Plant Breeding and Biotechnology

Indexed in /covered by CAS, KoreaScience & DOI/Crossref:eISSN 2287-9366   pISSN 2287-9358

Table. 3.

Table. 3.

List of candidate genes with the SNPs/InDel detected by whole-genome sequencing between parental lines.

Trait Chr. Marker Candidate gene Locus ID SNP/InDel Position (bp) Ref (Nipponbare) Dodamssal Hwayeong Region
RS 2 CS02_001 Starch Branching enzyme 3 (SBE3) LOC_Os02g32660 19358818 T C T Exon
AC 2 CS02_001 Starch Branching enzyme 3 (SBE3) LOC_Os02g32660 19358818 T C T Exon
6 KJ06_005 Granule-Bound Starch Synthase I (GBSS1) LOC_Os06g04200 1765668 gtctctctctctctctctctctctctctctctctctct (ct = 18) gtctctctctctctctctctctctctctctctctct/gtctctctctctctctctctctctctctctctct (ct = 17/16) gtctctctctctctctctctctctctctctctctct (ct = 17) 5ʹ UTR
1765761 T G T Intron variant
1765799 A G A 5ʹ UTR
Plant Breed. Biotech. 2020;8:354-67 https://doi.org/10.9787/PBB.2020.8.4.354
© 2020 Plant Breed. Biotech.