Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 1.

Table. 1.

The list of the primers used in this study.

Gel-based marker Primer name Sequence (5ʹ-3ʹ)
DFR DFR_F2 CCACCATGATGTAGTTCAGTTGTGAAC
DFR_R2 CACCGTTAAAATCGGCCGTTAG
DFR_LB2 CGGCTTCGTCTTCACCTGAAC

KASP marker Primer name Sequence (5ʹ-3ʹ)

AG1-KP-InDel-1 Allele-specific primer-1 TAATTTCTTCGTTTTGTTCTCGATGTTTC
Allele-specific primer-2 AATTTCTTCGTTTTGTTCTCGATGTTTT
Allele-specific primer-3 GGCTTCGTCTTCACCTGAACGAAA
Common-primer-1 GAAGGATTACTTATATGACACCTAGCCTT
AG1-KP-SNP-1 Allele-specific primer ACGTTACAATGGTTTGAGTATATGG
Allele-specific primer GTCTACGTTACAATGGTTTGAGTATATGA
Common-primer TTGTAAGGGTAAGGGTGGGACCTAT
AG1-KP-SNP-2 Allele-specific primer GAGACGGAGAAGACGGAGAAG
Allele-specific primer GGAGACGGAGAAGACGGAGAAA
Common-primer CCATCACCGCCAAGAAGTCATCTTA
Plant Breed. Biotech. 2021;9:20-31 https://doi.org/10.9787/PBB.2021.9.1.20
© 2021 Plant Breed. Biotech.