genotype specific resistance to Meloidogyne in Maranon races of Lycopersicon peruvianum complex. Euphytica. 111, 9-16.
  105. Verlaan, MG, Hutton, SF, Ibrahem, RM, Kormelink, R, Visser, RGF, Scott, JW, Edwards, JD, and Bai, Y (2013). The Tomato yellow leaf curl virus resistance genes Ty-1 and Ty-3 are allelic and code for DFDGD-class RNA-dependent RNA polymerases. PLoS Genet. 9, e1003399.
    CrossRef
  106. Vos, P, Simons, G, Jesse, T, Wijbrandi, J, Heinen, L, Hogers, R, Frijters, A, Groenendijk, J, Diergaarde, P, Reijans, M, Fierens-Onstenk, J, de Both, M, Peleman, J, Liharska, T, Hontelez, J, and Zabeau, M (1998). The tomato Mi-1 gene confers resistance to both root-knot nematodes and potato aphids. Nat Biotechnol. 16, 1365-1369.
    Pubmed KoreaMed CrossRef
  107. Wang, JF, Stall, RE, and Vallejos, CE (1994). Genetic analysis of a complex hypersensitive reaction to bacterial spot in tomato. Phytopathology. 84, 126-132.
    Pubmed CrossRef
  108. Wang, H, Hutton, SF, Robbins, MD, Sim, SC, Scott, JW, Yang, W, Jones, JB, and Francis, DM (2011). Molecular mapping of hypersensitive resistance from tomato ‘Hawaii 7981’ to Xanthomonas perforans race T3. Phytopathology. 101, 1217-1223.
    CrossRef
  109. Watanabe, Y, Kishibayashi, N, Motoyoshi, F, and Okada, Y (1987). Characterization of Tm-1 gene action on replication of common isolates and a resistance-breaking isolate of TMV. Virology. 161, 527-532.
    Pubmed CrossRef
  110. Wijkamp, I, Almarza, N, Goldbach, R, and Peters, D (1995). Distinct levels of specificity in thrips transmission of tospoviruses. Phytopathology. 85, 1069-1074.
    Pubmed CrossRef
  111. Wolters, AM, Caro, M, Dong, S, Finkers, R, Gao, J, Visser, RG, Wang, X, Du, Y, and Bai, Y (2015). Detection of an inversion in the Ty-2 region between S. lycopersicum and S. habrochaites by a combination of de novo genome assembly and BAC cloning. Theor Appl Genet. 128, 1987-1997.
    CrossRef
  112. Yang, X, Caro, M, Hutton, SF, Scott, JW, Guo, Y, Wang, X, Rashid, MH, Szinay, D, de Jong, H, Visser, RG, Bai, Y, and Du, Y (2014). Fine mapping of the Tomato yellow leaf curl virus resistance gene Ty-2 on chromosome 11 of tomato. Mol Breed. 34, 749-760.
    Pubmed KoreaMed CrossRef
  113. Yang, W, and Francis, DM (2005). Marker-assisted selection for combining resistance to bacterial spot and bacterial speck in tomato. J Amer Soc Hort Sci. 130, 716-721.
    KoreaMed
  114. Yang, W, Sacks, EJ, Lewis Ivey, ML, Miller, SA, and Francis, DM (2005). Resistance in Lycopersicon esculentum intraspecific crosses to race T1 strains of Xanthomonas campestris pv. vesicatoria causing bacterial spot of tomato. Phytopathology. 95, 519-527.
  115. Yeam, I, Kang, BC, Lindeman, W, Frantz, JD, Faber, N, and Jahn, MM (2005). Allele-specific CAPS markers based on point mutations in resistance alleles at the pvr1 locus encoding eIF4E in Capsicum. Theor Appl Genet. 112, 178-186.
    CrossRef
  116. Young, ND, and Tanksley, SD (1989). RFLP analysis of the size of chromosomal segments retained around the Tm-2 locus of tomato during backcross breeding. Theor Appl Genet. 77, 353-359.
    Pubmed CrossRef
  117. Zamir, D1, Ekstein-Michelson, I, Zakay, Y, Navot, N, Zeidan, M, Sarfatti, M, Eshed, Y, Harel, E, Pleban, T, van-Oss, H, Kedar, N, Rabinowitch, HD, and Czosnek, H (1994). Mapping and introgression of a Tomato yellow leaf curl virus tolerance gene, Ty-1. Theor Appl Genet. 88, 141-146.
    Pubmed CrossRef
  118. Zhang, C, Liu, L, Wang, X, Vossen, J, Li, G, Li, T, Zheng, Z, Gao, J, Guo, Y, Visser, RG, Li, J, Bai, Y, and Du, Y (2014). The Ph-3 gene from Solanum pimpinellifolium encodes CC-NBS-LRR protein conferring resistance to Phytophthora infestans. Theor Appl Genet. 127, 1353-1364.
    Pubmed CrossRef
  119. Zhang, C, Liu, L, Zheng, Z, Sun, Y, Zhou, L, Yang, Y, Cheng, F, Zhang, Z, Wang, X, Huang, S, Xie, B, Du, Y, Bai, Y, and Li, J (2013). Fine mapping of the Ph-3 gene conferring resistance to late blight (Phytophthora infestans) in tomato. Theor Appl Genet. 126, 2643-2653.
    Pubmed KoreaMed CrossRef


December 2018, 6 (4)
  • Science Central